Oryzias_latipes Locus ENSORLG00000016535
snOPY snoRNA Orthological Gene Database
Oryzias_latipes ENSORLG00000016535
Oryzias_latipes
ENSORLG00000016535
17
SNORD66
14038..14113
21083
ACGTAACGTTTGCCGGCTGTCGGCTAACCACCATGTAACCCAATTCGGCCTAGATTGCT
GCCGCACTTAATAGGCCGGCGAATACATTTCATCCTACATACTTATAAGACGTGATAATC
TTTTCGTTGAGGAACTGTCATCTTTAATCACGATTCACAAGCCTCTTATCCGTCACCACC
GGGGGAACCATATGGTAGCATTGTTCGGTAAAGCCTTCGAAGCATGGTCGCTAGCTAGCA
GCTAACGAGAGTTCGTGTGTCAGCAGGTGGATGTTCTGTGACACGTCTACTAGCTGTATT
CACGACTTTTGATTTTTTTTTCGTCTGTTCAATGTTATCTTTACTGTAAAATCAATCAGA
TACTGTTAATCGACACTAACTTGGTTTCGAAATAGTTTGCCCACTAGAGTAAACCTATAG
AAGCGATTGTTAACACAGAAAATGAACTTTGACCCCCCCCCCTTTCCTTAACTTTAAAAA
TTTAAATTGGGCAAATAATTCCCATCTGATGGTAGATGTCCAAAGGTTGAGGACTATCTT
GTTCTGTGGGGCCTAGCTGTATTCACCTCCTGTTTCAAGTCATTCTTGGGTTTTCTCTGT
GCCCTTTAGTAGGTCAATGTTTTTGCCTCAATTATGGATATGACTTAAGTTTAATGAGTA
GAGAAAGGAATCTTAAATGAATAGTTGCAGTTTTTAATCGAAAGATCTTATGCATTGTTT
AAGCAAGTGGTTCAGATTGAAAAATGACTTTTCTGGAGGTGGTGTTACTGTTATCATTAG
GCAAAACCACAGGCCACACCCATTTTATTTGTTCCATGTTGCCACACATGCAGAAATGGG
CCAGTATGTGCAGATCTAAATGTCCTGCTATCCTAATTTGTATTTGTAATTCAAAGTAAA
TTATTTGCAGCTTCACCTAAAATGCAGTTTTTCCCCCTTCTCTCTTAAAGAAGGCTGGCA
ACACACCGCCACCCTAATGCAGACCCATAAAAGAACGTGAAATGAACAAGCCACCGCAGC
CTTTAACGGGACCTACTGCTGTCCCAAATCCGTCCCCATCCCCTGGATTGACACAGGTGA
GATCCACTTAACATACATTTTTTTTAAGTAGGTTGGAGTTTATTAACAAACGTTTTCTGT
TGTCTCCTTACAAGGCCGCTTACGGCCCAGGACAGCCCCCTTCTCTTGTCTTTGCCCCCC
AGCAACCCCCACAAATGACTTCTGCTCAACAGCCAAGACAGGTAATGAGTATAACTATTT
AAATCTTATATTAAATGGTTTTGTCGTCATCTAATCCGCACTGATGGAGGTAGTTTATAA
ATGTGCTACATATTTAAGAATGGTCTTTTCCTGTGCTTTAAATGTAAACATGTTTCTTCT
GCTTTATTGCTTTGGCTTAATGCATGCGCCTTGTCGCTTTGCTTTATTCTTCAATGTTGG
TCTTGATTTATCCTCTCTGTCCTTTTTGCCGTTCTCCCAGTTTGCCACAGGGCCCCGTAC
TTTACACCAACAGGTACTAACTTCCCTTCAGTATTCCTTACATCCTCTCTGTGTTCTTAG
GTTTGTGCACATTTTCGCAGCTGAAAATCGAAGAATAGCTGCTTTAGAGGTTTACATGCA
GTTTTAAAAAAAAATGGGATTTGGCCAGGATTTCTAACTTTTACAACCATTGAAGTAAAA
TGTATTAAAAGCAGAACATATTTTCTATTTATTCTAATTATGCATCTATCTATATCCATA
TATGCTGTAAACTTCTGTTTTTGTTTTTTGCAAAAAAATAAGTTGAATATTTTAGACATC
TCAAAAGTAATTAAAGTAGCTATATATTTTGATTTTCTTTAGTCTTCCCATTTTTATTTT
TACTGGTTATTTATGTAGAGTTGAATTTTTTATAATGGTGGCACATAAATTTGAGTTTTT
TGTTAGATAACTGTCACAGGAAGCAGGATATGCCTGATTCCAACTTCTGCAAATGGAAAG
GGCACTGCCATGTCATTCATTTCTACAGCTTTTTTTTTTTCCTTTTTCACCATGTTCCTG
TTCTTTGCACACACAAAATAAAGTTTTTCTTTTCAATTTCATTCTTAGACACATTTTTTA
AGAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCCCCCCCCCATTTTTCTTCTTCAACCATTTTGCAGTGAAATAGTTTGACCAACA
GTAATCGATTGCTGATAGTAGTTAAACAAAAGTGACAATACGATCTTGTCTTAGAAAGAC
CTGTACATAGTTGGCCCTTTATGGGAGTTCGAGATCACGTTTTCTGACCACAAAATATGC
TGCTGGCTCTTTTCTCTCTTGTAATCTGGGCCTTCCTCATTGTCTTCGTTTTCACCTTAA
TCTCATACCTCTCTTGCTCTCTGCTCATGTGTTGTGCGGCTGAAGGGTGGATACAGAGCG
CTGCAGGTAACAGCTTTCTCTCTAAACGCTAAACGCCTTCACGTCACTTTTGGTTACAAA
AATGGATTTTAGTGTGTGAACAGCTTCAGGATGAGGCTAGATTAGTATCTAAATGGAAAG
TCACACGTTCAAAAGTCAAAATATTTCCAATGTGAGTCAGGATGATTTAAGCTGACACAG
CACAGAGCAGTAACGCTGTCTCTTCTTCATGAATCATTTTTTACTTCAATTTTTTGTTCT
TGTTTCCAGACTTACTATCAGAACAGACCCGCAATGGCCGCCAGTGCTCCACGGGTGCAG
TCGAGTAGTGGCCCTCGGCCCGCCGGGCCTCTGCCTGTCTACCCCGCCAGCTCCCAGATG
ATGATGATCCCTCAGCAGCAGATTTCTTTCGGAGGCTCTCAAAGCTACTTTATTCCCCCT
GGACAGGTTCGCCCATTTAAACCATTTGGCTCTAGTAAATATTGTCGCTCAGCTCCACAT
AACATGGAGTTGATGCTTTATCATGTTACAGTAAGCTAAATAAAGCATTCAGTAAATAGA
TGTCATTGGTTTAAGGGAGACGGAGGTTTGAAACTTTCACATTAGTTTCTCTAAAGTATG
TATGTTGGGGAGTAGGGCTGGACGATTTGAGGAAAACTCGCAATATGAGATATTGGTGAT
TAATATTGCGATAAAGATATAATTTGCGATATATAAACAAAGAGCAAAACAACCAAAAAC
CTTATTCCCATTTCATTGCAACAGTTCAAAGATTATGCTCCAAATGACCCTCGTCGACAT
AGGAGGCAAACAGCTAACATCATAGGGCTCCATCTGATTGGTTAACAACGTGAAAGGGTC
CATCCGATTGCTTCAAGTTGCCATAAGATTGTTTTACCACATTTAGGTTAACCATTTATT
GCAATTTTCGTTGTCTTTTGCGATATGCATATTGCACAGCTTGATATTGCGATAATGAAA
CATTTGCGGTATATTGTGCGGGCCTATTGGGGAGGTTTGTTCTTTTTTGTTTTGTCTTTT
TATTGTTTATAACTTGTTTTTTTGTTTTCTTTTGGTGAAGTACCGGGCCCCATACATGAC
ACCTACCCAGCAGTATCCTGTGACCAGTAACACAGGCTATTACCCTGGAACAAGTCCTGC
AGAATATCCCGGTTTCGGTAAGTTTTTCTTTTTTTTGTAATGTTTTATAAACTAAAAATG
AATATCAACCAAGCACAACAATGAACTGGATTCTCATCAGTAAAATGGCATAACTCACTA
AACATCAAATTCCACCCCAAAAAATCATTAATTTGTATTTTCTAAGTTCAAGCTATGGTA
AAATCATAAATTGTGAGTATTGCCTCTAGATTTTATCCGTTTTGCTTGGTTGCTTGTTGG
GCTTAAATGTTTTTCTGAGTCTAAACTCTTCCATGTGTATTAACTGCTAGATGCTTGTAG
TCTGGCTTGCTTGGCCTGTCGTCTATCTATCTGCAGTTTCACCTGACGCTGGCTTGCAGG
TTCCATGAAATGGCTTTTAAACCTTTCTTAGGTGACCAAAGGTCATACGATAGTGGCGCG
TGATCAAGTATGATTGACACCTTGGTGTAAATACCAATAATATATGAGGCGGGAACTTTC
AATGCTAAAAGAATTTCAAACGCACCATCCAGAACCCCCACTTTTGACCGCTTTTTTAGG
TTTCCAGAGGAAAAGTAACAACCCTGAGCGTTTCTGATTGAGTTGCCCGCAAACAAAAAG
TATTTTCTGTCAACATCATCTTAAGTTAAATATTTCAAAACTATTTGTATCAAGTTTTCC
CTGCAGGACCGTGTGCTGCTACTTGTAAACACAGTAATCCACGTTGTTGAGTAACGGCTG
CTGCAGTCGACCGGGAAGATGTAAACCAGGAGGGATGATGATCTGGAATGAATAACAAGA
GAGAGGAGGTCTGATAGTCGGCACAAGTGTGAGGTTATAGCTCAACGAGGCCATTAGTCA
AACCCCCATCCTATACATGTTATTTATGCAAAGAAAAAAACAGATGCGTTTTTGTGTCCA
GCTCAGCTGTTGAAGGTTTAGTCTTTTTATAACCAAGTGTGGAATCATTCAAAACTGTTA
AACAAATCAAATTAATAGGTTTTGAGCCTTTCATATCTCTCTATATCTTACTTTCATTGC
CTTGCAAACTGGTATTGTCCATGAACAGAAATGGGTAATGTAACTCAAACAGCCTTTATG
ATTTATTGGCTGTGCGAGCTGCGTTCCATCTGAAAAGGTAGCAAAAACCCAGTCAGCAGA
ATCTTCCTTCAAAGGATTTCTGTCGTGCTTTTACTTGTTTCAGCAGATCTACGCAGGAAC
ACAAAATATTAAAGAAAATTTGATCAAATCAAACATGTCCTTTTTATATTACATTTTAGG
CCAACACGTGTATTTAAAACAAACATTTAAAATAAAGCACACTTTGAAATGATTCACTTC
GTTACATAAGTAACAAACTAAAAAAACATTTACCGTAATTTCCGGACTACAAGCCGCTAC
TTTTATCTTGCGCTTACAGCCTTGCGGCTTATTCAGTGACGCGGCTAATTTATGGATTTA
ATTGGCGGCCACCATGTACGTACTTTCGAACTCAGTGAATAGTTTGAATTCTCTATCTAA
CACCAAGCACGAGGCATTTTTATTCAACACACCTCTTAGCAGCCAAACAGCATGGAGTTG
ACTTCAGGTCTTAGACACTTCAGTCATGGTTCAACAAAACGAAACACGCATGCCCGGCCG
CATCCCAGAATCCTTTGGGGCCATTAGACCCAACGTGCACGTGATCGCCGCTACATTATG
ATGAAGCTTTCAAGTTAAAAGCAATCGTTAAAAGCAGCGTAAAAAAGTCCACCTTCACCA
ACGGGTTTGGAAAAGCCGGTTTGCTGCGTGACGGAGAGAACAGCGCATGGAGTGAATTTA
CACTCCATTTACGGTTTCTAAGGAAACCGTAAAAGCGGAATTTTGCTTTGAAAAACTCAC
AGCCTCCGTGTGAGCTGGAGACATCTTCTCCTGCCGATTGAGCTGCGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCATAACGCTGCTGCG
ACACAAGCGGAAGGAGAGCTTTTCCCGTTCACCCCTCCATGCACTGCTGCTACTTGCTAA
TTCTTAAACACGTACAACAGAATGGCGAGCCGGGCGTTGGCCCCGCCTTTAGCCCCTAAG
ACTCATGGGAAATGTGGAATCGCGGATGTAAATTTCCTCATTATAACTGAGGGATGTAAT
GTTGATTATATGGTTACTGTTTGTAATTTTATGTTAGATACCTAGATTGTCAATAAGTAA
AAAAAAAATGAAATAAAAACACCATAACTGAGGGACTTGTGAACAGAATATAGGTCCATG
CTGTTTGACAGATGTCTATACTATCAAATACGTGACCCAGAGTCAAAACTGTCACCACCC
ACAATGTGCTAATAAATTGCACTCACTCTGGGATGCTGGCCGTGATCTGTCTGGATGACA
ATATCGGCTAACACATGCGCGGCTTGTACTCTGACGCGGCTTGTGTATGTATAAAAGCAG
TTACACACGTGAATATGGGTGGGTGCGGCTTGTAATCGGGTGCGCTTTGTAGTCCGGAAT
TTACGGTAAATGGCCTGTAATTTGATCATACAACAGCCCCGTCGTGTGTCTAAGTCTTTT
AACTTGCCATGGAAGTCTTGCCTTTGTTAAAGCTAGTCTTTATTTTGTAGGGTTCTATTT
TAGATTCTATTACAGAGTAGAAATTAGGGTTGCACGATTTGTGGAAAACTTGCGATATTA
GCGATCAACATTGCGCTGATGTTGTCTAACGAAACATGAACAAATGGCAAAACAACAAAT
AACATTGTTTCCATTTCACTGCAGCAGTTTTCTTTTAAATAAGTCAACATAACTTCAGTT
ATACTCCAAAGGAACCCACGTCTACATAGGAGCTGGACATCCAACATGAAAAGGCTCCAA
TTGGTTGATCAAGGGATCCATCGATTGGTCAAATGCATAAATGGATTTAAATACTTTAAG
CTGCCATGAGATTTTTTACAATGTGCGTAAACATTTAAGGTAATCACTTGCAGTTTCATT
ACACTGTCTTTTGCGATAAGTGCATCAAATAGACTAATATCGCGATGACAATAAATTTGT
GAGTCAGGAATACAGTGAAGAGATGGAGGAGCGTAGATCAAAACAGCTTTAACCCGGTAG
ACCTCATAGAATGATGTCAAGCCTGTATAATTAGGACGGTATGAGGGATTTATTGATTTG
TCAATGGGGTAATTGGGATTAAGGATATCAGATGTAAATGATACGAATAGAAAGGAAACT
CTGTCGAACAGGAACTATTGAAGCGCTTTTGACCCGTCAATGCAATAAAAAAATCACACA
AATTTATCAAACTCATTACAGAGATGATGAAATGCATGGATAAGAAAACAAAAACAAAGA
TACGCTTAAGTCACATTAACTCAAGTCAAGTAGAGCTTGATTTATTGCTTTAAAAGAAGT
GGGAGGAAAGGAGCTTTGCCAAAAATGTAAAAGTATTTGATTGGGAATGAGTTCAGGGTC
AACCCAGCCAAATTTTCTGTTTGGTGCCGCTGCCCCCCCCAAAAAAAGGTTTCCCTTAAA
GAGCCACCCACACTTGAGCTTTTTTAACATGTTCTTGTAGCATTTCTGGGATTATGGACG
ATGGATATATGGAAAATTAAGCTTAATTTCATTTCTGGATATTTCTTTATTTAAATTGTT
GGGAATCAGGAGCAGAATGAAAAAATGCTGTTGGAAAAAGCTTTTAGCAGTGACATAGAT
GTTAGTATCGGCGGGCCGCACGCTCCCTGTTCCGCTCCATTCTGATGCGTCCACTTGTAA
AAGACTAGATCCATGTACGTCTCAGTTTTCATCGTCCAAACTGGCATTTGGCTCAAAACT
GTATGGCTGGATAGCTCCGAAATTGCTCGTCATTTTTATTACACCGGTAATGTTAGGTTG
GGGGTGTAACCTAGCGAGAGAGCGTGATGATTAGATGATGGGATGTAGGGGCAGGGTTAC
TCTGCACCAACGGTCCTGCCCACAACTCGGAGGAGAATTTCTAATGCTGCTCTGCAGAAA
CTTGGTCTTAGAAAACGACATATTAATATAATTATAAGTAATATAATTATTACAAATCTG
TAGCAGTAATCAGTAAGCCCCTGTGCATTTCATGGGACCTTCTTAACACCCTGCTTCCTG
TGGATCCTTTCATTAACTCATTCTGCATCTGTCTCTTCCTGCCCTCTTTCCTTATTTCCT
CCCTGTCCCGTCCCTCACTGTCCTCCTCTTCCTTGCTGCGTTGGGTCAGAGCCCTCTCTT
GCTGCGAGGGAGAGGCGGGGTGGTGGGGGTAGAGGGGGTGGGAGAGAGAACAATCGTCTC
TCTCTTCACGGCGCTCCTCTTACCTCTCAGCGCTACCCCGGTGAGTAGTGCGTGCGTGTA
TGTGTGTGCTTCTGTGATGGTCAGCGAGCTTTCGTGGCGTGACTCGGTGGCGCTTCCCGT
CTGTAATTATCTCCCATCTGCTGTCTTATTACGCCCAAGCAGCTTTACTTTTAGTTGTTC
AAGTGTAAATGTCTCCTCTCAAATAAATGGAAGAAACTCTCCAGTTACAACATCCTGATT
TTCAATGACGAAACCTGCTGTCATGTGATGGAATCACCTGAAAACATTTTTAAGCCAACT
TTGAACACGTAATGGCCATCAAAGATCACTTCCCCACTCTAAATTAAACCTGCAGTCATG
TGATGTGCATTCACTTTAATGCTTGAAATATAAAAGAAAATTGCTGTAAATAAATGCATC
AAACCCCAGCGCTATCTTTAGAGCGCTGTTTTTACAGCACAGTTGGCCAGCAGCTCTGTT
TGTAATAATAGCTGTGGAGCCCAAACTGGTGTGAAAATCAGGCCAAATGTTACCAGGCGA
TGTGTAAACAGAAGTTTATGCATCTAAATCTTCTATTTCTGATTTTTTTTTTGTAACTTC
TGGATTTTAAAAATGTTTAATATCTTTAGCACCAACAGTTTTACTTAACCAGTGTCTGAA
AAGTTTAAAATGATATGCGGAAACACACATAGAAACTAAACATAAACAAGACTTTTCACT
GCTTTAAATTAACAACATATCGTAGAATCATGTCCCTCGGTCATGGTGATTTTCATCTTT
TTTTTTATTTTTTATCATTTTTTTTTCTTTATCAGCAGCATATTATCCAGCTCAGCCACA
ATATCCTCAATCGGTCCAGACCACACCGGGCATGATCGGGCCAACTCAGCAACAGCAACA
GGCTCCGCCCTCTCAGCAACCGCAGGCACCTCCCCAAGGCCCGCCGAAGAGGGAACGGAA
ACCGGTACGGTACCCTGACCAGTTATGTCTAATGTAACCTCTCCACCTCATTCCCCCCAA
TTTTTATGGAGGAAAATGTCCACATTTAGACTCCATTAACTCTGAATCTCTTCAAAGGGA
TGCTATCTCAGCGTTAGTTTCTATTATTTTAATACTTTTCTTTCTACTGATATGGTTTTA
ATTGAGAAATGTGTTGCATCGCTGACAGATAAGAATACGGGACCCAAATCAGGGTGGCCG
TGATATCACAGAGGAGATCATGCAAGGTGGAAGGTCTACCACCACCCCAACCCCCCCACA
GGTAAGACATGAAGAAAAGTCTGTGTTGTCTTCATAAATCTAAAAAAAAAATGAATAATT
GCTATGAGCTGTCCAAATTGTCATGTTTTAACACTGTAGAAAGGTCAGCCCTTTTTAAGA
AATGTTTGTGATATGAAATATAGTCTCAGTGCAAGAAAATGTAACCTGACAAAAAGGAAG
AATTTCTTCTGTTTTTTTTTTTTTTACTTTTTCTCTTCAGTTTGGTGTCTGCACTTAAAA
CAAACAATCCCAGAATTTGGTTCACCTTCCATTGATGACTGGAATAAAAGATGATTTACT
TTTTAGTTCTATTCCATTTTTACCAAAAAGGACTTTTTGTACCATGTTAAATGAAATTCT
TTACTTATCAGTGTAATAATTTATGAATAATTATACTCAGATTGAGACGAAAGTATTCTG
ATTTATCAATTTTAACATTTGTCTCTCATAAAGCCTTGATACTTTTAAAGCCCCACGATC
TATTTGAACCCACAAGAACCCATGGTGACATCAGTGGAGCAGAAAAATGACAGAAATGAA
TTCTGTGGTCCACTTGGGTTGTGGCAAAATACACATGATTTTATTTTTAAGAAAAAATGG
CTCTGGGTTCTTATTGGTTAAGATCGTTTAAAGTGGTCTTTTAATTGTGATTATGCTGTT
TTTAGCTGAAATTTAAAAAATCGGTGTAGTTTATTAGAAATTCACCTCTTGGTTGTGGGC
AGAGCCGCTGGTGCTGAGCAACCCCGCCCCCCCTTTCCCTCCCTGTTGCTGAGCTCAGAA
CGGGAACCATATTTTCTACATCACAAATATGTTCCATTTCAAATGATATTTTTTTTGTCT
GCTCTTGATTCACAACGATGTAAATGAACAAATATTCAGAAAAGCAATTTTAATATCAAT
TTTTATTTGAACATGTGCCATCATGTGAAAAATGCCTCAAGAACATGTGGGGTGGGTCGG
AGTTTGACCTTCTTAAGGCAACAATCTTTGAGTAAAAATCCTGACTGGTATCTCTAATTG
AATTGTAACTATTATGTCACACATTGTGCTGACGGTATTATAGCACCTTTTTTGTAATAA
CTGCCACCTCTCTTTCCTTGTAGGCCTCTGCACCAGATACAAATCCAGTTCAGACCAACG
GTGAAGTTCTGCCGCCTGTTAGTGCAGACCCAATAAAAGGTGTTTATCGTCTCTTAAATG
ACAATTTTACTTTTCCCTTTTTATTAATTTGCTTCATGTTTGTGCTGTTTAGAAGAAAGC
ATGTCTCTCCCAGCAAGTGCTGCAGTCCCTTCACCTTCAGCCACAGAAGCCATAGAAGAG
GTTGTACAGGAGGTGGACAGGAAGACCCCTCAACATACTGACATAACTGCACAGCCTGTC
GCTGCTCCTGCTACCGAGGAGCCGTCCACGCTCCAAGACTTCCAGCAAGCTGCGCCTTCC
CTTGCTCCAGAAGCTACCGCTATGGCTGATGTCCCCGAGGCAGTAGAAGAAGGGAGCGAC
AAACCTAGCGACACGGTCGATTCCCCAGTCGTGCCGCCGCCGCCGCAGCAGCAGCAGCCA
TCAGCAGGACAAGAAATTCCTGTGGAAGCTGAAGAGCCACGAGCTGCTTCACCTGAGAAG
AAACCAGAAAATGAAGAAGAGAAAGAAAACGTTAAGAAATCAGAAAAAGACGAGCAAGTG
AGTAGCACTAAGGCGGCGGCTGCAGTTGAGGTTCCAGTTCCTCCTGGTAACGTGGCTGAA
GAGGAAATGGAAGCGAAGTCAGTTGCTGAAGTCTCCGAGCCTCCTCCCCCCTCTGAACCA
GAGCCCGCTGCTCCACCTCCTGAGGACGTTGTTCTGCACTCTCCGGCGGATCAAGAACCC
ACACAGGTGGAAGCAGAAGCAGCTCCTCTCTCTAATGGCCTTCCTCAGGAGACTGAAGAA
CTGTTTGAGAAAACTCCAGTTTCAGACACTACATCCCCAGACGAGTCCAACACTTCTCCA
ACTCAGGAATCAACACCTGCGGTGAAATCCGCCGCACCAGCCCAGGTGGAGGAGGACAAT
AAAGAAGAGCAAAAGAAGAAAGTGGACGACACTCCTGCCTCGGTCAGCTGCCCAGAGGAA
TCTACTATGCAAAGTATGGAAATGTTTTTTATTTACCATCTTCCTACTGTTTAAGGTTGA
AATCCAAACCGGTTTTTATTTCCTTAAAGCTGCTACATCTGTGCCAAAGAAGAAGAAAAA
CATGAAAGAGCTCAATAAGAAGGAGGCCATTGGGGACCTCTTGGATGCCTTTACCGAGGT
ATGCTTCATTTCAGGTGCAGTCAGACGCTGTTTTTTCTCTAGAGAATCGGGAGCACTGTT
ATCGCCTTATCCTTTGTCACTTGAAACCTTTTTAACATCATCTCTCTTTCAGGAGCAGCG
TGCCAAGCCTGTTCCTGAACCTTCACACACTCAGGCCAACCCTCCAGCTCCAGCTGAACC
TCCCGCAGAAGCAGTAGATGAGACATGGGAGGAGAAGGAGGACAAGCAAAATGCAGATCC
AGAAAAAGAAAAATCCCAGTCAGAGCCAAGTGACCAGAAGTACCAGTACAAAGAAGGTGG
GTAGATGTTCTCCAGTCTTTTCCATCTGCTCGTAGAGGTCTCCTGTTGTAACATTAAAAA
AAACACATTTCTCAGTAAGAAAACCAAAGTGGAAAATGACACATAATTCTTTAAAATAAA
AACGAAGAGTTTTTGTGACGTAGTTTTGTATTTACGACCAACGCTTTCATCCATATAGAT
GTGGGCGACCAAACTTCTTTAAACTGAAGCTTTCCTGTTTTAAACAACTACAATGTTCCA
ACAGTGAACATGATAGAAATGAGTAAACCTTTTATTTCAAGCTGACAGACCTGACTGTTG
TCTAGCTTATGTCTGTAGAAGTGACTTCAAAAGACAAATCGCTTCTAAAATCACTTTAGA
AGTAGTTTTCCCAAAAATTACAAAGGAAAGTAAACGCAAGTGTTGGTATATTAGCATACT
TTAAGTCAAAGATCCCCAATCCTACCGATCTGTGGGTCACTTAGGGGAAAAAAAGGATAG
TGTAGCGTTGAAATTATGTCTGCTTTTGCTTATTTTCTGATTCTAAAGCAAACTATCGGA
TTCAGTCCACCACATCTATATGTTTATGGCTCACTCCTGATGCATGTCATTTGCCTCGGT
CACGTGTCTGCTACTTTCTCAAAGACAGAATGAAGATTTGAAACAAAGTGGCTGACTTGT
GGAAACTTGTAAAATTTAAGAATTTTCCTTACAGCAAAACTGAAGTAGGGAGGCATCTGT
TACGAAACTTTAGCACAAAAAAATTCTGCCCTCTGTGTTAGAGAAATGCACAAGATTTAT
TCAAAAACAAATGAGTCATCTTTTTGCCCGAAAGATATGACCTTGAATTGACTTCCCAGT
TTTAAATTGACCCTATGGAAAAGAAAATAACAATCTTCCGTTTGGTTGAATTTTTGCAAA
TCAGAAGTAAATTAAGTATTTAACCTTTAAGGACACATGCAAAATATCTACAGACAGTTT
CAGTTTTTTAAAATGAAATTGCATGTAATAGCATTTTCATTTGAAATATAGATTTTTCGG
AAAACCAAAGCTTAAATACATTAAACACTAACTTCGGTCCCATTTGGACCGCTTTGGGAA
AATATTGTATGACGTTAAACCTGTCCGTGGCCTAAAAAAGGCTGCAGACTGCTGTTTTAT
ACAACTATGAAGAAGACTTTCACTTTGAAATGTTTGAGAACTGAGCCTGAAGTTAAAGTA
TGTGTATCTTTTTGTTTTTATTTTTTTCTAACACTCGCATCTTTTTTATTCAGAAAATTG
GAAGCCAATAGATCCGGAGGAGAAGAAGCGGTACGACAGGGAGTTTCTACTTCGCTTCCA
GTTCAGCAACGCCAGTATGCACAAACCCGAGGGCCTGCCCGTCATCAGTGATGTCGTCCT
GGACAAGGTAGGAAACGCTTGATTGGTCGAAAATTCCCTTAAAAATGCCATGGAAGTAAC
ACTTTTTGCATAACTTTTAAAATTCTAATCAAGTTTGATTTTATAGCTCTCTTTATACAA
GTTCTGAGACTTTTTGCTGCTTTAATTTTAGGTGAACAAAACTCCGCTACGACCTCCTGA
TCCATCTCGGCTAGCAAACGCTGGTCCGGATTTTACCCCCTCTTTTATGGGGAATCTGGG
AAGCAGATCAATGGGAGGACCTCGAGGCCCGGTGAGTCAATTTGTTGCATTTTTTTTCAG
AGGTTGTCGCTCTATTATAATCTTAAACTAATTAATTTACTTGGATAATAATTAGTTGAT
GAAGTGTATTATTCTTATTTTCTTGAATATTTTGGTCTAAAACAAGAACATGTCCTCCCT
CGCCTTTTTAGCCTCCTGGGCCGCGTCGCTCCCAGCAAGGCCAGCGAAAAGAACCCAGGA
AAATTATCAGCAGCCTCGGTGAGGACATCCAGCTCAACAAAGCCGAAAAAGCCTGGAAGC
CATCCGTGAAGAAGCCGAATGCCCGTGCTGCCGAGGAGGTCGACGATGACGACCCAGAAA
ACGCCAAGACCCGGGAGCTGTTCAAGCGTCTGCGCAGCATCCTGAACAAGCTGACTCCGC
AGAAGTTCCAGGAGCTGATGAAGCAGGTGTCGGAGCTGGCTATAGACACAGAAGAGAGGC
TGAAGGGAGCCATCGACCTCATCTTCGAGAAGGCCATCTCAGAGCCCAACTTCTCTGTGG
CCTACGCCAACATGTGCCGCTGCCTTATGGGGGTAAGACATGGAGCTGGGGTTTTCCGCT
CTGATGATGACTCCTGTTTTGTGCCACGTGTCTGGGCCACTGAATGCTCATGATGGCAAT
GAGGATCTGAAGAAGCCTTAAACTATGTATTACTTTAAACAGTGCAAATGTTGCACAATT
CAGAATTAATCATGAAATGCCCAATTTTCATGCTCGGCTTCCACAGTTGAAAGTTCCCAC
CCCAGACAAACCAGGAAATTTTGTGAACTTCCGAAAACTGCTGCTCAACCGCTGCCAGAA
AGAATTTGAGAAGGACCAGGATGATGACGAAATCTTCGAGAGGAAGCAGAAAGAGTTGGA
TGCTTCCAAAGATGTACGAGACGGTCAACTGGTGCATTTATAGAGGTAAACGGGAGACGT
TTCTGTTGTTCTCACCTGAACACCTTGCATCTCCGCTCAGGATGAGGAGCGAGAACGCCT
GAGGGTGGAGCTGGAAGAATCCAAAGACAAAGCCCGAAGACGCTCACTGGGCAACATAAA
GTTCATTGGAGAGCTTTTCAAGCTGAAGATGCTGACAGAAGCCATCATGCACGACTGTGT
TGTGAAACTTCTTAAAAACCATGACGAAGAGTCTCTCGAGTGCCTCTGCAGACTACTGTC
AACTATTGGCAAAGACCTGGACTTTGAGAAAGCCAAGGTGAGGATTTCTTTTACAAAACA
ATCAGAAAAAAAATCTGAACCTCAAGTCTTCTCCAGGTATGATGTTTGTTTTTCTGGGTC
TGCACATGTAGTGATGAGGACTTGAGCAGATTGTTTTACGTGAGTGTTTTGGAATTTTAA
GCCTGTTTTCTGTCTGTTCCAGCCTCGCATGGATCAGTACTTCACCCAGATGGACAAGAT
CATCAAAGAGAAAAAGACGTCTTCAAGAATTCGCTTCATGTTACAAGATGTTCTTGATCT
CCGAAGGGTAGGAAACCGTACACCAACATTAGTTATGTAGCACACTTATATAGCACTGCA
CTACCTTCTTAGAAGGCCGAAAGCGCTTTACAACCTATTCACCCATGCACACACACACAT
TCCCAGCTCCGCTGCTGAACACTGGCACAAACTTAATAACAGCATGGAGCAATGTGGGGT
TCAGTGTCTTGGCCAAGGACAAAAACCTACAGTCTTCCAATCAGAGGTCGACCGCTCTAC
CTCTGCACCATGGCCGCAGAGGGAACACTTTTTGTTCAAATGGTTGAACTTTTGCATTTC
TGCTCCTCAGAATAACTGGGTGCCCCGCAGAGGAGACCTGGGCCCCAAAACGATCGACCA
GATCCACAAAGAGGCAGAGATGGAGGAGCACAGGGAGCAGATCAAGGTCCAGCAGCAACT
CATGTCAAGAAAGGAGCCCGGAGGCAGGATGGGGGGCAACATGGGGGGACGGGGCTCTCA
CTCATCAGGAGGTGGACGGGTTAGCCAGCCTCAGGATGAGGGCTGGAATACGGTCCCCAT
TTCAAAGAATCGACCCATTGACGCCACCCGCCTTAGCAAGATCACAAAGGCAAGAAAGAG
ACGCAGACATCTAGTTTTTTGTTAAACCAAATCTCATGTTTTGTCAGTATCTTTGATTCC
GTTCCATTTAGTTTTAAGTGTCTGTGTTTTCTCCAGACTGGTACCATGGACCTTAACAAT
CAGCTGCTGGCTCCTGGAGGTAAAGGCATGTGGAGTAGCTGGGGAAAAGGCAGCAGTGGA
GGGAGTGGAGCGAAACCAGCAAGTGGAGAACAAGGTAAAATATAAAAAGCAAATTTATAT
TTAAAAAAAAACAAAACTGAAGAGTTTTTGTTACTTTGTCTGAGTTTTAATGATTGTTTT
TTTTCCCTCCCATTTCCAGACTCTGGTCGTCCGGCTACGAGCACTCTAAACCGCTTCTCC
GCTCTGCAGCAGTCAGGTTCTCTAATGGCGTCAACAGAAACGGATCGAAGAGTTCCTCAA
AGGTATGCAGACAGAGCATCTGTTGTTGAAATCTGTCGTTTTGTCTGTCGTGTTTTGGCT
ATATGCTCGGTGGGTTGTTTATTTTCCTATTATCCCTACTAAAGATTAAGTACAACAAAT
TATTTGATTAGAAATTAGATTTGTTTTAAAACAATAACTTATTTTCCCAATTCTTTCAGG
TCGAGCTCAAGCCGCGAACGTGGCGGAGACAGAGACAGAAGTGAGCGCGACAGGGATCGC
TTTGACAGGTTTGCTCGCAGCGAGGAACAGGGGGGAGACCAGTTCACCAAGAGGAGCTTC
AGCAGAGAGTCGAAGGATCGCGGCAGCCGGGGCGGAGACAGCCGGGCTTCAAACGAACCA
GTGCGCCGTGTCGCCAGCATGACTGACGATCGCGACCGGGGAAGCCGCGACAGAGGCAGC
AGAGACCGCGGGAGTCGGGATAGAGGAAGCCGGGACAGGGGGAGTCGGGACCGGGGCCCA
AGCAAAGACCTCCCAGGTATGAAACCTGACAGGAAAGCAAAGGTTTCAAAACACTTTTGC
AGCTGTGAGATTTGAGTTTGAGGAGGGAAAAGAATAAGTAACCTTTTATTTTGATCTGGT
TTCTCAGCAGTTAGACGTGAAAGCGCTCCCACTCCTCCTCCCTCTCTTCCTAAGCCTGCC
TTGACCGAGGAGCAAGTGGAAAAGAAAGCAAATGCCATCATTGAAGAATACCTCCACATC
AATGATGTGAAGGTACAGAAATGACACTCACTCTTGCTAAAGTACAACTTGAAATCCCCT
TCAGTTGAGTTGACCAGCTTTCTGGATGTTTCCTCTCTGTGTGTCATTGTAGGAGGCGTT
GCAGTGTGTTGCAGAGCTGAACAGTGCCTCACTACTCTATGTGTTTGTACGGAACTGTGT
GGAGTCCACACTCGAACGCAGCACCATTGCTCGGGAGCACATGGGTCTGCTGCTGCACAA
TCTTGTAAAAGCAGGAACTTTGCCCACACAGCAATACTTCAAAGGGTGAGTTTAGCTCGT
GGTTGGAACTTTTGTCTCTGAATCGTCAGATGTGGACGTTAAAACGATGCGGCGTGCTTT
GTTCTGGACCTGTTGCAGGCTAGAAGAGATCCTGGAAGCAGCGGAGGACATGGCCATAGA
CATACCTCACATCTGGCTGTACCTGGCTGAACTGATCACCCCTATGCTCCACGAAGGAGG
CATCCCCATGGGACAGCTGTTCAGGTGAGTGCTGGGACAGTCCAGGAGCTGAGCCGACAA
CTCCTGCTTAGATGCAAAATGTCTGGAGGGAGGAAGCCGGTTGACTGACTGATTTTACAG
TTATGAATAATAAGAGAGTAAAACTCTTGGTGGCTCTTAATTTCTGTCATTTTACTTCAA
ATATTTGTTTTATTCACTTATAGGGTGAAAACTGACTATGGGTTAGGATTGAGATTAGGG
ATTTTGCTGATGTTTCTCAGATATTGATTCCTATGGATGACCCAAACATAAATCCTTGTT
TTTGTTTTTCTAATTTCAAAGGCAATAAACGTAAAATTCCAAAATTCAGTTCCAAACTAA
ATTTAATCCCACTTGAAGATCAAGGTTCAGTAAAAAAACACAAAATTTAACAAATTACAG
CAACACATAGGTTGTCAACTTCTTTATGCTGATTGTTCCAAAATACGTATCACACTGCAT
TATTTACTTATCTCAACTGAATTTAGAATCAACTTAAAAGCAAAAGTGAAACATTTTCCC
AAGTTGGAAATAAAGGGGTTAAAGGCCTTTTTAGAATCAGGAATTCTGAAAGTGAAAATG
AGACAGTTCTTCTAATCTGAGAGTCAGATGAATCTCAAATACCAGCATCACAAATGTGGG
ATTTTTTTATTGCAACCATGTAACTGTTAGGAACATTTTCCTTTACAAATGTCTTTCTCT
TTTGAATAAGCAGCCTTCATGTGGGGCACTTGTGTTTTCAGGGAGATCTCAAAGCCTCTG
GTGCCTCTGGGGAAGGCCGGCGTGCTGCTGGCACAGATCCTCCAGCTCCTCTGCAAAGGA
ATGGTACGTACAAGCAGACGTAGAGCGACGGCACGCCAAAGGCCTCATTTACATATGCAT
GCTTGTTTTGGAGTCTATAGAAATACTTGGAATGTCTGGTAAATTCTGACAGAAATGTGA
AATATTTTAATATTTTTAATGGAGGAACAGGAGGATTTATAAGTAAACCTAAATGTTGCA
TTTACTTAAAACAAGCCACAGCTTTTCTAATAATAAATATCCATTGAGTTATTTTAGTTA
AAAAATAACTTTTGGTAACAAACGTATACCTGACATGTTTTCTGTTAAATATTATTCTTA
AACTTAACTTATAAACCTCTCCCCTTCATATTCTTGCTCTTATCTTGTGGAACATGCAGA
CTCCTCAGAAGGTCGGGGCTTTATGGAAAGAGGCTGGACTGAGCTGGAATGAAATCTTGC
CCAAGGATGAAGATGTCAACACGTTTGTCACAGATCAGGTAGGCAGGATTTGTTCCGAAA
ACAGAACAGTTTGGCTGGTTCTGGGTTTGTTCAATTCAAACGGCTGCTGCTGCTGCTGAA
AATAAAGCAGACAGCTGAGGGCCTTTCCTTTCCTTTCCTGTCAGTTTGACCTTTTATGTA
AAACGCACCCACCAGTTTGTGCAATGAAGAAAATGTGAATTGGAATTTAAATGTCCTGTA
AATGTTCTAATGGTCTGAAATCTACTTCAACACATTGTTGTTGTTTTTATTTTGTTTCTT
TTAGAAAGTTGAATTCACTGTAGATGAAGAAATGAAGTCAAAGGACGTCGGGAGGAAAAA
TGTCCTCAGTGGAGAAGAGATCAGTAAACAGCTGGACAGACTCCTGCAAGACAAGGCCAA
CAACCAACGGATCCGGGACTGGATTGAGGTGTGGAGCTCTTTTCTTGTGTTCTGGGGGGG
GGGTCATTTTTCTGCATGTGTGTAACCATGTTTTCTTCATTTTTCATCGTTATCACTTTA
TTTCACGTTCCTCACTCGATTGTTTTTTCCTTTCACAGGCTAATTTGGAGGATCAGCAGA
CGGTGAGCAACCAGTTTATACGAAGGTTGATGACATCAGTGTGCCAGTCGGTCATCATAT
GTAAGTATGAGTGATGTAGTCTGTATGTGTCCTGTATTGCTCATCCATGTTCGTGTTTTT
CTTACAGCAGCAACAACCTGAAAGTAACTGCAGACACTCAAATTTAAATTTGCAGATGAA
ACCGTTTATCCTGTTTATGGATTTTGTTTTTAGGCGATAATCCATACAAGGTGGATATGG
AGCAGATCAAGAATAGAGCCCCTCTGCTGCAGAGATACCTGTGTGATGAGGAGAAGGAGC
TGCAGGCCCTCTATGCCCTCCAGGCTCTCATGGTTCACATGGAGCAGCCTGCAAGTCAGT
ATCAAGCTCAGATTGTGCACAAATATTGTGTTTGTATTAAATGTTTGTGTGTTTATATTT
TTCTATGGAAACCGGGGAGAAAACTGATCGTCTTTATTTGCATGTCGTCTCTGCAGACCT
GCTGCTGATGTTCTTCAACACTCTGTACGATGAGGACGTGATTAAAGAGGAGGCCTTCTA
CAAATGGGAATCCAGCAAAGACTCTGCAGAGCAAACAGGCAAAGGCGTCGCCCTAAAATC
CGTCACCACCTTCTTCACTTGGCTCCGCGAGGCCGAGGAAGAGTCTGACAAGGATTGAGG
CAACAACAAAACAACACAACAACAAAAAAGCTGCCGCTTAACTTTATCAAGAATTGTGCT
CTGTAGGCAGCTGTGGAGACTCAAAGACAATGTTGCCAGTGTGGCAGACCCAAATAAGTC
CTCAATGAGGACACATCTTTTTTTCTCCCTCCTTTTTCTTTTCTGTGAGAGATGGACTCA
GAAAATAATGTCTCTCCTCCCTTTCCTGTTGTCCTCAAATAAACTTGAAAACGCATTCAG
CAGGACTGCTTTTTAATGAGGTGTGAGAAACCCCACATCACTACAAAACTCTGTCAAGTA
GCACAAACCAAGTGGCTGCTTGAATCTCGACAGTTGCAACGCCCCAACATGTCATCCGAC
TTGCAGGAAGAAAACGAACAGGGAGTGTAACACGGTGGCTTCCCTGACCCCTTGGTTTAA
CGCTGTGTGTGTTCAAGCACGGCTCTTGTGTCTGTCCTTTACTGGAGTGTGCAGCATGAC
TGAAGTGTGTTTCTATTCATGATCTAGTGGGACAAAATGTTGGTAAATAAAAATGTACAT
GAGCTAATCATAATTTGCCAGATGGAGTTTTTAAGAGAAAAGGTTGTCTATTTTCACCTT
CTGTTTCCTATCTTGAGCCTAACAAAAGGACTAACGCTGACTTGGTCTACCTGGGTGTGG
ACTTGTGCTTCCTCTAAGCCATCCTCTTCCACACCCAGTAGAGAACCATATGGACTGACT
CAGCTGTTCCAGAGGACTCTTATGACCCAATCAGTTAAAACTTGAAGTCGGTGGAGAAAT
TACCTTGATAAAATATATATATATAAATAAATATATACAATGAAAGGAAAAAAACTAAAA
CAAAAAAAAAATAGGTGATCTGAAAGCCTTTTCTACTTTAAGTGGAAACTTATTTCAGGA
TTGTTCCATAAATATAATAGACTTTTTTTCAGTTTTATTTTTCAGAAACGATAATTTTCT
GATATAATTGCAGTGTCTCATTTTCCAGGAGAAACATCAGTCGCCCGAATGCAGAGAAGA
GTTTTTTGATAATCCATTGATTATTAGTTTTATTTGACTTTTTTTGTAAATATTTTTTTT
CTTTTCTCTCTATTTAATAAATTCTTGCTTCTTTTGCATCTAAAACTGGAAAGATGAGAT
CATTGAACATGAAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 1154..1240, 2439..2465, 2709..2885, 3520..3616, 8792..8862, 8896..8943, 9148..9240, 9339..9342, 10513..11352, 11372..11517, 11632..11815, 13073..13206, 13351..13470, 13631..14011, 14206..14352, 14440..14676, 14842..14946, 15250..15528, 15636..15753, 15859..15961, 16139..16362, 16567..16691, 16792..16964, 17058..17183, 17921..18002, 18359..18457, 18724..18867, 18998..19079, 19233..19373, 19496..20083
1001..1075, 1154..1240, 2439..2465, 2709..2885, 3520..3616, 8792..8862, 8896..8943, 9148..9240, 9339..9342, 10513..11352, 11372..11517, 11632..11815, 13073..13206, 13351..13470, 13631..14011, 14206..14352, 14440..14676, 14842..14946, 15250..15528, 15636..15753, 15859..15961, 16139..16362, 16567..16691, 16792..16964, 17058..17183, 17921..18002, 18359..18457, 18724..18867, 18998..19079, 19233..19373, 19496..19674
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved