Oryzias_latipes Locus RS3A_ORYLA
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RS3A_ORYLA
Oryzias_latipes
RS3A_ORYLA
1
SNORD73
3633..3704
4960
GTACAAGATATAATGAAATGTCAAGGTTACAAAGACATTATGAGGTGAAATGTGCTGTT
TAATGTCAGAAAAGTGGGTCTCCCAATCGGTCACAAGTAACAAATAGGATAATGACCCAA
AACACAAAACAGCTTTAACCCAAGAATTGCAAATAGCACCGGATTATACTTAAATTGACT
TCTGTAATACCTAATTTAATCCTTTTCTAACATCTGTGTAATGAGCTGGGACATGCCTTC
TTTCAACCTCTGGCAGTTAGAGCTGTGCTTATGATGAGTAGAGGAAAATGCTTGTTGATA
GGTGCAGAAGTCACTTTGATGATTGCTGATATCCTTTGGAGAGTCAGTGATTGTTATGTC
TGATTTTCAGTAAAACACTTTTCATTTTCACTTTTGTCCCTTATAAGTTGTTCAAAGTAT
TATTTTGAGGTTAATCCCATAATAATAAAATGGCACTAACATTTCCATCCATGTGTTTAT
AATACAGGAACATACATTCAACAACTGTCTGTGACATTTTTAAGTACAAAAGAAGAGGAA
CAGCATTTGTTGTGTCTGTGAGGTATTTTCCCATTTCAGAGCTAAGTTAAAATTACTTTG
GAAAAAAATGTATTTTTTACATTACTATCTCAAAATTTTTTGTAAAGCATGTATATATAA
ATTTACTTTGTTCTATTAGGACATTGATCTGGACCTAATAGTCACTCAACACTAGCTTTA
AATCAGAAATCACACTTATGAATAACAAACTATTTGGATTTTTTTAATGGTTTTAAATGT
AGCTGTTTTCAAAAACTATCTACTTAAGAAAATAAGCCTAGATCTGATTTAAAAAATTGT
TAGTGTTAAAACATAAAAGCACATTTGTTTGGAATGTCATCTTTGCAGTATACCTGTTTC
TAACAGCAGAGGGAGCTAATAAATATTCGAAGGGAAGACAAATCTCGCGACCCCTGACCG
CCTCCTTAATTCTCGCGAGAGTCCTTCTTTCCTCCTCTTTTACTCCCTTTAGCCAACATG
GCAGTCGGCAAGAATAAGAGACTGACCAAAGGCGGTAAAAAGGGTGCCAAAAAGAAGATG
TAAGTTTGAAATTCACGCATTAATTAATGTGCAAACTTTAGTGTTTTCGATATCTGTTAA
TTTGTTGTACGAAAATGGAAGGATGAGTCTGATAAAAAGCAGATGGTATGAAGTCGCTGC
TCGTCTTGTCGCCGGCCTGTGTGGCTCTGGATGGAGTTGTAAAGTGCTACGTAGTTTAAC
ATAACGTTTATACTCTATTTTATACATTAAGTATCATAACACCATATGTAGCATTAATGT
CGTAGTGGAGTTTTATAGACAAGAAAGGCTTCCGTGTATTATCACAGGTCAGATGGGACT
AATTGCTATGAATGCTAACTTACATGTTAGCATGTTTGTTTGATTTAGTGCGGCTGAAAT
GCAGCCAAACCTGAAAAATGAATGTCGCTATCCTCCTATATTTGTGGCCTATAGAAGAAG
TATCGGGTACAATTTAAACAGACTGCGTTCTTCATTGATGTTAAAAACTTTAAAACTTAA
AAAGGTGACTTCCAAAAGCATGATGCTGTGCAAAGCATGCTAATGCTAAACGGAATTTAC
CAAACTAAAGTAAATTAAACTTTTTCCCCTCTGTCAATTGGATTGTTGTGAGTTCCTTAG
ATCATGTTTTCTGTTTTTTCAGCGTGGACCCTTTCTCCAAGAAGGACTGGTACGATGTCA
AGGCACCAGCCATGTTCAATATCCGCAATCTTGGCAAGACCTTGGTTACCAGGACCCAAG
GAACCAGTAAGATGGTCCATAAATTTACAGATGTCTATTTTTCAGCAAAAATAGATAAAC
TTGTCTTTAAACATGACCCAAGAGTATCATATAACAGTGTATACCGTAGCTGCGTATGTG
GTAAAACATGTCCAGATTTTATTCTTGCTTGTGAGATTTAGTTCAATTTCTGAGCTGTTT
AACTTTCTACCACCCAGAAATTGCCTCCGACGGTCTGAAGGGACGTGTGTTCGAGGTGAG
CCTTGCTGATCTGCAGAACGACGAGGTCGCCTTCCGCAAGTTTAAGCTCATCACCGAGGA
TGTTCAGGGCAAAAACTGCCTCACCAACTTCCACGGCATGGACCTGACCCGGGACAAGAT
GTGCTCCATGGTTAAGAAGTGGCAGGTAATGTTTTTAAGATTCATTATTCAATCTTGTTG
TAATAAAGCTTTGGTGCTTTCTGCTGGTTTCTTAAGGCTTTAATTAGATTTACAATTTGA
AGTATTTCTCAGTGGAAAATGCTCTAAAAGCCAGTCGGGTCTGTTAATGTGTCCTCACTT
TCCAGCTGAACTTCCTAAGGATGACTTTTACGATGAAACGTTATTTTATTTGTGTATATT
CACCATTTTGATCCCACCATAAGGTCACAACAGGTGGAGGCTTTTTCTTACTGTTAAACA
GGTTCAGTTTATGGCCATCTTTCACGTCTTTCAGTGGTAGCTCTTTAATAAATTCCCCGT
CACCCTTGTGCTCTGTTCTATGCAACAGGGTGTCATTTCCCCCCAAACCTTTGACATGCA
GACATGTATAGTTACTTTAATAATAAAACTTTAAGTCATGGTTTGTTTATATTATGAAAG
ACATGGCTTATTTGTAATTTTGTTTCTTCGTGATTCATGAATTCTCAATTAGAAAAAGTT
CTTTTGAATATATGTTTGTGTATTTACATGCAGCATGTCCCCAAAAACAAATCGGATTTG
TGATTTTGTAAACCGTTTTAAACACAGAAAACATTTTGAACTTGGCTAAACTAAAACTTG
GTCTTATCTGCTTACTGTTGGGTTTGGACTGTTTTTAAATGCAACAGGAAATCGCTGTTG
GGTTGACCTGATGAAAAACATTTAAGGCTAATGCGGCCGTACTAACATGAACCCCTGATT
TTTTTTCAAACCTGTGTTTTATTCACAATTTCTCCAGACCATGATTGAAGCCCACGTGGA
CGTGAAGACCACTGACGGATACCTGCTGCGCCTGTTCTGTGTTGGTTTCACAAAGAAGCG
CAACAACCAGGTCAGAAAGACCTCATACGCCCAGCATCAGCAGGTCCGCCAGATCCGCAA
GAAGATGATGGAGATCATGACCCGTGAGGTTCAAACGAACGACCTGAAGGAAGTGGTCAA
CAAGCTGTAAGTTAACTGCATGAAATACATATTTTCTGTATAACGGCAATATTTTCTTTT
CTTTGAATTAATTTGCGGTGTTGGATGTTGTACTTCAGGATCCCTGACAGCGTTGGTAAG
GACATTGAAAAGGCCTGCCAGTCCATCTACCCCCTACATGACGTCTACGTCCGCAAGGTC
AAAATGCTGAAGAAGCCCAAGTTTGAGTGTAAGTATTTCTGAGGTTCTTTATTGGGTCAA
AATGTTGTTTCACCAATCAAAACTGCAAAATATAATGGAAACAATTCCACTTCATTTAAA
AATAATTCAGGTGAGCAGTTGGATTATCACAGTAAAATGTAAACTTTGCTTTAAAAAGGC
TTTATTGCAATAGGTTTGGTTCTAAATACTGAGCAATGATATGCACATTATTATGATTGT
GCGTTTGTTGTGTAGTCCAACTGCTCCTTTGGGAACGTGTGATGACATTTTGTTTCGGTC
CCAGATGACTGCCTGATTACTTTTAAATTGAGATCAACTGATGTTCCCTTATGAAGCAGG
GCGTCATGCACTAAATGTTAAACCTTGCTTTACAATTTTAGTCTGTTTTTAAAGCTTTGT
CTTTGTGTTTGAACACAGTGGGCAAACTGATGGAGCTGCATGGAGAGGGTGGTGCAGGCG
GTGCTGCAAAGGCATCTGGTGACGACACTGGAGCCAAGGTGGAGAGGGCCGATGGCTATG
AGCCCCCCATCCAGGAGACCGTCTAGGAACATCCCAACAGATTTAATAAACATTGTAAAT
GACCAAACTACTTGTGTTTTCTAGTTACCATGACATTTTCTTTGCACAGAACATGTACTG
CAGTTTTTTTTGACTCCCTAAAATTGTAAATGTTTAATTATACTCATCTTGTAGACTTAA
AACTGTCAGGGTTGTTGTAAGCTCTACTCAATATAAAAACTATCAGACTAGGTATATAAA
ACTAGACTGGCCATTATGGTCTTAAAATGTAAATCTACCTTCTTCCAACATCAGTTTGCA
GCCACAAAATCCAAAAAGTCATTTGTAAACATTTTATTTTTAATTCACATAACTTAAACC
ATTAAAATGCATTACTGTTGGAAAAGGTTTAACTGCTTAGGATTACAAAACATTTAATAG
ACAGCAGTTTAAAGATGTTCCATCAACTCAGCCCCACATCTTTGCAGTGTTTGGCCTCAT
TGTAACACTTGGACATAGTTTTTAGGGACCAGAGCTCTTTTTCCTCTCAAGTCTGCCAGA
AACCATTCTTCATCAACAGACTCCACGTTGGTCAAGATATCACCAAACTGTAAAAGAAGA
CTTTGAATTGATGCTTTTATTCAGCAGAATCTTGCAGGAAAAGAAAAAAAAAAGGTACCT
GAATTGAGAGTTCTTCATCACAGTCTGATCTAAAGTCATATAAAGCTCTTGCTCTCATTC
CACCAGCAGCTTTACTTCTCAGGTCAATAGTGGGCTGTTCTTCTGTAACAAATAGGAAAA
AATAGTGAACATTTTAGTTCGAATTTTTTTTTTTTATTACAATTAACTGACTAATAAAAA
CAGTTAAATGTTGAAAATAGGATCTTTTTTTTCTAAAAACAGGCCTACAAATAAGCTAGA
TCCCAGTGTACCTATTACGGTCTGAACATAAATCCGGGGGAACATGCCCTCTCTGCCATT
CAGTTTGCCACAACTCCACTTTTCATCCAAGTGCTTGGTCATGAGGATGCGGTCACCTTG
GCGAAACGACAGGTCGCTGGAAGTCTTTGCTGCATAATCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1078, 1702..1805, 1997..2184, 2977..3185, 3278..3387, 3798..3960
1017..1078, 1702..1805, 1997..2184, 2977..3185, 3278..3387, 3798..3922
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved