Oryzias_latipes Locus ACADM
snOPY snoRNA Orthological Gene Database
Oryzias_latipes ACADM
Oryzias_latipes
ACADM
17
SNORD38, SNORD38
116528..116595, 116953..117021
162813
GGATTTTGTGTATGTTTAAATGCACTGTTCATTTAAACAGAACCACGTGTGCCTGTGAG
CTGTGAGAAGGCCAGCACGCCCTGTGGGGCTCACTAAGACTTTGAAATACTAAACATGCA
CTTCAGAAACTCCCATCTATCCAATTTTTGGGGGCAATTTCGCAATGTTCAGTGCTCTGC
GTGTGTGTGTGTGTGGTGGTGGTGGTGGGGGGGGGTGTTATCCCAGCAGCCCTTGGATGC
TACAAATAGACCTCCAGGAAACAAGAATGGCACAAATGTGCCACCTGAGAAACGCCCTTT
TGAGGCTTTAATGAAGCTATAATCCTTCAGTCTTCTTGAAGAGCTTCTGCTCACAGGTCT
GGATTTGCTCTCCAACAATCTTCTGTCCATTAATTCTATTTAAGAGTCCTGAGGGAAGCT
ATTTCAAAAGAGGATTATTAAGTTAATGCGCTCGCCTTAACTTTGTGTGTAATGGAATAA
TATTGCTTAACAAAATTTGGGGATTTTATTTCTCAAGAAGCTGAAAAGAAGCTGAAAAAA
ACACAGACCACCTGCAGAAAAACAGTTGGGATTTTTACTGATCTGCACAAAGCAATCAAC
AAGTTTCCTCGTGCAATCAAGCCTTTCGACATGTTTTATTGGAGCTTCAGCACTCCACTG
GAAAGCAACCAACCTGCAGCTTTCATGTAATTATTCTCATTCAGGAATCTAATGTACTGG
TAAAACTGAAGTGAGTGTCTGTTTTTCGTCTTGCTGGCAGGTTCAGGTCCACGCAATCCT
GGAATCAGAGATCTTGAGTGATTTCCTGGCAAGGCAGCATCTCCACAGTTCCGTGTCCTC
CTGTCGAGAAAGCACCTTGCCGTTTGTAGATGAGTTCACAGGTATGTGCAGATGAAACGG
TAGCAAAAATCAGCCTTTAACATGGATAATCGGCTCAACACCTGGACTGTTGTTATTTTC
TTCCATGGCCTCATTTGCTCCTTTACTCCCTCCTCATCCCTTCTGCTGCAGCTCACCATG
TCCGTGTTTACCTTGTCCAATTATTGGGCACCAACTGTGGGCTAGTCGCCTTTACTCTGC
CTGTCCTTTAACTTCTCCAACACAGGTTTTCCAGCCAAAGGTTTTTTCTTTTCCCTCAAT
GGCTGAATTGGATTCAAGAAGCTGTCAGGTACGCTGAGGTTCCGTTGGCAAAGGAGAGAG
GAGAGTATCTGAAAGAGCTGTCCATGTGTATTACTTCAGACTACTTGCAGTTGTACCCAA
AGGACCGAGACGGAAAAGCCTCGAACGGCACACTGGGAGCTGCGTTTACTTGTGGTGAAA
CAAGCATGTCGGTGTGTAATTTTGAAAATATCCCAAGAGGACTCTTGACTTATCAAGGAA
AAAGGCGAATATCTCAGTTTAAAGCACATTTTATGACCAAAATGTATATAAATGTTAGAG
GTTTTAACATAACATGCTGTCATCATCGTCAGGATAAACTCAGAGAGAGCCCCACTTTTG
TGACATGGAGCTGCAGCTTTGAATGATTAGTTTTTGGTGTGAAGAGCTTTTGCTGGCTCC
ACAGTTGGCTCTCAGGCTTGACTCTTGCTCCTTTTCTAAAAGTGGTGCTGTTCTGCTGTT
TCCAGTGGAAAGCTAAAACCTGCAGACAATAACTGCAGAATCTTTGTGGCATAATTATTC
ATGCCATCATGTCATCATTTGTGTGTTTCTCCTGGTATCAGATCTTCACAACTAAGAAAT
GTGTAAATAAATTGTTAACTAAAAATTCTAATTTCTTGATTTTTACTTTGGAGTTTAGAG
CAGAAATGTTTGTTGACTTTAAATGTGTTCATCAAGGGACTGTTTTGAGACCTCAGATGT
GAACACAAGCCTTTAAACGAAAAAAAAACAACAGATTACTCTGCGTGTTTCTTGATTTTT
AATTATTTTACAATAGTGGTTATGATCACTCTGTGTCAAAAAATATATTTTCTAGTGAGA
ATTACCTTGACATTTTTAAAGACACCATGTTTTTGTACTTATTTTTGTAACTTTTTTCTT
TCCATTTGAACAGAAATGAACTACATGTTGGGTTTTATAATTTATCTTTAAATGATGACA
TTAAACGTATTCCATCCTCACCAAAATCTTGAGAAATATTTGGATGAAAATATCAGACCT
CGATTCAAACTCAGGAGTCACAAGGTAGGGAGACAGAGTTGGAGCAGGTTCCCTGTTGTT
CCTTCTGTCTGAATGGAACTCAGTCTAAAAACTGACGTTGTTTTGTATTTCTAAGCGCTG
GCAGCTATACGCAAACGTAGCTCACTGGCGACTATTGATGACATCATTGAGTGGGAGTAA
TGTCCTGATTTGAAGACACTATTTTTCTACATAACTCTCCAATTAAGTAACCAAATGTAG
TGGTAGAGGAAGAATACGGATTTGGCCTAAGTATGTCTGAGTGTAACTCTGACTGAATGT
ATAAATGTAATCTAAATAAATGTAATCTGTATAAGGGTAATCTGTCTGAGTGTAATTGTC
TAAGGGTAACTCTGTAATTTGAGCACCAAACTACAGATGTGTTACTTTTACTGAAAGGCA
TTGAAAGGTATTTCTCTGGCAGGCTCAGGTCCTGAGCCTGCCAGAGAAATGGAGCTTTCG
TCTGACAGAGTTTCAAATACTTCCTGCTGCAAAGACACTGACTGCACACACCTGACAGAG
CTAAATAGCAAGCAGGCACAGATTCAGTTCCTCTTCTACCAACCTGATCTTCTCAGTATT
CTTCTTCTAAGGTTTGGGACCAGAATATTCAGGAACCGGAGAGCAGCAGAAATTAGGAAA
AGGTCATTGAATGTCTGAGGGTAGCAGTAGTTTGTGTAAAAGCTGACAGTCAGTGCAATA
TTTGGTTTTGTTGCCATTTTTCTATTTTGATCAAAGTTAAGTTTCTCTCAATAATTTCAA
AGTGATGATGATGATGATGATGATGATGATGATGATGATGATGATATGACCTATCCTCCA
CTGCTGCCTTCACACCCCTTGTCATCGGATGAATTTTGAGGTAAACTGCGTCTTTCTTTC
AGGTGTTTTCTCCGACAGCAGTGCGACTCAAAACAGGATGAATCCAGACTTCCTGGCTCC
TTCAGCAGACACCTGCTCCCAGTATTCCGGCCCAGAGAGGAACTTTGATGCCAACAGTCC
CATATCTTCCTTAGCCAGCCCAGGAAGCATGAGGGACGGGTGAGTGTGAGAGCAGTTTTG
TGTTTATTCATGTGGCGACGCTTGTTTGGGGAAATTACAGCGACTTGATGATGATGTGTG
CCTTCCCTGTGAGCAGCAGAAGTTTAATTGTCATTCCCATGGTTGTTCTACTAAATAATA
CAAAAAAGGGAGGCAAAAGATGCACTCGATCACTGTCAAGTATTTTAACATTAAACCCCT
TTTGGGAAACGGAGCACTTTAATGATATTTAATTATGTACCCAGAAGCAAAGTCAAACAG
TCCGTTCATCCAATTCACTAAATCAACGCAAAAACACATTTCCTCACTTACCACTTGTGG
TGTGTGGCAGCGCTTCAAGTTATCTGCTGCGGGGATTTCTGCTGCCAACCCGATACAGCA
ACGCTGAAGGAGATTTTATTTTTGGCAGCTTTCATTCGGAACGATTTCCTGCCAAAGATA
AAAATAGTAAAAACAAACAGACCCCAGCTTTTCACTTCACTTTGGATCTACTCTTGGATG
AAGGTTAAGAATGATCCCATAACGTTTGCGTGAATATTTTTCTGTTTTACAAACAAACCG
CGCATGTGTTGAATCATTTCTTGAGCGTTCTCTGGCTTTGCAGGGCTTGGGCACCATCAG
ATATTTTGATTCAACACAAATTCACTCTCACTTTGCTTTCTTCTCCTCTTTGGGAATCTC
TCAATGGCTTTAGGGTTGCACTGATTGAGTAGTCTGAGACCACAGAGCTTATGTCTGCTG
TAAACTGAAGTGAATGTCATTAACCTCAGAACCTGCGGGGTCGTAATTTCTGGACATTAT
GGCCCAAAATGTTTGGCTATTAAAGATTTTCTTGTAAACTGTCTGTTACTGACCCAATGA
GGAGCAGGAAGTGGAAACTGCTTCATTTAGTGAAGCTCAGAAAGACAAAGACATTTGTGA
TTTAGAGTTATCATAACCATTTAAATAACAGGTTATTTCAAATGAAACATACTGGTGTTT
ATTAACACTGGATTGAATGTGTTTGAATAACATTTTAACCAATAAGGATCATATTTGGCA
AAATAATAGACAAGGAAATTACCAGTAATCACTTAATTACACAATGTTGAAAATTTGCAC
TTCTGCAAGAGGTTTGAGTGTTTTCCAAAATAAAGATTTAACATTCGTTGTCCATTTGTT
TTCTTCAACAGCCCACATATCTTTTAGTTCAGATGAGGGAGTCTGCTGGCTGTAAACGGA
GCAGTAGTGCATCTTTGTTGCCCACATTCTTCCAGCTGCCTGCCAATCACTTAAACCTCA
CTGGGCTTTAGTAACTCGGACAAAGTTGTTTTTTATCATCTGCTGAAGGTCTGCACTGAA
AGAAATGACTGAACGTCTTGGCAAGCTGGCCTTCAGTCGTTTAGTGTAGGCCACACTCTC
TGCTTCTTTTCCGTTTTATCTCTAGATTGATAAAAAGCATGTTTAGCTTGTGAAAAGATC
TAAAACTATTTCATTCAAAGTCCCACTCTGATCATCTTTTGATCTATTTTTAAAGCGTTT
CCAGTGGTCTTTTATTTATGTTGACGCTGTTTTTGCCAAAATACAAAAAGATGTTTTCTA
GGACATAGTTTCTGCAGAGCGGCAGGAGTTCATCAGAAATTCACCTCTGAGTTGAGGCGG
GCTGTTAGTGCAGAGTAAGCCCATTCCCACTTGCGGTTCCCATCTGTTTACATGCTCCCC
AGCTAGCTTACAGCCCCTCATACCCCCAACCTAACATTAGTGAAAAATGGTGAGCACTGT
TGCAGCTATCCAGCAGTACAATTCAGATTCAGATTCCAGCTCAGACGAGGAAAGCAAAGA
CGTACATGGATGTATTTGTTTGCTGGTGGATGCATCAGAATGGAGCAGAGCAGGGAGCTT
GTGCCCTGCCCACAAAGAAGCTCTTTTTCAAATGGCATTTTTGTGTCTGCTCCTGTTTCA
CAAGGATTTAAAGGGTCCACCTCTCACACTCTTGCTGTTTTGTGGATTGTTTTCAGTGCA
ACGTTGCATGCTTTTTATTTTAGTATTTTAACAGCACACTGTGTTCTGAGTCCTGATTGG
CCATTGACCTTGTCAGTTAGCTTGTCAGAGTTACATAAATCTTCTTCGTGAGCAGAGCTT
TGTTTTCATTCTGTAATCCTGGACGTATTTTTCTTTGAAGGTTCGAACTTTGTGAATTTA
AACAAGAGAGTGTGAAAATTGTCATGTCTGTCTTAGAAAAGTGGATAAAGTGTGTTATGA
GGAGTACTGTATTCAAACCTCATCATGCTACTGAGCAAGTTTGACCTATTGTAGGTCATT
AATGGAATGTATCCCCTGCGATAAATGAGGGAACATTTTAAAAATACCCGTTTCATCAGA
GAAGGGCTTTAAAGACTCTAAAATAGTATGTTTGGAAAGCAAAAAGTATACTTTACCAAA
AGATATTCTACACTTGTACAAATAAATGTAGTAAAGGTGCAGAATTTCTGCACAGCAAAC
AGCTACACAGCCTGCAGCCAGAGCTGCTATGCAGTTATGCCGTTTGTCCACTGACGTCTC
CTTTCTGGAGGTGGAGAATGTCACTGAATCCCGCTGGTGCCGCAGTACGCCACGACGTGC
CAAAGCCAACACCAGTCAAGCACTTGTTTTTCTTCAAATAACTTCAAACACGTGAAAGTA
AATTATCTTTGCTTCACAGCCCAGCTGGCAGCCTTCTTTCAGCTCTTAGCCAGGCTGGAG
TCTGCTCTTCGCTGGAACAGGCCATCTTGACCCCCTTTAAATGGATAGATGTTGCAGCAC
TGAGGAATGCCCTTGAGAAAGCATTTGTGTATATTTTGTGGTCATCAGGGAGGGGAGGCT
GGAGGCTTGACTTCTCAGAGCAGCTTGTCCATCACACACAGACACACCAGCCAGGATAGC
TCTCACAAAGAAACACTACTTTCACTTTTAAAATTTGCAAGTTTACATTGTAGAAACAGA
GTGAATCTTGACCCAGTCAGACAGTCAAACTGTCAGAGACCTCTGCATGTTTTCGTGTAC
GTGCAGCTCCAACATGCAATGAGTTTTGTGTTGATCTTTCTCACATGGAGCTCTCGCAGC
TCCTCTGTCATGCTGAGAGAATAAATATATGAGCTTTAGATCTTGTACAGTCTCCTGATT
CCAGACAAAAACGAGGAAAGCAGCTGGCGGTTGTTAGTTAGCATGAAAAAAGTGAGCATG
GGGGGTGGCTAGCTGTTAATATATGATCAGAGAAATAGTTTCCTGAGCCCATGCTGACAT
CCGCTCCCTCAGGCGTCGACTCGCGCTTTGGTAAGGGCAGGCGTCTGAGCGGTTTGGGCC
ACTCAGGCGACGGCAGCCATCAGACATCTTAGCTATGTTGTTGCAACGTTGTTAATTGCT
AAGATGCTACAGGGGGCTGCGTGGAGGGAATCGAAAGACTTGTTGAATATTTCGGGCCGC
AGTCATCACAGCACATTCAATGGTCACACTGTATCAAAGTCCCCTTTGTTTACATAATCC
ACACGAAGTCTGGTCTTTATTACCTTGGGAAGCCACAACCATCTGTAAGTTATATTAATT
TGGAATTCAAAAAAGTCCTTGTGATCAATTTAGGCTTTTATTATGTTTCTGCACTAAAAG
CAAGGACAGTTAAGTTACATGGATAGCATTTGACATGGGAATTTGGTGTCTCTTTTTTTC
ATAGCTTCTCTGAAATGAACACAGACTCCACTTTAGCCAACAGCCGCCACATCTCTGACA
GTCTGGCTTGTTTATGAAGCCCTCTAAAATCCTCCCAAGCTCACAGGGGACCAATATGCT
CCAGTACATCATCCAGGAGAGCTTCAGGCCACATAAAATGCTGAGGCGGGGGTGTCTCAA
ATACCATCCAGCTACATATCTCCTCAGAGAGATCCGGCTGCCTTTCTTTCTTCTTGCACA
CTGACTCATTGGTTTCCATGTTGAGTCAGAGTGTTTGTGCAAAGTCAGCACATTCCTTGA
GCATGGCAACTGATTCAGCTCTGGGAAAAAAAAACCTCAGAGGCTGAAATGCTTCTTTAT
ATAATGTGTGCTGCTTGAAGATCATTCGTATTTATATTTCTAAGAAAACTGAGTGGCTAA
TGTTTATTTAACTACAAAAGAAAATGTCTGGTCTGAGTTTGAATTTGATCCTTGAGTTTC
TGCTTGGTTCGATTGAATTTTACTGCTTTAAGTACTTTATTGGAGCAGAAAAAACACCAG
AAAAGTTACTGATTTTTTCAGTTTTGATTTTAAATCATAAAATCAGAAAGCTCTTCATGG
TTGAAAAAAATTATTGAAGTAGGGCTGTTGCAGAAGTCGATTTTTAACTACATTTTAATT
TGTATTTTGAGCACTTATAGGCAATTTACTGAGTTCAATTTTAAGTTTTGGATAGAAACA
TGTTTCTATCATACAACAAAACATAAAAGATAAAAGTAATTTAACAATTTTTCAAGAAAA
CATGAGAGAAAAATGCTGCTAGGCTTGTAGTAAGAAACAATTCATATTTTACCTTTTACC
TTACCTCACCTTACCTTTACCTCTTACCATTCATCCTGAAGAATTACCGTATTTTCCGGA
CTATAAGTCGCCCTTTTTTTCATAGTTTGGCAAGGGGTGCGACTTATACTCCGCAGCGAC
TTATATTAGAAATAAATTGAAATAAATACATTGTTAACCCTCCTGTTATGTTCATTTGTG
AGGAACAGAGATGATGTTCCTGGGTCAATTTGATGTATGAGGTATGTTAAGTGTTAAGAG
TATGTTAAGTGACTCAGAGAATCAGCAAACTTTTTTTACAGTAAGATCTTGAAGGCTAAA
AACATAATATTCTATTTTCCAATGATTTCATAGATTCAGAAATGCAATAAAAGTGAAAAC
TGTTTCTACAAATACAGGATGAAAACAGAGTATTAGTTAGCCAATGATGCTTCATGAAAA
GAATAAATAAATAAGTTTGAGAAAAAATTACTGTGAAATTATGAGATAAACAGTCTGCTA
TGATTGTGTCATATAAGGTTGTGAAAGTTAAAATGCGACTTATAGTCCAGTGCGACTTAT
CTGTGTTTTTTTCTACTTTATAATGCATTTTTGGGCTGGTGCGACTTATAGTCCGGAAAA
TACGGTAAAAAGTTTCAGAAAAAATATTTCACCTTCAAATATGACCCTTGAAGACCAACT
TTGATAAAAAAAAAGTGTTTTTGGTGTTTTTGACATGTTTTTGTAGCACTTCCCTCATGA
TGATGGACATATATGAGGAAAATCATTCTTAACATTGCATTTCTGAGTATTTCTTTATTC
AGATCATTGTGATTCAGGAGCAGACACTTATAGCTGTGATGTAAAAGCTACTATGGCGAG
CCAGAAGCTCCCTGCTCTGCTCCATTCTGATGCATCCATTGGATAGCAACAATATTTTTG
CACCAGGAAAGTTAGGTAGGGGGTGTGAGGGGCTTTAAGTTAGGGGGAGAGCATAAACAG
ATTGGTGACTGGAAGTACTCCGTGCCAACAGTCTCACCACAACTCAGAGGTGAATTTCTA
AGGAACTCCTGCTGCTCTGCAGAAGCTATGTCTTAAAAAAAGACAGGTATTTGACATTGG
CTAAAAACAGCCTAATCCTAATTTAAAAACCACTGGGAACGCTTTGAGAATAGATCAACA
GAGTATCAGAGTGGGACTTTCAACTTGATTTATCAGCAGGTACAGACCAGCATCTTTGTT
TGAGTCCACTGATGTGAGTCTGCTGAGCCCCCCCTTGGACAGAGGTGACGTCCAGCCGCA
GAAAGTCTACAGCCACCAGCAGTCTGTGTTTTCACAGCAGCAAGGTACAAACAGTTGGAT
GAAAGGAGTAACAAGTTCTGACTGTTCTAATGCCTTTGTCTCTCATCATTTCCTCCTCTG
TACTTCCAAGACTGTCTGTACGCAGAGGGAAAGGTGGTTCCAGCCGCCCGTGATGGGAGC
TTTGAAAACTCCACGACTCACTCTGCAGGTAGGTTAGCAACACAGGAAAGTAAACCCTTT
ATAGGACTAAATGACTAAGACAAAACAAACCAGGTGTTTGTTTTAACCGGACAGGATTCG
ACTTGCTGCATGACCTGCAGGGACAGGCAGGAGGCAGGTACCCCGTGTCTGCCTGTCCGG
AGGACAGCTTCTTCTTCCAGGCCGGAGGGGTCGACCGCTGCCTCAGTCAGATCTTCTCCA
TCTATCTGGACTGATAATGGTAGTCCAAAGACCAAGCACAAATGTTTTGGAAGAACTGGA
CAAAATCCTACACCAACTGACACCTATTCAGCCTTACTTCTTCAGACCTAGTGATAAGAT
ATCCGCTCTGAGACTGGAAGGTTGTGGGTTCAAATCCACAGTTGGGGCATATTAAAGACT
CTTAAAATGGGACTCAAGGGGTTGGATTGTGGGAGTTGAACTACCAACTGATTCCTCAAT
GCAGCTGTGTCTGCAGCCCTTCCCTCCCCCAGGCGTGGGTCAAATGTGGAGAACAAATAT
CTCACACCTAGGTGCGTGATAAATAATGGGACTACAATATTGTTTGAAAATTTATAGTGG
CAGTGGACACTTTAGAAAATTATTGGAGGCTACAGAAAACAAGTAAACATGAATGACCCA
AACTGGAGAAATGATAAGAATATTTATGTAAATAATAGAAAATACAGTAATGATTGCAGC
ATTTATGAACTCAATAGAAAAAGCTTTACACTTTTTAACTTTCTCCATCTCTTACACTGC
CAAAGTTAAACATTAAAGAATGTTCTTTGCAGTGTTGTAATACAGGACAATTGGGTCAGC
AGTGTTGTCTGCATAAAAAAGACATTTGAGGCCTAAATGTCGTATTCTCTTGTCAAAAGG
CCTGGTTCATTCTCCAGCTTTTTCAGTGCTAAAGTCAAAGTGTCCTTGGGTGAAAAAAAT
AATAATAGATTTGAATGAGATCCCCAAAATGTCTTTGGAGAAAATATGTTCTGTCTTGAA
TTAACTTCAACAACAATTGATGAACGTAAAGCTGTCGAAACTGTTTACCAGTCTAAAATT
GAAATGAACAGGTTTGTCATGCGCTTAAATATGTCACCAAAGGTTAAGTTGAGTCACAGC
ACCCGGACCTCAAATCTTTTTTGTTGAAATGTTTCACTACTCACCCAAGTGGCTTTTTCC
AAGAAGGAAGATTTTTAGGTCCAGATGCCATGACTCAACGTCAAGACGATGAGTAGGAAA
GTAGAGGATTTTAACTTGTTTTAGGTCTCAAACCTGGTTTTTTAGATGTCAGTTTCTGTA
ATGCTTAAAGAAGTTTAACATCTGAATAAGCAGACATTAGAAAAACATTTATGGTTTAGG
ATTTGACCGTGCAGCAGTAAGGCTAGTCAACACTGCCCTCTAGTGTTTCAAGGGCTGTAA
ACGAAAAAGTTCTCAAAATAAATATTTCAAAACTAAACTAAACTATTTCAAATGAAAAAT
GCACTACCATTTTTTTAAAGTTTTTAAACTAATCTTATTTTATGTTCCTTATTTCGGTGT
ATTGTTTTGACTTTATGGCTACATTTTCAGTATTATTTTCATTAAAAAGGAAGAGTGGAC
CGTTTACAAGTAACTTTTCTACACTCCATCTTCAAGTGAAGATTCTAGTAATAATGGGAA
AAGTTTACACTGATTTTGTAGCATTTTATAAATTTCCTACTATTATTTTGTATGGATTAC
ATAAAAATGCATTGTTTTCATATCTAAATAAAGATCAGTATTCTTCTGATATTTGGTCAC
TGATCTGTCATTTATTATTGTAAATTCCTATAAATCTATTACATTTGCCAAATTTCGGTA
CTTTTATATTAAAAGACAGAAGAAAGTAAACATTGTGGTTGCAACATGTGAGCATTCTTT
TGTTCCTGTTTAAAAGGGATCTAATTCAGTGCTGCCATTTGTTCTCTTGATTAATAAGTC
AGAAGTGGCAAAAGCAAGCAAACCCCTGTCAGTCTGTGTTTGAGTGACTTTGTTTGCACT
GGCTTAGAATATCTAGAATGATCCTGCAACTGAAAGACACCCCCCCCTTTCTTTTTTAGT
TAAACAGACATGTTTTTGTATTCACCTGTTTATCGTTTTTGTTGGCATTCTAACAACACA
GCCGGGGGGGGGCTGGATAGCACGCCATTTTGAAGGGGAAAAAAAGAACTACAATCAATC
CCCTCCATCAGCTGTTAATAAATTTACACACCACCCTACTACATTTCGAATTGGTCTACT
GTTACTCTTGGCCATTCACATTTGAAGGATGAATCTGTACATTCTATACAATGATGCCTT
GATCCAATTTTGCTGGCATCATACATGTGTTGTCCACTTTGATGGTATTTGGTCGTTTTT
ACATTTTAGTAAAATAAACCCACTGTGCATGAATACAAATGGTAATTTCCAACATCAATA
TAATTAATTTATGTCGTTTTAATTTTTTTTAGAATGGCATAAGTTGATTAGATGAAAAAC
TTGCCTTAGACAGATCGATCTGGTTGGATAGTATAGAAATAATAATTTAGTTTATTAAAT
CAAATAATTCAATTCATTCAATTGTTAATTGAATATTTGGGTTAAGTCAATTAACCCCTA
TTCTATGGGCTCACCCAGCGGTCTACGACATTGATAGTTCATGCTGATCATCTGTGTGCC
CTGTACAGGTCTGCCCATGTTTGCCTGCAGACAACCCATATCCACAGGGCAGTTTTGACA
ACATTTCTTTCAGTTCATTGCCCTGATGGAATACTAATATGGACACACAGCTTTCTGACT
CTGGCCCATTGACTGTTTAATATATAACTGGAAGGATCTCGTGTGACATCACCCATAGAA
AATTCCTTGCTTCTGGTTTTTGGTCACTGTACAGCAAACTGCCTGTTTGAGAAATGTCCT
ATATAAATAAAGTGGATTGGATTGGATTGGTTCCAACCAAATGCAGTCAATTCAGTTGCC
ATTTTTCTGGGATATGTCTGTCGCCGTGTTGGAACCAGACGTCCTCAGTAAGCCGTCATT
GGCCCTTTCACATTTCTATGGCAACCACTCTCTCCAATCACGAGTGATCACAGGAGACGG
CCACACCCCTTCCACTATAAGTGGGCTCTGGGGAGGTATTGCAGGGGGGGGGTGCGGTGG
AGTTTAGAAACGAAGGATTTGTATGTTTGTGTCAGTGTGGGGGGGCTCGAAAATATTCTA
ATCTTCAGAAAGGGGGGCCGTGCAGAAAAAGTTTGGGAACCACTGAGCTAGAACATGTTG
ATAAAAGATAGTAGAGGTGGTTATTCTGAAAAACATAATCACAGAGTAATAGCTTTAATT
TTATTTCTCAGTAGAAGTCTGTTGCAATTGTCTATCACAGCTTTTTGGACTTCCTATTTG
GAACGTGGGGGGGAGGGGTTTCTCAGTCCAAGTCTCATTTACTCTGTCTATTCTCTGGCC
ACTACTTGGTGCCCCAAGATCCCAGAATTTTATCAGCCTGTCTACACATTGAATGAATCC
AGTGCTAGAAGCAACACAGCAATCCAAAACATCTCTGAACCTCCACCATCTTTGACTGCA
GGGAATGTGTTCTTTTCTTGGATGGCCCTCTTTCTTTTTCTGTCTGTGGTGCCATAATCT
CTTTTGCAAGGAAGCTCTACTTTTCTCTCATCTGTCCATAGTACATTCTCCCAGAGGGAT
TGTGGTTTTGTCACTTAGAATCTGGTGTATGAATTCACATTGAAGATGGACACCATAATG
AAAATGGGAGAAAGATTGTCTTTGATTTCTAGCCAAAATCTCTGGACAGATATTTGTAAT
AAAACGGTGCAAGAAATTTTTGTTGTTTAAATCATTTGAAAAACTAATATCTATGACTAG
CAAGACTAGTAGTTATTCTACTAAGTGTGGTCATTTTAAGATGTGAGTACAGCTATCAAG
TGTCACGGTTTTAGGTTTTTCTGCTTTTGTGTTCCAGTTGTTTTTTGTTCTGTGATGTTT
TGAGTTCAACTTCCTTTTTTATTTTGTAGGGTTTCCTGTTTCTTATTGTAGTGAGTTTTA
CTTTGGGTCCCCGAAATTAAAGTATCCCTTTTGCTATCCTAGGCACTTTACCATTGGGAG
TTGGGTCATCTAGACCCACCAAACAGTGCTCTGAACCTTTTTTCTTCAATGATTTGTGAT
ATTCACTGGTGTCCATGGATTACATGAAATCTTTCCACCTTTATCCACCTTTTTCATAGT
AGGGAGAACACGTCAATGTAAGGCTGGGGTCATCTAAGATAGCACAAGGGTTAAACCCGC
AACAAAGCCTTGCATTGGTAATCGCCACCTTATGCTGTCCGGTGATATCCATCAATGCCC
CGGACCGGCTCCCAGCTCTAACGAGACACCTTTCTCTACTCCACCATCAAACAACAGGAG
CACCTCCAGAAACTTTCAGGTACATTCACTTACGAGTTTTCAAGTTTGCTGTTTCTAGGG
ATTCTAGTGTTTCAATTTTTTTGGCCTGAAACTGAGTTGGTGTACAGTGAATGAGCGGCT
TTACAGCTGACACATCCCACTGTTTGCGGTTGGAATAAAGCCATACTACTTGCCACCTGC
CTCAAGACTTTTCCTTGGACGTGAGATTGTTATTGCTGTTTATGTCCCCCATCCCACCTA
CCTCCCACCCACTGCTAATACAGAGACCACCTGTGACATCCTGTTCTTTTCCACCAGAAA
GCTGCAGATGTAACAGGTTCAGTATGGTCACTGATGCACAATCAGGAGGACGAGACGCTC
AGATCTGGTTACTGCATTTTTAATGCCTTCAAAACGGCGCAAGAAAACGTGGCAATAGTG
GACGGCACAAGTACAGCTCTTTACATGATAAAAAGGAAAAAAGTGCAATAAAAGCTGGCA
CTTAAAAGCACATAAGAAGATACAGTTTCATGTCAATAGCATCACATTTTAATATATACA
ATGTCATGGTGTCCTTTCCCAGCATTCTTTGCCAGTTGATTGCCCCTCAATGGTGCAGTA
CGTGGTCACTAATCTAGTAATCTAGTTCATCCTCTCTATGGCTACACTCCTAAGTTCTCC
ACCTCATCTACGGGACAGTATCCACGAGTGCTGACCTGGGTCTTATCCTCACACGAGCTG
ACTGAAAACCACCTGAGATCCAAAGCCTCTAGCCCCGCCACCACGCCAAGACTCCCAGCC
TCTCCACAAGATTTACCACACCGTTGGATAATCAGCATCCAAGCTTGGCTTCCTCGTCAT
CACCATCATTCATCTTTGACATCCGTACTCACCTACTGGTCCTCAGCCAATCACCTTTGG
TTGACACCACCCAAGCCTTTTCAACCTACTGGGACAATAAATCTTTAAATCCATTTCAGT
CTTGCGTGATCCTTCCTGGTTCCATCATCTGGGTTTGCTCAGCCTTGCTGATCATGACAT
CAAAGAAAAAGAAGCTAATATCAATTTTGCAACAGCTAACTTGAAATTTTGGGAGACTGA
AGAAAAAATAACTCACCAGCACAGACTGCTCATTACAATGGAGAAAATAAATCTCAAATA
AGAAATTTAATTTAACAATTGATCTTGCATCATTGGTTGAAACTTTTAGGATAAAATGGT
TAAGACTTTATCATTATATTCCCAAAAACATCTTCCAAAAAAGGATGTCGTCAGACTTTT
TTGAGATGTGACTTTGAAATTTCCAAACTTCCTATAAAGATTTTAGAATTTTGCAAACTA
TACTTTTCCATTGGAAAATGATATTTAGTCTTTTACCCCTCACGGCGCCACCCTGTTGAA
CAACAGAGTAATCACCACAAACAGGAAGACAATGTTTAATCAGAAGTGGTTTGACTACAA
GAATATTTTTGCAAGGGATATTCTCGATTTGGAGAAATTCAATTCAGCGACTTCAAAAGC
AAATATGTTGAATGTTCAATCAAGGAACTTCAGAAAACCTGCAGATCAATTCCAATAGCT
TTAATACATTTAATAAAAAATACAATATAGTCTCCCAATGTTCAAGTTAAACAACCAAAT
TTAGTAATAGGTGAAACTAAACTTACCGGAAAAAATTTGATAAATAATTAAATAAATAAA
TAAATAAACAATTACCATGAACATTACCATTTGCCATGAAAAGTTAATTATAAAATAATT
GAGGCAGCTGTCACATCGGGTGCTCAATAATGGAATTCATGAAATTAAAGAAATGCAATT
CAAAATTAGAAACTATTATCCACCAGCAGAGATGTTGAGGAGTAGATTTGGCTTTGAGGT
TGATGCGTGTGATTTTTGTCATACAGCCTGAGAGGCAATCACACACCTGTTTTATTCATG
TTGAGTGATCCAAAGACTCTGGCAGCTTTTTCACAACTGTCAACAGACAACAACGTTTGT
AAACATCCTCTTGATTTTGGAAAAATACATATCCAAAAGAATAAAATGTAAAGAAGATCG
GTCAAATTGTCCTCAGGGCCAAGAACAACACAGAGAAGTTAACATGGACCTTCTGCTTCT
CTTCAGAGGACATTTTTTTAGAAAAGCGTCTTCATCCGTCAAGTTCAATTCAATTCAATT
CAATTTTATTTGTATAGCCCAAAATCACAACAACAGTCGTCTCGATGGGCTTCGAAGTAA
AACATGAAATCAGAAGGATCACGAATACAAAGAGTTCAATAGAAAAATACTAAAATGAAC
TAACAAACTGACTAAGCTATACTGGCATCCCTGCCCTTAGACCCCCCTTCGCGGTAAGGA
AAAACTCCCAAAAAAAACGGATTCCGGAAAAAACGAAGAAACCTCAGGGGTGCCCACATG
AAGGAGGGATCCTCCCCCAGGACGGACAGGCGATTTACCAGAACTCTTAGAGAAGAATTA
ACTTATCTAAATCTACAACTACATATATAAAAGTCCAGCAGACGAGCTTCATCCAGCCGT
GGTTGTGGGGACAGTCAAAGGCGCGAGTCGAGCCGGAGACAGGAACCACAGCCAGGTGTA
GGAGCAGGAGCAGAGGCGAGGTAATAAAATATAAAACCAAAGCATTGCCAGCGATCAAAG
TTTTATGTATATGTGGCAAACCCATTTTGTACTGTACAGGAGACACAGCACAGAGAAGAT
TGACGAACTATGGTTAACAGCCAATCAGGATGCAGAATACAATACACATTAAAAAAAAAA
AAAACTTGCTGATTTTCACACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCTAGGATCCAAACTGGGCTTTTTCAGAAGAGGTTTAACAACTGCATATTTA
AAAGACTGTGGCACGTAACCCGTTTCCAGAGAGGCATTTATCATTGTTAATATGGGATCA
TTAATTAGGGGAAAAGTTTCTTTAAAAAGTCTAGTGGGAATTGGGTCTAACAGACACGTT
GAGGATTTGGAGGACGTAATAATTGATGTTATTTCCGCTTGATCCACAGCAGTGAAGCAG
TCCAATGTTACAGAGGTTTCTATGGATGCCTCCATTTCTACCGCTTCAGCCTGTTCTGGG
CTGATAGTAGGAATAACTTGATTTAACTTATGTCTCATATTTGAGATTTTACTATCGAAA
AATGTAAGAAAATCATCAGAGCTGAGAGAAACAGGAACATGTGGTTCTACTGAGCTCTGA
CTGCGAGTTAATTTAGCTATAGTGCTAAAAAGAAATCTTGGATTGTTTCCATTCTCTGAT
ATTAAGGTTGAATAGTACTGGCTTCTAGCTCTACGCAGAGCTTTTTTATAATTTAATAGG
CTATGTTTCCAGACACAGAACGGTCAGTTAAGGTTCTTCTAAGTTGTTTATTATTCACTG
GGGCAGAAGGATGTTCCAGTGTAAGCTGGAAGGTAATCATAAAGTGATCAGAAATGATGG
GGTTAAGAGGAAGGACACTCAGCTGGCTGATCTCTATACCATGGGTTAGAACAAGATCCA
GGGTGTGCTTATGACAGTGAGTGGGTTCATTCACACTTTGGGTGAAACCAACATCATCTA
ATAAAGCTGCAAAAGCCTTTCCTAGGCAGTCACTGGGGTCATCAACATGAATATTAAAAT
CCCCTAATATTATAATTTGATCAGAATCTAAGACAATAGTCGATAGGAAGTCGGAAAACT
CAGTTAAAAATTCTGAATATGGGCCGGGGGGGCGATAAATAATTATGAGTAAAACAGGTT
TTCGAGTTTTCCTGTTTGGGTGACTTAAAGACAATATGATGCTTTCAAATGAATTATAAG
CATTTTTAACTTTAGGGCTGAGAAGTAAGCTAGACTGTGATATTACTGCCAAACCACCTC
CTTTCCCTGAAATCCTGGATTTCTGATAGTTAGCATAAGTGGGGGGGGGTGCTTCATTCA
ATCTAACATAGTCATCCTGATGGAGCCAAGTTTCTGTTAAGGCTAGAAGACTGAGGTTGT
TATCAGTAATTAACTCGTTGACTAAGAGGGACTTGGAGGAAATGGATCGAATGTTTAATA
ATCCGCATTTAATGACATCATAATTCTGCTTGTGAGAACTGCTGTCTGTCATTTTAAGGT
TTCAAGAGTTCAAGTTCAAGAATGACTTGACAAAACCATGAAGGAAAACTCAGCTGATCT
CTGTCCTGCATTTCTATGTAAAGGTAAGTTGAAAAAAATCAAGAAAAAAACAAAATGAAC
AGGAGGCAATGTTTTTTTAGAAGCTTCTAATTTGAGGGAAGCTTAGATCCAAAAAAACTC
AGGCAAGTTAATTTTCTTTGACCGTGTGATGTAAGCAGCGCCCTCCCAGGGGAACGTGGC
CTGATCCCTAAAATGTAAAGATGGTTAAACTACTATATTGTTTATTGAACTATCTGATGC
CTCTATGTTTAAGAAAAATATAAGTGCAGAATCTGGTTACATCTCAAAAGTTTGAAGAGT
ATTATGCAACATAATGAGACATTTGTTTATTTTCATTAAAATAAGTTGAAAAAAAACTTT
TTTATTTGGTAAAAGATGTTTACATGAAAATAAGAAATAGCTTTTGTAATTCATTAATGG
GTTTTTGTGAAAAAAGGATCATTATTTTTGTATAAAGTGTGGTTTTTGTGGTTAAAACTG
TTTTTGGTTGCCATGGGGACATTGGTGATGTCATTTTGGTGTCTAGAGGGTCATAACACC
TAGAGTGGGGCAAAAAAGTGTTCAGTCAGCCACCAATTGTGCAAGTTCTCCCACATAAAA
AGATGAGAGAGGCCTGTCATTTTCCCTTATATGTTTACCTCAACTATGACAAGCACATAG
AAAAAAACAGAAAACCACATTGTCTGATTGAAATAAAATAAATAAATTGTGATTTATGAT
GTGTGTTAGATTTGTGATAATTTTGTGCCCTGTTCCTGAAAGAACGTTTGTGAGTTACCT
CGGTAAGTTTGAAGGTATTGAAGCAGATAACCTCAGCTTTCGGTTCCAAAAACAGAGGTA
TGTTTCAGGATATGTTAAGTTGCCATAGCAACTCATGCCCTGAACATAACCTGGTCTGGA
GCAGGTTAGTTGAAGGTTAGTTGGTGTCATATAGAGAAGAAGCATGGCGTGACCATATGA
AAATGATTTAGTGGATGAAGAAGCTCTTTTACGCCAGGAGAGGGTGATTAGACCACATAT
TGATGTTGTATAGATAACATTTTTTACATTAATCTAACTTAATAATTTGCTTCCGTTAAT
GTATCTTTACCTCAAACTCCAGAACTTTGAAGACACCAAGATTGAGTATTTGGATGGATT
GGAAATGTTTTGCCCGACAAAAAAGTAAGAAAAACCTTTTAGTTACTCACCTATCCTTAT
ATCCTCCGCTCTTAAAATCTTTACTAGTAGTTAATATATCTATACCTCAAACTCAGGAGG
AACCCATCGCAGTGGACAGGATAGGCTCCAGAACTTTGAAGACACCAAGATCGACTATTT
GGATCGATTGAAAATGTTTGTGCCCGAAGAAAAGTAAGACAAACATTAAAGTTACTCACC
TATCCTTACATCCTCCACTCTTAAAATCTTTACTAGTAGTTAATATATCTATACCTCAAA
CTCAGGTGGAACCCATCGCAGTGGACAGGATAGGCTCCAACACTTTGAGGACACCAAGAT
CTACTATTTCCTGAGGTTCAGGCCGTGTCACACTGCCACTACGTACAATTTGCACATTGA
CCCTGGAGGAAAACTGGTCATAATGGTCAAAACATTGGAAGGAGCCTCAGAGGGCGCTGA
CCATGGTGCTGATGTGATCTCTGCTCAGTGCTCTGAAGGTCAAAATGAAGAAATTCAATG
AAGCAGATTTACGCGTACCTTGCGTGGTTATGTGTACTTGTTCCGAGTTTTAATGTGGTT
CCTCCGTGACATTTCTATAAACATTTCACGCACAGGCTGGCCTTCCGCGTGGCGCCTGAC
ACTGGTCATGTGATGACAGTCTGGTCACTGATGGCGCCCAGGCAGAAACCAGGAAAAGAT
TCTTGGACATTTTGTTGTGTTTTGCACACTTGAATGACAGTAAATTTGTTTCTGCACAGG
ATTTGAATCCTGACATTGATGGCCAGGTGAAGTTTCAGGAGAGAAAGGAGGTTAACTCCA
AACTCTTATGTTCACAAATGTTTGCAAGTTTCATTTAGTGTAATTTTTTAATGGTTTGGA
CATTAACATTTGAGGCAGGTGTTTCATTTTTTCTGTAGCCCCTCTTGAGTTTATTATCGG
GATTGCTTCAGTGTCAGATGTAAAATATTCAGTCTATATAAAATTGAATAGACTTTTTTG
TGTGAAATTAATTTTATGTAAGATCCATTGGCCTCTGTGAATTAATTTTTAATAATAAAT
GATTAGGCTACCATGTTGGTTGAGGCATGTTTTCTAATTGAGTAAAAAAACAAAAATAAG
GCTGTTATTGTCCCTGGTCCGGCCCACTAGAGATCAAACGGGTTGAATGTGGCCCCAGAA
CCAAAACAAGTTTGACACCCCTGATTTAGAGGCTTTAACAGAAAAAAAACGCCAGCTGTA
ACGTGGATTAAAACGGGAACAAATGCAGTGATTTTCACATGAGAAAAACTTAAAGCACAG
AAAAACCCGCTGCACTTCCTTACTTTGGTTTTGGATCGTTAGTTAACGGTTGAATCCCCA
TCACATTTGACGTTTTTTTTTTTATTAAAGCCTAAACTGACACTAATAGGTTTTTTTTTT
TCTGTATTTCACGTTAACACATACCGGTAAAACATGCACTCTAGTGTGTGTTTAAAAAGG
CAGCGAGCGCAAAACTGAGTTGGTTGTGATTTATTTTTCCAGTCATCAATCAGCACCAAA
AAATCCATCAAAGTCTTCATCTTCTGGATCTGAAATGAACAGCTGGGCTACATTTCTATC
AAACACGTCAGCTTTCCCTTTGTCATCATGAGAGTTTGTCTCGTTCCTGTGCGGCTCCAA
AGATCAAGTTTAAGTCCTACAGTCCAAAAGTGTGGCGTTACTCGCTCGGCGCTGCGTCAC
TGTCAAATTTTCATCAGCAGGTTCTCTTAGTCTGGGCACTGATCTACAAACACAACTTTT
CTCCACAGAGTTGTATTATTTGGAATAATTGTACTATTGTCTACAAAAAGAAATTTCTGT
TTTTAAGTAACTGGTTTATAAATGGTATAATTTTCCTCAATCAATTATTCAAAGAACCAG
GATTATTATATAACTACTCAGAATTCACAATGCTGTATAAAATACCAATAACTCCCAAAG
AATTTGCATTAGTGTTTGATGCCGTACCGTCTGGGCTTTCTTTGTATGTTATTCAGGGGT
TTCCAAAGCGCTCATCCTGTGACTCTTAATCCTCCTGATGTGCTCAAATCCCCTCTGGGT
AGTTTCTGCTTCACTCCTGCTAAACAGTTGAACTCAAAAATCAGAGCTTTGTTCCAAGAT
AATTTGGTTTCTGTTCCATCAGCTACCTCTTATTGGGCTAATTTCACTTCTAATGTTGAA
TGGAAAAAAGTCTGGTCTTTACCACAAAAATACTTCTTAACAAATAAAGTCAAAGAAATG
TCGTTTAAACTCCTACACGGATTTTATCCAGCAAAACATTATTTAACTAAATTTAAAGAT
GACATAAACACCAACTGTACTTTCTGCCAGAAACAACCTGAAACCTGCTCTCATTTATTC
TGGTCTTGTGAATTCACATATGAATTTTGGAAAAACATTCAGAAATTTATCACAGACTAT
CTTTGCTGATATACAACTTTATTATAAAAACGTACTATTTGGTTTTCATAGTTTTGATCT
CAAAGACCGTGATGCTTTCTTTTGTAAAAACATGTTGTTATTTATGGCCAAATTTTATGT
TCACAAAAGCTAATTTTCCAATAAAAAACCTGATTTCTTTGTGTTCAAACTGGAACTGCA
ACAATATTTAAACTTAATTTCAGCTTCGAAAAATATCAAAGCTCAAAAAACAATTAACAT
TTGTAAGTCTTTTGGAATAATGACATAAGTTTACTCTCGTATTTTCTCTTTTTATTTTTT
ATTCTATCTATTTTTTTCTATGTTTAGTTCTATTTTCTTTATTTATTTTTGTTTTTTATT
CCCTTTTGTGCTTGTTACTAATAATAAGAATCTTCCTAAGGATGTAACACGTTTATTCTG
TATTCAGAATTGTAATGTACATTATATGTGCATAAATGTTGCATTTTTTTGTTCTGTATG
TTGCAATTGTTCAATAAAAAAAATCAAAATGGAGCGGAGGATGGACAGTTTTTCCACTGT
CATCTGCTGGAAGTTCCTGCGCTCAGCCTCGAGTCAATCTTCCAAAGCAGGCAACCTCAG
TTTCCTCGGAAACTCAGCTGCTGCTGCTCTTCTTGTCTTGTCGGATTTGTTTTTCCAGCC
TCCTTACTTGCAAGCTATGGATTCATTATTTTAAATTCTCTGGCAGCTGAGGTTCAGTAA
AGGTAAAAAGATCTTCACAGATTCGGACTTCCGGCCTCAATAACTCTTCCGAGAAACGTT
CAAATGTATCTCAATCCTTTTGTATTAACACAGAGAGTGAACCATAAATGCAAATCTAAA
AAAAAAAGATAGTTTTTTTGCCTTTTAATCAGAATTGTTCACTTCAAGCTGTGAATGCAG
ACATGCAGCGAGCCGGCTGTCAAGGGACCGTCAACAAAGTGTAAACTCTGTGAACCATTC
TGTAAAAATCAATAGTCTCACAAAAAAGAATAAATGTCTGTATTTATATGAACGGTAATG
AAGACTCTTCAGCAAATTCATGTTACAATAAAAATTTGTAGGACATTCCATCTTTATTTT
ATCTTGTTGCATATACTTTTTCAAATTTTAATAGATATGGACATGACTAAAGTTATCGTT
ATGAAGATACTGAAGGTATTTTCACCAAACCTTCTGTACGGACTAATCATGACTTAATTT
TCATACTAAATTAAAGAATATGTCAATATTTTACTTTGTTTATTTTGAGGAATTTTTCAT
ATTTACAAATGGATTAGATTGGGTCAAAAATCCTCAATGGCACTTGACATGCAAATTTCC
GGCCAATCAGATCAACCACAAAGGTTACCGCCCCCCAAGTGACAAACACGCCCCCTTAAC
ACTGAGCTTAAATCCTGGTGAGGGCGCAAAGAGGAACTGAGCGGGATTCCCGCGGTATCC
CCGCTCAGTGAGAATTGCGGCCGTGCAGTTTCAAAATACACATGCGCGGTTGCAAGGTTC
GCTCACTGAGTTCCTGAATACGCCCGCTCAGTTGTCCTTACGCCCATTAACTTTATGGCA
GCTAGGAAACGCCATAAGGGTCCGCTTGGGTGTTTTCAGACTGAAAAATTGTTCCGGATT
ATCGGGGAAACAAACTCGCTTTAAGCGGACCAAATGTGTCCATTTTGAATACACGCAAAG
TTTTTTCTTGTCCACGCAATGTACCACGCAACCTATCATAAAAAAAGAAGAAAAAAACAA
TTTCCTGGATGCGTTGGACCTGATCACATCATAAACTGTTTAACCTCAGCTAAGCCATTC
AGCTCATGCTAGTCAGTGCGTGAAAATGTCAATACATGGAGAAATTTAAGTGGAAATCCT
CATGAAGCAAACTTTATGGTTTGCTGAAAGACATTTAAACTTGGCACAATGGGGAGCGAG
GCGATTGAACCGCTTGTTCAAAGGAAAAAATACAGCAAGTCTGCAAAAGCTAGACAGCAG
ACTCCAGCTCCTTGTTTCTCTCCTACTCGTTCCACCATCAACAAGACTAACTTTTTAACG
GTCAAATGCATTATGGAGATATTTTTAAAGCAATTCTGCTTTAATTTGTTGAAAGTAACA
GCTTTTGCTTAACTATATTCAGATAAAAAGTTAAAAACATAAAGAAACAATTTTTTTATT
CAATTCCCTTTTTTCCTAGCACCCTGGTTCATTGTAATGTCACTTAGAGATTTTCATCAG
ACTTCTTTTAACTCGAGTCGGATGTTTCTCCACTTTTGTCCGTGCTTTTCAATTCCTCAC
TTCCTTCAGTCTTGGGATGAACTGTTTGTATATGAGGGGGAGGAAGAGAAGGAGGAGGAG
GAGGAGTCATTGAACTGCTCACGTTGGTTCAGAGGTGAGGCATCAGAGTATTGGCAGCTG
TCCTCCGAGGAGGACAACGAAAAGGTTGAGTCAACTTCAGCTGCCATCCACAAATCCTCT
GAACACCATTCCATGTGTGCGTCCCTCTCCATCTGCACCTGTAAAGACGGCCTTTGATCA
CCATGGAAATTGATCAGGATTTCGTGGAGCGTGCATTTTGAACTGTACTTAGACGCCCTA
CCTCATGATCTATAACTGCGTTGTTGTAATGGATGTGCTCAAAGGACATCAGGTCCAAGA
ATAAAAGAAAGTATTCCTCACTGTCCTCAGCCTCCTCTTCATCCGTACACTTCTCTTCAG
CGCTGTCATAACTTTCTTCTGACAGGCTTTCTGACAAGAGGGACTCCACAGACATTCTGT
TGTTTAAGTGTTGCTCTCACCTCTTGCACTTGCTCTTTTTTTTCCAGGCAGGATGCATAT
GAGTGTTGTGGATGAGTGGATGTTGTTTTTTAAAGTGTATTGAAGTTGGTGTTGCCAAAG
CAGATTGAGTTTGAGATCATTGTGCTAGGCAGCTGAGGAGTGCTTTGATTCAAAAATCCT
TCCGGAATTTTATGTGAACTTACATTTTAGTGAAAAATTATATTTATGTAATATTCTATC
ACGAGTATTTCTTTAAAAAACAGATTTCAGTACGACTTACTGGCCAAGCTCTCAAATGTT
TCACCTCAGTATCTTTGTTTTGTTTTTTTGTAGAATTTGTTTCTTAATTTTTGTTTTCTA
CTTTTTGCTTATGCATTTATTATGTGTATAATTGAATGTTAAATGACTTATACTTGAAAA
ACACATTTGTTCCTTGCTTTTAAGTTCACTCCAATCATCTTGTGATTAATTTTCAGAGTT
CCCTGTGGGCCTTTTAAAATTATGCCATTTTGACCAAAATCAATAAACTTTCTAAGACAT
AGTGTCTGCAGAGCCGCAGGAAGTCGCTAGAAATTCACCTCTGAGTTGTGACTGCTGGCG
TAAAGCAACTCTACCCTCACATTCCATCATCCATCTTTTTACACTCTCTCTCTCACAAGC
TTACAGCCTCTCACAACCTAAATATATAGATATAAGATCTATCCAGCCATATACATAGAA
TATTGTATTTATATAAAGAAACACCCAGAAATGGTATTTTTGGATATTTCAAAGCTCAAG
TTTCTTTACATATGTCCCCTACAATCAGAAAAATGCCACAAGAACAAAGTAAAAACAACA
CAAACACTATTTTCATTGGAGTTAGTCTAGTTAGAAAAAGTCATGGCTAGGGAAATTGAA
GAGACTAACAAATATTTAAATAAACCATAGGCCTGCAGAATAAATTGCAAATTTATCGTA
ATTGGGATATCAAGCTGTGCAATATGCCTATTGCAAAAGACGGCGAATATTGTAATAAAT
GGTGACCTGCAAGCTGCCATAAGATTGCTAAAAAAAATCTCTTCAGTGATAAAAGTCTTC
CGGGTATTCCCGGAAATCCAGGTTTTTGAGCAAACCGATCGTACCTTCAGGGAAATAAAG
ACCTGATCTCTAGGACAAATCGCTTTCCGGAGAAAAAAATTGTCTGAAATCGGCAAATTT
TAACTTTATTTTTTATTTTTCTTGACCATCTTGTCTTCGTTCTTCTGGCCTAATTTACCA
ATGACGGGACGTTTTAGTTGCTTTCGGATGCGTCGACGGCTCTGATTGGCTCTGTCTGTA
CCACGTGGTCAGCGCGACGGATTCCATAGAGACCAAAAATGGTGGACCCACGCTAAACTT
TTACAAACAAAACTGAAGAGTTTGCGATGAAATTTTTGTTAAAATAATGGCAGGCATCGT
CATTATTGAGCGTGGTCGCGACCTCAGTTGTGAGAAGACGATAAAAAACAAATTAGGAGG
GTCTTTTTGTCACTCTATGCCCCTGCTTCCTCCTTTAATATGTCACAAGAGCAGGCAGAC
AGTTGGATGCAAATGCAGCAGCTTTATTAGCTCAGCTAAAAGTCCACAAAACCAAATCAG
GGGCATGCAGGCAGGAGTTGATAGCAGGCATAAGTTCATCAGAGGAGAGACATGTTAGAC
AGGATCCAGGCAAGAGTCGGGGCAGGCAGCAGGCAAACTGAGTCAAACAAAAGATCAGGA
AATAGAAGATCAGGTCCCATGTATATGGAGTCCTATACTGTTCATAATTAAAGAAATAAA
TGTTTGATTAAATAAATAAATATGACCTCATGCAAATACAAAATAAACAATAAATCTCTC
ATAAATATATAAAAAGATCATGAAATGGTGAAAAACCTGCACACCAAATTAAAATTAGCC
ATTATATTATTCAATATATTTCATTTTGCTTTAAAAACCTGTTCATTATTTTAGAATAGC
ATTTTAAAATATTCATTTTAATCATGTTGAATATTATTATAATTCTGTCTTTTTTCAGAA
CCTCAGATTTCAAAATCATTATTTTCCAAAGTAGCTGTGTTTTTATTTCATGTTGCTGTT
TTTCAGAAAGACTTATTTATTTCATGAAGAGCTTTTTCAGTTGAATGAGTCTGTCAATCA
GAGAAAGTGGGCGGGATCTAAACGCTCATTGGCGATCCCTGGAGATCGACTCATATTCCT
CGATACCCGCTCTGCAGTGTTTCAGTCAGAGACATGACACATTTCAGCGATATCTGCATA
GCTTTGTTGACATTAGAGTATAAAATAGAGACAAACAATCTGTCTGCAGCAGAAGATGCA
AACATGGACGACTCTGTTTTTGTAGTTTGAGGGTTTGTGTGGACCAAACCACAGAGGAGC
TCCGGTGGTCCACATCTTCAAGTACCCCGTTGAAACACTTCTGACTCTCGTTCTCACGCC
ATTCACTCAGAGCTCCTCTCTGCTCTGCAGCTCACAGCTCTGCTGTCCATCTGTGCTCAC
AGATCCAGTCTGACGTCACATCGTGCCTTACACTGTGTCGGCTCGCGGGAGGCCTCCTGA
ACCTCATGATATTTTTCTATTTTTATTCAGACAATGATTATAAATCAGGTCCTCGGATTT
TATTTTTCTCTCTCAGGGAAAATGTTGAACCTTCCTGACGTTTCTGACCGTGGTCTGAAA
ACGCAGCGGAGATCTGGGGTTTGATTTAGGGATCACTTCCCAGTTCGGACACCTCCAGAG
CGGGTTAATAAAATAACCAGTCTCTATACTTTGGAGGAAACCTTTTTTTATTATTACTTT
TCCGGAACTGAGCTACACACCCTTAACATGCGCTCACATACACAAGCACACACATTCTTA
CGCAGTACGCTCTGATTACATGTAATTTAAGACATGGTTTGACTGCAGGAGTTGAAGCAG
AGCCTCTCTCTGGGATGATGTCATGAACTCAAACATGGAAACATCATTTAGAACTATTCA
AAATAAATAAATAAACCTGATATTTTGACATTCTCTGTGTGTATTGTGCATCCATGCATT
GTAAGTCAGATAAACACAGCCACAGCTCCATGGGGCTATCAGGCTAAAACATTTGCTGGT
AGCTCCTCCCACACGCGGCATGGTGCGTTCATGGAACTCCAGTTCATAGAAGCGTAGTGG
AACTCCAACAGCCACCCAGCCTAACTTAGACCACTACTATATGTTCATGAGAAGATGAAA
ACCGCCGAACCAACCACAGAATCACCCGAATTATGCATAATCGCCCAAAGCCACTTTTAA
ACTTAGAACCAAAACTGCCCAATTTCTGGTAACACTGTGGATGTGTTTGAGGTGCATACT
CCCCCTAGTGTTGAGGAGTGTGCATTGCGCCGTCACGTTCGCTGAAGCATCTTCCATTGC
TGTGGTCAGGGTGCTGCTGCTTATGTCTGAGTAATGGGGGTAACCAATCATAGAAGTGTC
TCCGCCTCTGGTTGGATTTGACTCAGAGTCATTGTCCTGAAAAACCCCTTCATGAAATAA
ATAAGTCATTCTGAAAAACAGCAAGATGAAATAAAAACAAAACTACTTGGAAAATATTGA
TTTTGAAATCTGAGGTTCTGAAAAAAGACGTAGAATTATAATAATATTCCACATGATTAA
AAGGAATATTTTAAAATGCTATTGTGGCAGCACGAGAAAACGGGTTGACAACGCCACATG
GGGCTGCTGAGCCCCAGGAAAAGATTTTAAAGTAAGGCAGGTGCAGGTCCTGCTCTAAAC
CAAGGCAGAGGCTGTGGTTTTGTTTTAAAATATAATTTATTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAATAAAGTTTGGCC
TCAATTACAAAAGGGGTTTATTCAGACATACCTTTGGTTTGTCTGAAGATTAATAACCCC
TCTTGTTAAAGCAAAATATGTCCAACACAAGAGGCCCTCAGCTCTCGTCTGTCTGCCCAG
CTGTTGGACAGGACAAGTTAAAAAAAAAAAACAATGTTAAGAAACCTTTTAATAAAACAA
TCCTTGATAAAAGTCAGTTAAAAATGTTCTGGAGGAGGAGCTTACCGAGGTGGCTAAAAA
CAGCATAAAAACAATGCAAACACCCCTTTGTGAATCACTGCACACGTGATGGAAACCACA
CAGCACACTGGGACCCACCACGAGGTACAGCAGTCCACCACCTCGGCCTCCTACCTCCTG
AAACAAGAATAAAATTGACGATATCAATAAAAGACACACAATTAAAAGTAAAGATTAAAA
AGATGATTAGTGTTCCGGGGCGCTGGTAAGCCGCCCAACCACCGCCGATCAGCTGGTGGG
AGTCGTCCACAGTCAGGTGAGATGCCACAACGACGTCTCCGTGAGCTGGGCGTTCGCTCC
AACCGGTTCCGTCGTGGCGGGGGTGGGACCCGGACAGAAATCACAATAAAAACAATAAAA
GCAAAGCAGCGGGGTGAGAAGGGCGTGCAGGGCGTGCAGCCTCAAACACGTTCCTGAAGG
AAAAGAAAAATAGTTTGCAGGAGCCTTACTTGTATGTGCAGGTGGAAGCCAGTTAAACAT
ACCGGTCACTGAGAGATCTAGGTAAACAGAGTCACGTCACGCTTGCAGATCATTGCCGCT
ACGTTGCAGATGCGCCAAAGTCTGGCCGGTTTCTTGTGTGCATGGAGCTGTGAACAAGTT
TACTTGTCAGCTCCCACTCCCTATTCGGTTCAGAGAACTCAAGGCCCGGCTTACCTGCCT
GTCAACCCCCGCTCTACTTCCCGATGCCTTGGTGGCACAGCACAAATTCATGTCTGAACG
AAGAGGAGGAGAGCTTTTAAAGCACCGCCACCAAATTAACACAAGTGTGTTCTGCTGCCT
CACAATTAGTGGGCGTGTCCTACTTGCCACACTATTTTAAAATAATGAACAGGTTTTTAA
AGCAAAATGAAATATATTGAATAACACAATGGCTAATTTAAAATCTGTGTGCAGGTTTTT
CACCATTTCATAATCTTTTTATATATTTATGAGAGATTTATTGGTTGAATGTGTATTTGC
GTGAGGTGATATTTATTTATTTAATCAAATATTTATTTATTTAATTATGAACAGTATAGG
ACTCCATACATATAACGCTCTTTAAGAAAGGCAGAGTGGGACAAACAGTCCTGGGGGGTA
TTCCAGGAAGCATGTTTAAACTAGCTTGGCTTTAAGCCTGAACTCTGGCTGAAATCCGCC
TGAACTTGCTTACTCTGGATATGTCGGTTCCAAAAGACCGGATATGAGTTGGCGTAATTA
CGCTCGACTTGATAACCCTGGGTTAATGGGCGTGCACAGCAGGTACATAAAGACATTCTC
AATGGATCGCCGATTTCTGGAGTCACCATGGAAACGCGTGGAAAAAAGAAAGCGCTATAC
TTCGTTGAGACGGAGTCTGAGGTTTTAATGATGGCGTATGAAGAATNNNNNNNNNNACTA
AATGTCATATTACTCCAATTCAATTAATATTTTTTCCATCTTAATTAATTATATTTCTTG
ATTTCTCATATGTCTAAGTTTGAGCCAGCAGATATGCTCATTTTTATAACAATAAAAAGG
ACGGGAAAAAGATGCACGTTGCGCACAAATTCATTAAAGAATTAGCCATCAATGTTATTA
CACTAGGGAGCGGTGCTATATAAACTCATCATCCTCTCCTTCACTCTCACTCATGGTGCA
GAGACATAAGCACAGTATGACTAAATAACTCAGCAAAACATGGCAAAACACAGTAAAACA
GCTAAACAACTAAACACATTTGGTCAAAAAGGCACAATTAAACCCAAATCCATCCAGACA
GGCAAAGGAAATGGTATCCCACAATCCCTTGCGGTGCCAATCTAACATCAGCACCAAAGT
TACACCTACTTAATTGAATTAATTTGAATGAAAGTAAAATAACTGTCTGAAAACTGCGTG
TTATTTTTAAACTGACTTAACAAACAAATGATTTATCTTAACTGAAGCAAATAACTAAGT
TAGATCAAAGTAAAAAGTTTATTTTTCCAACATCCATACGTGGTCTTATCACCCTCTCAT
GGCGGAAAAAGTATTATCTGAGCTTCTTCATCCACTAAATCATCTTCAAATGGACACGCC
ATGCTGCTTCACCTCTCTGAAAACAAAATAACCTTCAACTAAACCTGCTCCAGACCAGGT
TATGTTCAGAGCATGAGTTGCCATGGCAACTTGACATACCCTGAAACATACCTCCATTTC
TGGAACCGAAAACTGAGGTTATCAACTTCCTTAGCCTCAAACTTATCGTGGGAGCTAGCA
TAACCTGCTTTCTGGAATACCCCCCTGCTTTGTTCAGTGCAGAGCTCAAGTATGCTGTGG
TTAATTGATTGAATGAGAGTCAGGTGTGCGGCATCCAGGAAGTGTGCGCTGGGGTCGCTG
GGAGCTGTAGTGTGGCTAGAAGTCTGGGGACGGCTCACACCGGTGATCAGGAGGGAGACA
GAGCTCTGACTTCTGACACATTCGTTTAGTGTGAGAGGTCCTGCAGCCCGATTTGAGCGT
CAGGCATGACGCCTCAGTGTGGCAAGTGAAAAGGGTCACAATTAATCCGGAAAAGCGTCA
TAAAGAACGACATTTTGGCCATCTAAAACACCGCCTTTTATGCCCGTTTTAAAAGTAGCA
TGTAGTTTATGCTGTCTTGTGTTGTCCAAAGGCCGGCGGGAAAAGCAGCCTTTTATCTCG
CACAAACCGGGCGTCCAAAACACCGTTCTAGCGCGGTCAAAGTTGTCTGTCCAAAGCACT
GTTTTGTTGTGTCACATACAGTGAGGTCAATAAGTATTTGATCAACCTTTGATTTAGCAA
GTTCTCCCACTTAGAAAACATGGAGGGGTCTAAAATTTTCATCATAGGTGCATTTCCACA
GTGAGAGACAGAATCTGAAGAAACATTCAGAAATTACGTTGTACGATTTTTAATAACAAT
TTATTTGTATATTACTGTGAAAAATAAGTATTTGATCACTTGAATTAAACAATTTTAATA
TTTGGTAAAGAAGCCTTTGTTAACAATTTCAGAGGTCAAACGGTTGCTGTAGTTCTTCAC
TAGGTTTCTACACACTGCAGCAGGGATTTTGGCCCACTCCTCCATACAGATCTTCTCTTG
ATCTGTCAGGGTTCGGGGCTGTCGCTGAGCAACACGGAGTTTCAGCTCCCTCCAAAGATT
CTCTATTGGTCTGGAGAATGGCTAGGCCACTCTAGAACCTTGATATGCTTCTTACGGAGC
CACTCCTTGGTTTTCTTGGCTGTGTGCTTCGGGTCATTGTCATGCTGAAAGACCCAGCCA
CAACCCATCTTCAACGCTCTGACTGAGGTAAGGAGGTTTTTGCCCAAAATCTCACAATAC
AAAGCTCCCTTCATCCTCTCCTTAATACAGTGCAGTCGTCCTGTCCCCTGTGCAGAAAAA
CACCCACAGAGCATGATGTTTCCACCCCGTGCTTCACTGTAGGTATGGTGTTCTTGGGAT
GATGCTCCTCCCTCTTCCTCCTCCAAACACGCCGAATTGGTCTCATCTGACCACAAGACT
TTCTCCCATGACTCCTCTGGATCATCAAGATGGCCATTGACAAACTTCAGACGGGCCTTG
ACAAGGGCTGACTTCAGCAGGGGAACCTTCTGTGCGATACATGATTTTAAACCATTACGT
TTTAATGTATTACTTATAGTAGCCTTGGAAACGGTGGTCCCAGCTCTCTTCAGGTCATTG
ACCAGCTCCTCCCGTGTAGTCCTGGGCTGATTCTTCACCTTCCTTAGCACCATCGATACC
CCACGAGGTGAGATCTTGCGAGGGGCCCCAGTCCGAGGGACATTGACAGTCATCATTAGC
ATTTTCTGACAATTGCTCCAATTGTTCTTTTATCACCAAGCTGCTTGGCATTGGCCCGTA
GCCACTTCCAGCTTTGTGAAGGTCTACAATTTTGTCTCTTGTGTATTTTGACAGCTCTTT
GGTTTTGCCTATGTTGGTAGTTAGACTTCTGACTGATTGTGGGGTGCACAGGTGCCTTTA
TGCAAGCTAATGACCTCAAACAGGTGCAACTAATTTAGAATCATGAGCAGAGTGGAGTTG
GACTATTTACAAGCAGAACAGCAGGTCTTTGCTGGTCAAAAATCTATCTGACAATCAAGT
GATCAAATACTTATTTGTCACAGTAATATACAAATACATTTTTTTTTTAAATCATACAAC
ATGATTTCTGAATGTTTCTTCAGATTCTGTCTCTCACTGTGGAAATGCACCTATGATGAA
AACTTTATACCCCTCCATGTTTTCTAAGTGGGAGAACTTGCTAAATCACAGGGTGATCAA
ATACTTATTGACCTCACTGTATGTGAGTACTCTACCTAGCTGAGATGGTAAGACCATGAG
GTGGGGTTCTGGGAACACACACAACGACGAGCAGACACCAAATCTTGATTCGTGCGTTCA
GTCTGGCCATTTGTCTGAGGGGGGAAACCTGATGATAAGCTGGCAGTAGCACCCAACCCC
TGGTAAAAAGACTTCCAGACCTGGGAAACGAACTGCGGACCACGGTCGGAAACAATGTCA
GAGGGAATCCCATGAAGACAAAATACATTGTCAATGACTCTTCTGGCAATCTCAGTGGCA
GTGGGCAGCTAAGGCAAAGCCACAAATTGGGCTGCTTTACAGAAGCGATCCACGATGGTC
AGGATAACTGTGTTGCCTTTAGAGGCAGGGAGTCCAGAGACAAAATCCACTGCGATGTGA
GTCCAAGGTCGGGAAGGGATTGGCAGTGGATTTAGAAGGCCAGCAGGAGCTTGATGGGCT
GATTTACTGGTGGCGCAAATCGTGCAGGCTGCAACATAAGACCTAGTGTCAGAGACAAGG
GAAGGCCACTAGAAGTGACGTTGGACTTGGAGCAGTGTCCGACGGAAACCCGGATGGCAA
GAGAACTGAGATGCACGGACCCAGGTCAACACTTGTTACCGGACCGAAGCTGGGACATAT
TGATGGTTTGGAGGTCCGTTTCCGGGGTCTGGATCAATGGCCAGAGCATGCTGGATGGCG
GTCTCGATCTCCCAGGAGAGACTAGCTAGTACAGAGGAGGGAGGAAGACTAGGACTTGAG
GAGGTGTCAGGGTCTTCTGAGGCTTGAGGTTGCGCGACCCTGGGCAAATAGAAACTGTGA
AATTAAATCTGCTGAAAACCAAAGCCCAATGGGCCTGATGAGGATTGAGTATTTTAGCTG
AACTGATGAATTCTAGATTTTTGTGATCGGTCCAGACTAAGAAAGGATGTTCAGCACCCT
CCAGCCAATGACGCCATTCTTCCAGGGCCAATTTGATGGCCAACAATTTCCTATTTCCAA
CGTGATAGTTACGTTCAGGGGGAGACAGCCGGCGTGAGAAGAATGCATATGGATGAAGCT
TCCCGTCCTCAGTGCGTTGGGAGAGGACCACCCACACCCCAGTGTCAAAGGCATTAACCT
CTACCACAAACTGTCAGGAAGGATCAGCTTGGGCTAAGACTGATGTTGAAGTGAACCGGT
CCTTAAGGAGGTTGAAGGCATCCTCGGTCTCTGGGCTCCACAGAAAAGGGGTTTGGGGAG
ATGTTAGGCTAGTTAGGGGGCATACAATACTGCTGAAGTTACGCATGAAACAATGATAAA
ATTTGGCAAAACCAAGGAAACGCTGTAGATCCTTACGTGAGGTCGATCTGGACCATTCCT
AAATGGCAGCGACTTTGGTAGGATCCATGTTAACCTGACCTTTTTCAACAATGAAGCCAA
GGAATGAGATCTTGGGGACATGAAATTCACACTTGCCAGCCTTGACATAAAGTTTTTTTT
CAAGGAGACGTTGGAGGACCTGATGAACATGTTGGACATGGGATTCAAGTGAAAGGGAAT
AGATCAGAATATCGTCCAGGTAGACGAACACGAACCGGTTAAGGAAGTCTCGTAGAACGT
CGTTCACTAGTGCCAGAAAAACTGCTGGAGCATTAGTTAACCCAAATGGGATCACAAGAT
ATTGAAAGTGGCCTAAAGGGGTGTTGAATGCGGTCTTCCACTCGTCTCCCTCCCGTACAC
ACACGAGATGATATGCGTTACAGAGGTCCAATTTAGTAAAAACTGAAGCCCCTTGGAGAT
ATTCAAAAGCCGAATTTAATAAAGGTAAGGGGTATTTATTCTTGATTGTGATATTGTTAA
GTAGACGGTAATCAATACATGGATGGAGAGTCTTGTCCTTCTTTGCCACAAAGAAAAAAA
AACAGCTGTCAGAGGGGAAGAGGATGGACTGATGATGCCTGCTGCTAGGGACTCTTTCAT
GTACTGTTCCATGGCAGTTAGCTCTGGTTTGGAGAGACTGCACAGTTTCGATGTGGGCAG
GGTGGCGCCCGAGAGCAGATCAATAGCGATGTCATAGGGATTCACCTGTGTCAATTTTCA
AGCGAAGTGTGTGTTTCTGGCCAGATAAGTCGGGTGGTTTTACATTTAAAATTGTGTAAG
CCTCTTCCCTTGGCATATTTGCATCAATGCTGTGCATGCATTTTTTGCTGGCTATGACAG
AGTGAAACTCTCTTTGATATTGGTTTTCTTCGCTCGAGTCTGTGGTTTGTATGGCATCTA
TTTTACCTTTGTTTGGCTTTTTTCGATCATTCTTGTAAGACTGTCTCAGATAATTTTTTC
TGTGGTATCTGCTCATTGACTGTGGCTGAGGTTTATCTCGCTGGTGTTCGTTGGGGTATT
GTGTTTTTTTCTGTTTTCTTTTTCTGCAGCACTTGGCCCAGTGTAGCCACAAAGGTGACA
TGTGTCATTATAAGCAGGACATTGTCGTGGCTTATGATCTGATCCACATCTTTGGTAGAA
CCTTCCCCTACCTTTGGTGATAACATCCACTCTTTCCTTTTGCTCTGTTTTGCATACCTC
AAGTGGGTGAAGTTGGAGATTTGTGAGCGCTTCATTTTTTCGTCCTTCGGTCAATACTTC
AGCCAGAGAAAACCTTGAGGCTTGCTGTAGAGCTCATTTCTGAAAGCTTCATGTGGCGTG
CTGACTATGATAAGCTCAATCAGGCGTTCATGGAGTTCTTCATCTGTGAATTGATATGTT
AGTGCAAGAGTTCTCGCTCTGGTTATAAAATCATCAATACTTTCGCCTGGTTTCTGTCTA
TATTGCATAAGATGCAGTCTGTGAATTCTGAAGTTAACATCCAGCTTTGATTGTCCTTCA
AAACACTTCCACAGATTTGCCGGGACTTTCTTTTCATCTGCCGTTAGGCCGCTAGCATTT
AGCCCCTTTAGCCCCTCATCTCCGATGCCTCGGCATATTTTCCTAGCTTGTTTTTCTCCA
TCTGAGATTTCCTCATCCTCTAGGTACAGGTACATTTTTTGCTTGAATAATGAAATTGCC
TCACCCAGATCCGGGTCGGACCAGTTCATAGTAGGAAGATGCGACGCCATCTCGAACCAG
CAGGCTACACGTGCAGTTAGCTAGCAGCAGCACGTCACTTATCCACGGACAAGTTGCAGC
TTCAGTTCGCGTCGGGCAAATTCCTCTCTCTTCTGTTTTTTTGTTTTGGTCAATCTCAGT
TTTCCACTGCCACCATGAAGTGTTATTGTATTAATGAAGACCGGCAATAACCCATAGAGG
GACCTTGCAGCTTTATTCACTTCGAACTTATCAGCCATACATGTAGAACGTAGGCTCAGG
TGAAAAGGCAAACTCTGTATCCCTCCGCGTAGGAAACTGCACTGTCCAAAAATATAATCG
CAACACTTTTGTTATTGATCCCATTTTTTATGGTATGAACTCAAAGATGTGAAACATTTT
CCACATACACAAAATAACCAGTTCTCTGAAATATTGTTCACAAATCTGTCTAAATCTGTG
ATAGTGAGCACTTCTCCTTTGCCAAGACAATCCATCCCACCTCACAGGAGTGCCATATGA
GGATGCTGATTAGACAGCATGATTATTGCAGAGGTGTGCCTTAGACTGGCCACAAGAAAA
GGCCACTTTGAAATCTTCAGTTTTGTTTTATTGAGGGGGTCAGGGGACTCAGACAACCAG
TCAGTATCTGGTGTGACCACCATTTGCCTCATGAAGTGCGACACATCTCCTTCGCATAGA
GTTGATCAGGTTTTCTATTGTGGCCTGTGGAATGTTGGTCCACTCTTCTTCAATGGCTGT
GCAAAGTTGATGGATATTGGCAGGAACTGGAACACGCTGTCGTATACGCCGACCCACAGC
ATCCCAAACATGCTCAAAGGGTGACNNNNNNNNNNGGTATTTGCAATTCTGAGAAGCAAA
AAGCAATCACAACCTATTTCTATAGCAGGGTGGATGGAATAGTCACACTCTGGGAACTCC
TGCCAGACACAAACAGAGGGTCGTTTACCTCGCCAGGCACAAGGAGAGGAAGCCTGTTGG
ACGTTTTAAGGCCACAAAGGGGAAGAACTCTTCCTGTCCTGGAAGGAAGGAGAGTGTCCA
ACGGGATGATTGGTTTCTAGAAGTCTTTTCCTGAGTTTGAAATCAGCTTCATTTTTTCAT
GCTGTTGTTTCTTCCACACAACATCCACATCCCTGGTCTTGGGGGACTGTGTGACCCTCA
GAGACGCAGGGCTAGGCAGCCCCAGGCTAATGGACTGAGACTGTTTCAGCTGTCGTCCTG
TTTGGGATTTGCATATCTAGCCTGACATCAGATGTCCTTTCTTAAACGACCCTCTGCATT
TACCCGGACTTGGGACCGGCACACAAAAGCACTGGATTGTGCCCTCGTGTGGTTGCATTA
AGTTTTGGAAATGGCATGTTTCCAATTGTTTTTTTCATTTGATTTGATGTATTTTATAAT
AATTTTGTATGATATAATTAGAGTCAAATCATTTTTTTAACTTCATTTTTATTAGTTTTT
GTCATATGAGAACAAAACACAACCAAAATCTGCTCAGTTCTCTTTATGTTGAATTCTTTT
TCCATCTTATCTTTTACTTTTAACGTTGTGTTTTTGTCACATTTTGTCACGAATTAAAGA
TTTGTATAGTGTACTAATGAATTTAGTATTACTGTCTTCAGGGCTCCAGACTAACTTTTT
TCACTAGGAGCACTGTGGCCCCCAACTGAAAACTTTAGGGGCACAACCAGAAAATTTAGG
GTCGCATTCCATAAATCAACATGCTAACCAAATCTACTAATTTCCACACTATTATTAATA
ATAGATGAAGAAATTACAATGTTCTGTTACAAATTCGGTGTCACAATGTTTTCTGCACTT
TTGAAGATGCAGAACAAGGTAAACTAACAGCACCATCGCCGTCATGACAGTACAGACAGT
AAACAAAATACCATACATTCAGAATGAAAAAGTGCTTTGTATCCCCCCCCCCCCGGTCCC
CCAACAATCCAGGGGAGGGGCTGGTTCATCTTAAAAAAATCCATCGTTGCTTTTCCACAC
GTATTTTCAGGGCGTCTAAAACTAAATCTTGTTNNNNNNNNNNTGGACATGCTGGATGTG
GAGGTTTGGGCTGGTGTGGTTACACGTGGTCTGCGGTTGTGAGGCTGCTTGGATGTGCTG
CCAAATTCTCGGAAACGCCTTTGGAGACGGCTTATGGTGGAGAAATGGACATTCAATTCC
CTAGCAACAGCTCTGGTGGACATTCCTGCTATCAGCATGCCAATTGCACGCTCCCTCAAA
ACTTGTGACATCTGTGGCATTGTGCTGTGTGATACAACTGAAGATTTCAGAGTGGCCTTT
TCTTGTGGCCAGTCTAAGGCACACCTGTGCAATAATCATGCTGTCTAATCAGCATCTTGA
TATGGCACACCTGCAAGGTGGCATGGATTGTCTTGGCAAAGGAGAAGTGCTCGCTATCAC
AGATTTAGACAGATTTGTGAACAATATTTCAGAGGACTGGTTATTTTGTGTATGTGGAAA
ATGTTTCACATCTTTGAGTTCATACCATAAAAAATGGGAGCAATAACAAAAGTGTTGTGT
TTTTATTTTTGGTCAGTGTACAAAAGGACTCCGGTTTACTTTTAAATCTTTTGCTCATTT
TGGCTAAATGTTATATTCTTAAATTCTCTGGTCGAAAACCCTGTATCATTGTATTCTTTT
CTGAGTTAAATCAGTATATTAATGGTATTTGCAATTCTGAGAAGCAAAAAGCAATCACAA
CCTATTTCTATAGCAGGGTGGATGGAATAGTCACACTCTGGGAACTCCTGCCAGACACAA
ACAGAGGGTCGTTTACCTCGCCAGGCACAAGGAGAGGAAGCCTGTTGGACGTTTTAAGGC
CACAAAGGGGAAGAACTCTTCCTGTCCTGGAAGGAAGGAGAGTGTCCAACAGGATGATTG
GTTTCTAGAAGTCTTTTCCTGACTTTGAAATCAGCTTCATTTTTTCATGCTGTTGTTTCT
TCCACACAACATCCACATCCCTGGTCTCGGGGGACTGTGTGACCCTCAGAGACGCAGGGC
TAGGCAGCCCCAGGCTAATGGACTGAGACTGTTTCAGCTGTCGTCCCGTTTGGGATTTGC
ATATCTAGCCTGACATCAGATGTCCTTTCTTAAACGACCCTCTGCATTTACCCGGACTTG
GGACCGGCACACAAAAGCACTGGATTGTGCCCTCGTGTGGCTGCATTAAGTTTTGGAAAT
GGCATGTTTCCAATTGTTTTTTTCATTTGATTTGATGTATTTTATAATAATTTTGTATGA
TATAATTAGAGTCAAATCATTTTTTNNNNNNNNNNATGATCATATTCTGCTGGTTTAATT
TGCCTATCAAATGCTACCCATTTTTCATTTATTTCTAAATCATTTTTAATTTTAATATTT
TCAAAGTCTAATGTTATTTCCACACCTTGAAATTTCTTACCTTTTATATTCCAGTTGAAT
TTCAAGTTGTTTCTAATAAATTCAGAGGGGCCATAGTTGAATTTCAAAATTTGAAAATGT
TTTTTTACATCCAGATACATTTTCAAATGTTTCTAATAATAGCTGATAACTTTTCTTAAA
ATAAATCAGCTTTTTCTTTTATTTCTTCTTCTAACTAGTAAGTGCTTTGTTGTTGTTGCT
TTTTTTTACTTGTCCTGTCCAACAGCTGAGCAAACAGATGACAGCTGAAGGCCTCTTGTG
TTGGACATATTTTACTTTAACAACAGGGGTTAGGAATCTTCTGTCTGAATAAACCCCTTT
TGTAATCCAGGCCAAACTTTATTCATCTTAATCATGTTTTGATTGATTTTCTTTTCTCTG
TGTTTTCTATTTGTTGATCTTTTTATGTTTTATTTCTTTTTATGAACTGTTGTTTTTTTT
AAATAGTTTTTATTGCTATTTTACCTTAACCATGTTGTTTTTGCTGTTAGTTTTCACCTA
ATTACTGCTTAAGGAGTATCCCATACCGCTCCATTATCATTTTCCCCCAAATATTGCTTT
ATATCAGTGTCTTTTCTAATTGCTTTATCATTCAAAATCCCAACATTCAGTCTCCATTTG
GCTTGTTTCTTCTGATTTGATATTATTATTTACATGTAGAATATTATGGTCAGACACATC
GTCACACACCTAATTCTTCTGTGCGTGGAAAGGTTTTGTTTTTTTTATAGGGGGGAAACC
GGAGCATCCCGGAAAAATACCCTAAGAAATTGTGTGTGTTTGGGTAAAAAGAAAAAAGAA
ATAAAGCTTAAATCTGCAGAAACTTTGCAGGAGGCGTGGAGATTATGAGTAGAATGTTTT
TCAGCTTTCTTTCTTTCACTTGTGTGTCTTTGGTAACATATTTTTTTGTTGTGCAGTTCA
TGCGGGGGGGAAACCGGAGCATCCCGGAGAAAACCCCTAAAAAATTGTGTGTTTGGGGGG
GTCTGTCAACACAGCTTTATTTATACAAAAGCTCTTTTTAGATAAAGAGCTTTACAGTCA
AAAACAACAAATTACAAAAATAAAAGAAAACCAACCAACCCCTTTGACCCCCACCATNNN
NNNNNNNATCCCTGGTCTCGGGGGACTGTGTGACCCTCAGAGACGCAGGGCTAGGCAGCC
CCAGGCTAATGGACTGAGACTGTTTCAGCTGTCGTCCCGTTTGGGATTTGCATATCTAGC
CTGACATCAGATGTCCTTTCTAAAACGACCCTCTGCATTTACCCGGACTTGGGACCGGCA
CACAAAAGCACTGGATTGTGCCCTCGTGTGGCTGCATTAAGTTTTGGAAATGGCATGTTT
CCAATTGTTTTTTATAACTTGATTTGATGTATTTTATAATAATTTTGTATGATATAATTA
GAGTCAAATCATTTTTGTTACTTAATTTTTTATTAGTTTTTGTCATATGATAACAAAACA
CAACCAAAATCAAAACAGAGGTCGATTCTTGGTGCTTTGTGGGTCAATTTGTTGTAAAGT
GTCCATTGTTTTCCACTTTCGGTGTAATTGTGCCTCTTGCAGTCTCAGTCTGTATGTTAT
TGTTTCCGTTGAATAGACGTGGTTTATTGTTGATTAGGGTTGGGCGATCTCCCTTAAATT
GGCAGTTGACGATGTTTGCTGTCAACCATCGGGATGGACGATGATATCGTCGTGGGGGGG
GCTATTTTTAATTTTTTGGTCTTATATAATTGCTATTCGTTAATTTACTTTATTACTTTA
TTTATTTCATTTCCCAACTAATGACTCATCCACGATGATCCAGTATAAACTGAGGGAAGT
GACTTTAACAAAAAAAGTAACAAACAAAATAGACAAGAAGTACTCTGCTCCCGCACTTAA
CTATTCAAGTGGGCCGGTGGAGCGCGGACTTGCAGCTTTGTGTTTGAGGGGAAGGGGGGG
GGGGTGCTTTGTTACATGAGCGGTATGTGTGGGAGATTTAGGACTGTGATCTGTTCCGCA
GCTCTACGGGAACGAGCTACCGAACTCAGAACCGGGTCTAAAAGTGTGTGTCTGAGCACA
GCTCGGATCGTCAGCACACACACAGTTGTCAATTTAGTATTACTGTCTTTATCATTGTTT
GAACGATCCCAGCCTCATCCCCAGAAGAATCACTCTGTATTGTAGTCTTATAATAGTATC
TCATTTGTTAATCTCTAAATAATCCCGTGAAATTGCTTAGCCAAGTATCCAAACTCTCCA
GCTTTCAGACCTTCTTTTCTAACAAGCACCATGCTGTTATTCCTTTTGTCGTCCAATATT
TATAGGTATGATCATATTCTGCTGGTTTAATTTGCCTATCAAATGCTACCCATTTTTCAT
TTATTTCTAAATCATTTTTAATTTTAATATTTTCAAAGTCTAATGTTATTTCCACACCTT
GAAATTTCTTACCTTTTATATTCCAGTTGAATTTCAAGTTGTTTCTAATAAATTCAGAGG
GGCCATAGTTGAATTTCAAAATTTGAAAATGTTTTTTTTACATCCAGATACATTTTCAAA
TGTTTCTAATAATAGCTGATAACTTTGCTTAAAATAAATCAGCTTTTTCTTTTATTTCTT
CTTCTAACTAGTAAGTGCTTTGTTGTTGTTGCTTTTTTTTACTTGTCCTGTCCAACAGCT
GAGCAAACAGATGACAGCTGAAGGCCTCTTGTGTTGGACATATTTTACTTTAACAACAGG
GGTTAGGAATCTTCTGTCTGAATAAACCCCTTTTGTAATCCAGGCCAAACTTTATTCATC
TTAATCATGTTTTGATTGATTTTCTTTTCTCTGTGTTTTCTATTTGTTGATCTTTTTATG
TTTTATTTCTTTTTATGAACTGTTGTTTTTTTTAAATAGTTTTTATTGCTATTTTACCTT
AACCATGTTGTTTTTGCTGTTAGTTTTCACCTAATTACTGCTTAAGGAGTATCCCATACC
GCTCCATTATCATTTTCCCCCAAATATTGCTTTATATCAGTGTCTTTTCTAATTGCTTTA
TCATTCAAAATCCCAACATTCAGTCTCCATTTGGCTTGTTTCTTCTGATTTGATATTATT
ATTTACATGTAGAATATTATGGTCAGACACATCGTCACACACCTAATTCTTCTGTGCGTG
GAAAGGTTTTGTTTTTTTTATAGGGGGGAAACCGGAGCATCCCGGAAAAATACCCTAAGA
AATTGTGTGTGTTTGGGTAAAAAGAAAAAAGAAATAAAGCTTAAATCTGCAGAAACTTTG
CAGGAGGCGTGGAGATTATGAGTAGAATGTTTTTCAGCTTTCTTTCTTTCACTTGTGTGT
CTTTGGTAACATATTTTTTTGTTGTGCAGTTCATGCGGGGGGGAAACCGGAGCATCCCGG
AGAAAACCCCTAAAAAATTGTGTGTTTGGGGGGGGGTCTGTCAACACAGCTTTATTTATA
CAAAAGCTATTTTTAGATAAAGAGCTTTACAGTCAAAAACAACAAAATACAAAAATAAAA
GAAAACCAACCAACCCCTTTGACCCCCACCATACACACATGCATAGAAATGACTATAAAT
AAATAAATAAATAAATTAAATAAATAAATAGAAGAATTGAAGGGTTGGGGATCTCATACC
AGGAGCAACTCAGCCACAGATCATCGCTACGGCGCCCACCCTCAGCAGACAGACACAGAG
TCCACCTCACAGCCGTGAGGCTGCGACATTGGCCCCCAGCCGCCCCAGCAAGGGGGAGCA
CCGCAGCAACAACCCCAGACCAAACCAGCAAGCCCTGGTAGAAAAGATCCCCATATGAAA
CTTTAAACAGCTAATAAAGACGGTAAGAATAGATGCATGACATCTATTTAAAGACTTTTA
GACTGTTTTTTTTCTTTTTGCCCTTAAATTCCTCCTGTGTGTTCAGTAATGTCTATCAAT
CATAACGTTTGTGGAAAAAGGACTAAAACCTTTATCTAGAAGATCCACATAAACGTTGGA
AAAGCATGACATTGATCATGTCAAAGTCTTTTGTTCCTAATTGACCTTAGTTTCTTCAGG
TCCAACATCCACCTTTCCCACTTCTGGCTTTTTTAAGATTGGTTCGTCCTTTATGTTCTG
AACCTCCTCCAGCAGTTTTTAATTGTCCGAGGATTTTCTTTTTTCCTTTATTCCTTGCTG
TTTTCCTTCTGAACAATTCCACATAATCTACTTTGTGTTCATACTTGCTGCTGGACATCT
CTTCTTGTGGCCTCGTGGTGTCTTGCTGAGCAACATTTTCCTCATATTTAGCAGACACGT
CCATCTGATTGACAGCAGTTGTGCCTTTGCATTTTTCATAGAGGAAGATGATTCCATGTA
AGCTAATGTCAGCCAGACTGGTCTCATCTCCGACAGATATCCGACTGTCGTTTGCTTTCA
GAATGACACCATCTTTGACAACGTAGGTGTAAAAGTGATTGCTTCTGTGGCAAATGACAG
AGGACAGGTTGAATTGTTCCTTCTTGCCATTGATAGGAACATAGATGGAACTATTTGGTC
TGACTTTTTCCCTGACTGCAGACTGTCTTGGCACATACAAGGGAAATATGTCACAGTCCC
CAAAAGAGATTCCCGTTTCTACATTTGATGAGCAAAACTGACACTTTATGTTGGAGCAGA
TATTTTCAGCGTTGCTGCCAAGAAGTGAGGCGATGGAATCTGTGTTTCCTGGTTGCGGTG
GAAGGAAGAACATGTTACCCAAATCACTGAACCCACATGAGATGTTCTGGCACTTGTGAC
ATCTACTTTCCTGGTGCATGTGGAGATTTGCTTGGACTCCACAGTCTTTCAGCCAGCACA
ACAAAGGATTGATGAAGTCAGCAATGTCATTTTGTTTTCCGAATTCTAAATCTGGTATGA
CATGAGCTAACTCCAGTAAAGCTATTGCCACTTCAGATTCAGAAAAGAACGCTCCTGGGG
TTTGGACTGCATTCAGAAGCAATTGGGATGTGGCTGGGATGGCTGATATGGCAGCCATGA
CTTCTGGGTCCAGGGATTGAACAGCATCCCTCACAGTGTTTATATTGATTATAGCTTGGA
GGGTGGCGTTCAACCAACAGTTGTTGAAGTCATTAGAAAACCTGCAGAAGTCCTTTGTTA
AGTTGTGACTATTAAGTGTTGAAGATTTCACAAAGCCGTTGTTTGCAGTCTGTTTGGGTG
CTGCACTTGTCATTCCGACTTTAGTGTTCATCTTGTGTTGTTCGTCAATGTTTGTCGTAA
AGGGTGTAGATGTCATGGGCTGTTCCATGGAGGAAGGCTTAATTGGTCTTAAGAAAAACA
TTTTCTTTCTCCTTTTAAGGATTTGGGACTTCATCATGACACTACGTTTGACTAGTTTTC
TTGCTGTCCTGAGCAGAAATCTTTGCATTGCAAAACTTTTCACAAACATCTTTCAGGTAT
TTCTTTCCAGATGTCTCTGTCCAGATCCACGCTAAGATGTCTTAAAGAACAAATTTAGGT
CTATTTATACCTTTTTTCCAGATGATGTCAAATGACATGATTTGCAAAAAATACCTCAAA
TGACATCATTTAGGACCTCAAATTACATCAGTCTATATTCTAAAGGTCAACAATGCACAG
CCTTATTATTGATGACATCACCATTGATGACATCACCATTGATGACATTAGTGGTGCGGC
TGTGGGGGGGATGTCTGGCTATGTTTTTAGAAATTATTTATTTATTTGTTTATATATTTA
TTTACAAAAAGTCTTTATCTCCAGTAATCTTTAATAATAATAAAATTTTAAAGGGTTCTT
GTATGGAAGGGGGGTATTCCAGAAAGCAGGTTATGCTAGCTCCCACGGTAAGTTTGAGGC
TAAGGAAGTTGATAAGCTTAGCTTTCGGTTCCAGAAATGGAGGTATGTTTCAGGGTATGT
CAAGTTGCCATAGTATCTCATGCTCTGAACATAACCTGGTCTGGAGCAGGTTTAGTTGAA
GGTTAGTTTGTTTTCAGAGAGGTGAAGCAGCATGGCGTGTCCATTTGAAGATGATTTAGT
GGATGAAGAAGCTCAGATAATACTTTTTCCACCATGAGAGGGTGATAAGACCACGTATGG
ATGTTGGAAAAATAAACTTTTTTACTTTGATCTAACTTAATTATTTGCTTCAGTTAAGAT
AACTAAAAATCTTTTTTTTGTGTTAAGTCTGTTTAAAAATAACACGTAGTTTTCAGATAG
TTATTTTACTTTCATTCAAATTAATTCAATTAAGTAGGTGTAACTTTGGTGCTGATGTTA
GATCGGCACCGCAATGGACTGTGGGATATCATTCTTTTGCCTGTCTGGACGGATTTGGGT
TTAAGTGTGGCTTTTTGACCAAATGTGTTTAGTTGTTTAGCTGTTTTACTTGTGTTTTGT
CTAGTTATTTTGTCCTACTATGTTTAATTCTTTCTACACCATGAGTAAAAGGGAGGGAGA
GGATGATGAGTTTATCCCTTGTGCTATCTTAGATGACCCCACCCTTACTTTGACGTGTTC
TTCCTACCATGACAAAGGTGGATAAAGGTGGAAAGATTTCATGTAATCCATGGACACCAG
TGAAGATCACAAATCATTGAAGAAAAAAGGTTCAGAGCACTGTCTAGTGGGTCTAAATGA
CCCCACTCCCACATTAAAGTGCCTAGGATAGNNNNNNNNNNTTATAGCTTGGAGGGTGGC
GTTCAACCAACAGTTGTTGAAGTCATTAGAAAACCTGCAGAAGTCCTTTGTTAAGTTGTG
ACTATTAAGTGTTGAAGATTTCACAAAGCCGTTGTTTGCAGTCTGTTTGGGTGCTGCACT
TGTCATTCCGACTTTAGTGTTCATCTTGTGTTGTTCGTCAATGTTTGTCGTAAAGGGTGT
AGATGTCATGGGCTGTTCCATGGAGGACGGCTTAATTGGTCTTAAGAAAAACATTTTCTT
TCTCCTTTTAAGGATTTGGGACTTCATCATGACACTACGTTTGACTAGTTTTCTTGCTGT
CCTGAGCAGAAATCTTTGCATTGCAAAACTTTTCACAAACATCTTTCAGGTATTTCTTTC
CAGATGTCTCTGTCCAGATCCACGCTAAGATGTCTTAAAGAACAAATTTAGGTCTATTTA
TACCTTTTTTCCAGATGATGTCAAATGACATGATTTGCAAAAAATACCTCAAATGACATC
ATTTAGGACCTCAAATGACATCAGTCTATATTCTGAAAGTCAACAATGAACAGCCTCATC
ATTGATGACATCACCATTGATGACATGACCATTGGTGACATCACATTTGATGACATCACC
ATTGATGACATCAGTGGTCCGGCTGTGGGGGGATGTCTGGCTATGTTTTTAGAAATTATT
TATTTATTTGTTTATATTTTTTTTTTTACAAAAAGTCTTTATCTCCAATAATCTGTAATA
ATAAAAATATTTTAAAGGGCTCTTGTATGGAAGGGGGGGCAGTGTTTGGCAAAAAATGTT
CGATTTCATTAATGATCAAATAGATTCTTCTTTTGTTTTAGTCTGGAAAGATGTCTATTA
TCAAAGATGTCTAATGTGATAAAATATACAAGGGGACTCCGGTTTACTTTTAAATCTCTT
GCTCATTTTGGCTAAGTGTTATATTCTTAAATTCTCTGGTCGAAAACCCTGTATCATTGT
ATTCTTTTCAGAGTTAAATCAGTATATTAATGGTATTTGCAATTCTGACAAGCAAAAAGC
AATCAAAACCTATTTCTATAGCAGGGTGGATGGAATAGTCACACTCTGGGAACTCCTGCC
AGACAGAAACAGAGGGTCGTTTACCTCGCCAGGCACAAGGAGAGGAAGCCTGTTGGACGT
TTTAAGGCCACAGAGGGGAAGAACTCTTCCTGTCCTGGAAGGAAGGAGAGTATCCAAAGG
GATGATTGGTTTCTAGAAGTATTTTCCTGACTTTTAAATCAGCTTCATTTTTTCATGCTG
TTGTTTCTTCCACACAACATCCACATCCCTGGTCTTGGGGGACTGTGTGACCCTCAGAGA
CGCAGGGCTAGGCAGCCCCAGGCTAATGGACTGAGACTGTTTCAGCTGTCGTCCTGTTTG
GGATTTGCATATCTGGCCTGACATCAGATGCCCTTTCTAAAACGACCCTCTGCATTTACC
CGGACTTGGGACCGGCATACAAAAGCACTGGATTGTGCTCTCATGTGGCTGCATTAAGTT
TTGGAAATGGCATGTTTCCAATTGTTTTTTTCATTGGATTTGATGTATTTTATAATAATT
TTGTATGATATGATTAGAGTCAAATCATTTTTTTAACTTCATTTTTCAACAAAACTGACT
GCTCATGCCCCTTTATAAATCCTACTGCGAGAATCGCGCAAACTCTCGCGAGAGCTTTAT
GTCATAGCTGCGGATGGGGCGAAGCTGCAAAGCATGTCAGGGTTACACCTTGCAGTCCAC
TTCACTGATTAGATAAATAACATTAGATTTAATATCACCCAACGGCCACTAACAGTTCAG
TCTGTAGCATTCTGTTTGCCTTTTAAGAACACACTAGAGAGTTTTGCCTTGATTGATGCT
GTAAAGCTTCGTAAAGTGATTTCCCAACTTAAGAGTAAAACCTGTTCTCTGGATCCCATC
CCCACCTTTCTTTTTAAGTCTGTGTCTTCATCCTGTGAGGAGGAACTCCTGAACATCGTC
AATCGCTCTCTTCAGACTGGGATCTTTCCCACATCCTTAAAGACTGCTATAGTGAGACCC
ACTCTGAAGAAGAGTGGTTTAGATGCTTCAAATCTAGATAATTACCAACCAGTGTCAAAC
CTGCCATTTTTAAGTAAGATTTTAGAAAAACTAGTTTTTATCCAACTAAATGATTTTATT
AATAAAAATAATATTTTAGAAAAATTTCAGTCTGGTTTTAGATCAAATCACTCCACAGAG
ACAACGCTGGTCAAGGTTATAAATGATCTCAGGTCCAATTTTGATGAAAAGAAAACATCT
GTTTTAGTATTGCTGGACCTGAGTGCAGCCTTCGACACAGTTGACCACTCCATTCTTCTA
AACAGACTGCATGACATGGTTGGGATCACTGGAACTGTGTACAGCTGGTTGAATCCTACT
NNNNNNNNNNACTATTGTAATGCTCTTCTTTCTGGTGCTAAGAGAAATACTATAAACCGG
CTGCAGCTTGTTCAAAACTCAGCTGCACGCCTTTTAACCAGAACCAGAAAGAAGGAGCAC
ATTACTCCAATTTTGAAGTCTTTGCACTGGCTCCCAGTCAGCTTTAGGATCGATTTTAAG
GTTCTTTTATTAGTTTATAAAAGTTTACATGGAACTGGACCCTCATTTTTATCAGATTTA
CTTGTAGTATATGACCCTCCCCGAGCCCTCAGGTCCACAGGTGCAGGTTTGCTAGTGGTC
CCAAAGGTCAGAACTAAAACCCACGGCGAGGCTTCCTTTCAACACTGTGGGCCTCGCCTG
TGGAACAGCTTGCCTGAGGAAGTGAGGGCTTCAGCCACTGTGGAGGTTTTTAAGAAAAAA
CTTAAGGCACATCTTTTTAGTAAAGCTTTTACGTAGTTTTTACTTGTCCACATGTTTTTA
CTTGATTTTATAAAATTTTAACAGCTAATTTTATTTGTTTTTATTTTAATGGAGGGACGT
GTATGTGTTGGGTTTTTGTGTGTTTTATTAATTCATTTATTTTATTATTATTTGCATTTA
TTTTTATTGCATTCTTTTTACTTTGTTTATTATTTTAACTATTATATATATATTTTTGTC
TTATTTGTTTTTATTCTTTCTTTGGGAAGCACTTTGAGATGCTATGAAGCATGAAAAGCG
CTACATAAATAAAGTTGAATTTGAATTTGAATTTCTTGTATTTTTGTTGTTGTTTTTTTT
TACTTGTCCTGTCCAACAGCTGAGCAAACAGATGAGAGCTGAAGGCCTCTTGTGTTGGAC
ATATTTTACTTTAACAACAGGGGATAGGAATCTTCTGTCTGATTAAACCCCTTTTGTAAT
CCAGGCCAAACTTTCTATGTTGTATTTCTTTTTATGAACTGGTGTTTTTTTTAAATAGTT
TTTATTGCTATTTTACCTTAACCATGTTGTTTTTACTGTTAGTTTTACCTAATTACTGCT
TAAGGAGTATCCCATACCGCTCCATTATCATTTTCCCCCAAATATTGCTTTATATCAGTG
TCTTTTCTAATTGCTTTATGATTCAAAATCCCAACATTCAATCTCAGTTTGGCTTGTTTC
TTCTGATTTGATATATTTATTTACATGTAGAATATTATGGTCAGACACATCTGCACACTC
CTAATTCTTCTTTGCATTGAAAGGTTTTTTTTTTATAGGGGGGAAACCGGAGCATCCCGG
AGAAAACCCCTAAAAAATTGTGTGTGTTTGGGTCAGGGGGACTTATGGTAAAGCAAAAAA
AAAATAAAAAAAATAAAGCTTAAATCTGCAGAAACTTTGCAGGAGGCGTGGAGATTATGA
GTAGAATGTTTTCAGCTTTCTTTCTTTCACTTGTGTGTCTTTGGTAACATATTTTTTTTG
TTGTGCAGTTCATGCGGGGGGAAACCGGAGCATCCCGGAGAAAACCCCTAAAAAATTGTG
TGTTTGGGGGGGGTCTGTCAACACAGCTTTATTTATACAAAAGCTCTTTTTAGATAAAGA
GCTTTACAGTCAAAAACAACAAATTACAAAAATAAAAGAAAACCAACCAACCCCTTTGAC
CCCCACCATACACACATGCATAGAAATGACTATAAATAAATGAATAAATAAATAAATAAA
TAAACAAAATAAGAAATAAATAAATAAATGAATAAATGAATAAATGAATAAATGAATAAA
TGAATAAATGAATAAATGAATAAATGAATAAATAAAATAAATTAATTAATTAAATAAATA
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCAATTAATTCAATTAAGTAGGTGTAACTTTGGTGCTGATGTT
AGATCGGCACCGCAATGGACTGTGGGATATCATTCTTTTGCCTGTCTGGACGGATTTGGG
TTTAAGTGTGGCTTTTTGACCAAATGTGTTTAGTTGTTTAGCTGTTTTACTTGTGTTTTG
TCTAGTTATTTTGTCCTACTATGTTTAATTCTTTCTACACCATGAGTAAAAGGGAGGGAG
AGGATGATGAGTTTATCCCTTGTGCTATCTTAGATGACCCCACCCTTACTTTGACGTGTT
CTTCCTACCATGACAAAGGTGGATAAAGGTGGAAAGATTTCATGTAATCCATGGACACCA
GTGAAGATCACAAATCATTGAAGAAAAAAGGTTCAGAGCACTGTCTAGTGGGTCTAAATG
ACCCCACTCCCACATTAAAGTGCCTAGGATAGCACAAGGGTTAAATAGCACCCCTACAGT
CGCAGGGTATATTGACAATTGTAAAATTCCTAAATGAATGAATGCACTAAGTGCAAACTG
TTTTTTTTTTTTATTGTTAAAAAAATGAGGATCTGCCGGCTAAAACTTAAACTTATAAAA
GTTCAAAAATTTTATTTCTTTACAATGGAAAAAAAATTACCGTAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TTCCTTAGAAACCGTAAATGGAGTGTAAATTCACTCCATGCGCTGTTCTCTCCGTCACGC
AGCAAACCGGCTTTTCCAAACCCGTTGGTGACGATGGACTTTTTTACGCTGCTTTTAACG
ATTGCTTTTAACTTGAAAGCTTCATCATATTGTAGCGGCGATCACGTGCACGTTGGGTCT
AATGGCCCCAAAGGATTCTGGGATGCGGCCGGGCATGCGTGTTTCGTTTTGTTGAACCAT
GACTGAAGTGTCTAAGACCTGAAGTCAAGTCCATGCTGTTTGGCTGCTAAGAGGTGTGTT
GAATATAAAAAAGCCTTGTGCTTGGTGTTAGATAGAGAATTCAAACTATTCACTGAGTTC
GAAAATACGTACATGGCTGCCGCTAATTAAATCCATAAATTAAGCGCGTCACTGAAAAAG
CCGCAGGGCTGTAAGCGCAGGAAAAAAGTAGCGGCTTGTAGTCCGGAAATTACGGTACTT
GAATTGGAGTAATATGACATTTAGTTAAATAAATGTGTAAATTTGAGTTGTATTAACAAT
TATTGAGTTGGGTTTAAGTGTGGGTTTTTGACCAAATGTTTTTAGTTGTTTAAAGATCAG
AAACTCGTGCGTTTACTTTGTCTGTTCTTCTACTACAAGCAGAAAATCTTTCTTTTGCGG
ATGCAGCCTTGTTACTTTTTTGATGGTTGTACAATCTTCATACGCCGTCATTAAACTCCG
ACTCCGTCTCAAGTATAGCGCTGACTTTTTTCTCCACGCGTTTCCATGGTGACTCCGGAA
TTCGGCGATCCATTGAGAATGTCTTTATGTACCTGCTGTGCACGTGCGTTAACCCAGGGT
TACCAAGTGGAGCGTAATTACACTAACTCATATATGTCTTTTGGAACCGACATACCCAGA
ATAAGCAAGTTCAGGCGGATTTCAGCCAGAGTTCAGGCTTAAAGTCAGTAAAAATTAAAA
GTTTTTAGTTTGATGAATCCCAATGTTTAAGGATGTGTTCATGTAAACGAAATGAACTGA
AGGTTTTGTTCTGGAAGCTCCTGATTTAAAGAAGCCGTCAAACCTCAAACATGACATCAG
CTCGTCAGAAATGTACATAATGTAACACAAAACGGTACACAAAAACACACTCAGGGACAC
TTTGCTTCTTCCTTCCTTTCATTTTCTTCTCCTCCTGTCTCTCAGGTGACCCTCAGTAAG
TTTTTTAACCCCTGCTACACCACAGCCCAGCTCAAGCCCACCCTCTTCAGCAAGGTGAGA
CCCCCCCCCCCCCTTTTTGGTTGAAAAAATTTTTTTTTTTTAAAAAAGGGGAAAAAAAAT
TTTTTCCCCCACAAAATTTTGGANNNNNNNNNNCCCCCCAGGTACATAAAGACATTCTCA
ATGGATCGCCGGTTTCTGGAGTCACCATGGAAACGCGTGGGGAAAAAAAGAAAGCGCTAT
ACTTCAGTGAGACGGAGTCTGAGGTTTTAATGACGGCGTATGAAGATTATATGTCCATCA
AAAAGTAATACGGCTGCATCAGCAAAAGAAAGAGTTTTTGGTTGTAGTAGAAGAACAGAC
AAAGTAAACGCACGAGTGTATGATCTTGTTTCCATTTTCCTTGTGACGCATTTTATATGT
ATATATAACTTATCCAATTTTGCCAACTTAAATGAATTACTTCTATTGGTAACAAATAAT
TGAGTTAAACTTATTCAACCTAATTTTTTACATCTATAAAACCCAATAATTGTTTATACA
ACTCAAATTTATGTATTTATCTGACTAAATGTCATATTACTCCTATTTAATTAATATTTT
TTCCATCTTAATTAATTATATTTCTTGATCTCTCATATGTCTAAGTTTCAGCCGGCAGAT
ATGCTCATTTTTATGACTATAAAAAGGACGGGACAAAAATACACATTGAGTATTAATTCA
TTGAATAATTTTCCATCATAGCCATTACCACAACAACTGGTAGGGGTGCTATATAAACTC
ATCATCCTCTCCTTCACTCTCACTCATGGTGCAAAGGCTTAAGCAAAGTAGGACAAAATA
ACTTGGCAAAACACGGTAAAACACAGTAAAACAGCTAAACAACTAAACACATTTTGTCAA
AAAGCCACACTTAAACCCAAATCCGTCCAGACAGGCAAAGGAATGATATCCCACAGTCCA
TTGCGGTGCCGATCTAACAGCAGCACCAAAGTTACACCTACTTAATTGAATTAATTTGAA
TTAAAGCAAAATAACTGTCTGAAAACTATGTGTTATTTTTAAACAGACTTAACAAAAAAA
GATTTTTAGTTATCTTATCTGAAGAAAATAATTAAGTTAGATCAAAGTAAAAAAGTTTAT
TTTTCCAAGTTTTATTTTTAATCTATTTATGTTGTATTTCTTTTCATGAACTGTTTTTCA
AGTTCTTTTCATTTTATAGGTTGTTTTTTTTACAGTTTTTATTGCTATTTTACCTTAACC
ATGTTGTTTTTACTGTTAGTTTTACCTAATTACTGCTTAAGGAGTATCCCATACCGCTCC
ATTATCATATTCCTCCAAATATTGCTTTATATCAGTGTCTTTTCTAATTGCTTTATTATT
AAAAATCCCAACATTCAGTCTCCATTTCGCTTGTTTCTTCTGATTTGATATATTTATTTA
CATGTAGAATATTATGGTCAGACACATCGTCACACTCCTAATTCTTCTGTGCGTGGAAAG
GTTTTGTTTTTTTTATAGGGGGGAAACTGGAGCATCCCGGAGAAAACCCCTAAAAAAGTG
TGTGTGTTTCTCCGTGATTATCTTCCTCAGCGAGTCAGTTGATGCTATTTCTCCATTCGA
GGCTCAACCTTTGGTTAGAGCGATTCAGGAACCACTGGAAATAGCTGTTGTCTTGTTACA
AGCGTTTTGAGCTGTCTGAGCTTTTGTGATGAACCAGAGGTGTCTCATGACTGAAAAAAA
ATCAGCAAATAAACCCCAAATATTGAAACAGAAATCAGATGGGTAGCACTGTAAATTTAT
AGAAAAACCAGTGACGTGCAGTCAGGAGAGGCAGGTGAGGCTGTGCCTCACCTGTCATTA
TGGGAAGAAAAGAGAAAAAATAAATTCAATTATTATATTTAATCAGTAATTTGTGCTCTG
CAGTCATTTTCCATTTAAATTTACCATTTTTGGGGGTTTTTCTTTTCAAAATTGCTGAAT
TTCCGCATTTGCCGTTCAGATACTAAGAAGTGACGTGCGATGAGGCACCAGCCCGCTGAG
CCTCACCTTGGATTGTGCAATACCTATGCACTCAGACGGTACTGCTGTCTCTCTGTATGT
CGGTTCAATCACTTGTACTATATGAGCTGAGTTTACATAATTTAGCAGATGTATGTGATG
TACAGTGTTTGTTTTTATAAATAACTGTATGTGAGGGACGTGTTTCTTGTGCTGAGCGCT
AAACGCCGGCAAAAAAGCCACTGGGTGAGGCCAGCAGTTCTCGTGCCTCATGTTAGGGGG
CGCCTTTACTGCCTTGCTTTTTAATGGTGATGGTGCTACGTCCCACTCCAGGGGGAGGGA
GCCGGTAGCGTTTAGACTGAGAGTGCAGCCGTTCATTATATGGACAGGTGCGGAAGAAAA
GATGAGGCTTACAAAAGTGAACTGACTCAAATTCACAGGCACTACTCGGCATTTTCTAAT
GTAACCGCCTATATACAGTGTTCTGGATTGGTGCATTTACAATTGCAATTACAGGAGTGG
AACTTTAGGGGGCATGTGTTTGACCGTGCAAGAGAAACTTATAGTAAAAAGGAAAGTTTG
TGTCCGAGCTCCGTTATTGCACTCCAGTCTTTCAACACCACCTGGGTTTGGTGTCACTAC
AATACAAGAAAAGAAGACCACAACAAAAAAAGAAAACCAGGTTTTTTCCACAGGCTCCTA
AAAGCCAGGTCCGGCAGCAGGGAAAAGCTGAGAAATGGATCCCTCTCAGGGATTTCAGCT
ACCACTGGATCAGGAGCTGCTGAGGCTTTAATGCTTCCCGGCCAGGCTGGTGATTGGAGG
AAAAAGGAGGCGAGAGTCATCTCCTGCAAGAGGTAGAGTCTGGACACACACACACACGCA
CGTATGAACACACAAATACAGACAATATATACAGGACATCAGGAAGAAGGAACATGAGAA
ACTGGAGAAATATCAGGGACTCAGAGAAGAACTGGAGAAAGCCTGGAAAGTGAAGGTGAC
AGTGGTGCCTGTGGTAATTGGAGCACTCGGGGCAGTTACCCCCAAGCTGGAGGAGTGGCT
ACAACAGATACCTGGAAAGACCTCAGACCTCTCAGTCCAGAAAAGCACAGTGCTAGCAAC
AGCTAAGATACTGCGCAGAACCCTCAAGCTCCCAGGCCTGAACATTTTAATCAATTTTAT
CCTCAAACTCTCTGTATTTTGTGTATTCTGCACATTTTTCTATGATTTTCTTAATCCTCA
CTGCAAATGACAGTAGCATAATTTTCACTAACCGTATATGGTATATGCTATTAATTAAAC
CTAAAGATAAAAGTATTTTTTTCCAAACTAAAAACCTTCAAAGTCACTGTTCCACCTTAT
TACTACGCACAACAGTTCCACAACATTTGATCGGTTCTAAAGAACTGAAAATGGACGTCT
GTTTAATTTGCTGCATTAGGAGGTCTTATTTACTTACATCAAAAGCTATTCCAATTAGAA
ATATCTTGATAGTTCAAGTTACATTTGAGCATTGGGCCCCTTGTTTTGTAGCAGCTTCAC
ATTTCTTGCATCCATTGAGTTTGTGCTTGAATCTCATTGGAGTGGCTCTTCATTTGTTCA
TGGGGCTCTGACGTGGCCTCGCCAGCAGATGGCGCCCTTTCACCGCACTACTGCTGCTTA
AACCCTGCACTAAGCTCTGCGGGTTCCTCGCTGGTTGTTTCTGCTCACTGGACGTCGCGT
TTCGGCTGAACTGCATCCAACATACGAACTGTCCGCGCATGCACATGACGTCAGGAGACC
CACCCTCAGATCCGGATCAGCAGAGCTGCAGCCGGACCGTCGGATGGATGCAGGGAGAGA
CGGGACACTTTGGAAACTTTGCACCAGAGCTTCAGAAAGCAACAGGTATATAAAAAAAGG
TTTCATGAACTCTTTTGGTTACTCATGTATTGGTTTAATTCAATTTCTTGTTTTCTATTC
ATCAACTCGTTCTAATCAGCACAGTTTGTAATAATCTCTTGTGATTACTGAAGTAAAGGT
GAGTTGGATGTATATTCAGGTCATTTTGCTGGATTCATCTCAGCCTTGAGGTGAATTTTA
ATGTTTGTCTAGTTGTCAATGTGAATCAACCTCTGGCATAGAAAAGTGTCTAAAACCGTT
TTGGAGTCACATCCTGTGCTCTTCTGATTCTGTCTGTGATGAAAGGATGCAGAAAGTGGT
ATTTCAGAGATGCTCCAGACAGATCATTCCCACGTTCCGGGTTTAAACCTTCAGTTTGGA
TGACAGCTTCACTCCCAGAGCTTTTAAAGGTCAGCTGCAGTCTAGCATTGAAGTGTTTTT
ACACTCCAAGGCTCAGCTAGTTTATTCTGCTTGATATAAATCTGCAGGATCTTTACATAA
GGCAGATCCACTGCTCCAACCTTTACACCTTTCCTGTTATCTGACTGAGATGGGAGTTTG
ACTCCTCAGGAATGAAGTTATCTAAACGGCTGAATGTGTGTACTTACAAAAGCTGTCCTG
ACTGAACTTCTAGTCATTTAAGACCAGTGATTACTGTCTAGATGAGTCTGGAAGCCAAAT
TTCTCCCCTTTCTTTACATAACGTAGGTTTGAAATCACCTGTGTTGAGAGCTGAGAGACC
AAATGCTTTTCACAGAGACACACTGCATGCAAATCAATACAGTTACAGGGAACAGAAGGC
TGCAGGCTTTAAATAAACACAGAGCGTATCTGTGAAGACAAACACTGCAGAGCTTTAAAT
GCACTCAGAAACTGTGAATTTATGATCAAACTTTGAAGGTGCTTAAAATGTGGGAATTCA
ACCATCTGATCCTAAAGCAGGAGGAAGTGACTGCAGCCTAAGGACGAGTTAGAGAAAGAA
GGTCCAGACATTTGCAGATTAAAACGTATGTATTTAGATCTAAACTAAACTAAGAAATAA
AGGAAAAGCACAAAGAAGATAGTAACAGCAGTTGTTAACCTTTCATTAAAAATGAACGGC
AATAGATAAAAAAACCAAGCACACCACTGCTGCATCTGCTGGAAACCAACATTTCAGATT
ATTGCTTGTTTAGTGTCACTGATTTAATGTTACAACGCAAACTCTTTTCTACCAGATTTG
GCCTAAATTGATCACATTTATATCACCCTACCATATGTGTGGTTGATTTCTGTGTCCGCT
TACATACTTTATTTTATTCGTATTAATGTAAAACATTCCAACTACCCAGCCAGCATGGCC
AAGTGGGCCCCATAGAGTTTAAAGGTGGGCAGCAAAAGTGGGCCCCAAATGGGTTTGTCC
GTAGTTTCCGTGATGGCCCCACCTGTTTTTGCCCCCATTGGCCTCAGAGGGCATTCATTC
ATTCTAGGCAGGCCAGCTGCCTGGTGGCAGAGCAGATGAGCGGCGCCAGCCGAAGTTTGG
CAGAGCCCACCACGTCCACTGTTCTGGTAAAAGTCTTTTGCTTTTACAAGACGAGAAACA
ATTGGATTTTTTTTGGTTTTCACAAATATTTTTTTAATTTGGCCTTTTTTCTGCACACAG
AATTATTACAGTTTTTAATTTTTTTCCCCATTATGCTACTTTGGTGCTTTTGCTTTTAAT
TTAAAAACACAAACAAGATAGTTTTTTGCTGTGACACGGTTTCACAGTAAGAGCCCGACG
TTAGTCAGATCCCAAAAAGGGCTCATGAGTAGGAAAACGAGTGGGTGTGGGCTTAACCTG
TGACAAAATAAACAACAGAATGCAGGCGTGTGACTGTTGTGTTTTTGTTGGAAACAGAAT
CCAAAAGAAGCTAAAAAATGAAAAATGGAGCAAATGATTTTCCGTCAGCTGTGATTTGTT
TGAAGATTCAAATGGAATTTGATAAAAGCGGCATCACCTGATTAACTTTATACTTTATAA
ACCTGCTGGGCTTCATTCAAAGATAAATGTAAGACAATGCACTAAAGAGTTATTGTTTTT
ACTAAAGGATGTAACTGCTTGTTTAATGGTTGCATCTCTTTAGTTTACTTTTTTTTGGGG
GGGGGGGCTTTAAATCTTTCCCCTCAGACTGTGTCGTGTCTGTCTGATTGGGCTTGGAGT
CACTCTTGTTTTTATCTTTGCAGTTTTTAGAGAAGTCAAACGTTATCCCCACCAGTCGTC
TGCATATTCGAGTCTTTTGCCACAGCTTTACCTGTTTGCCATGTTTACCGGCTGTCCAGC
TGCAGCTGTAAATACCATAATTTACCAGAGATTGCAGCTAAAAAGAGATTTTAGATAAAG
ATATTTAGATAAAGACCATTGCAAATAGCTTTGACTATTGGATCTTTTCCTTTTATAAAA
CAAGACTTTAAAGTTTAGTTTAAAAAAAAGACGTCAGGCTTTTATGCATGTTTTAACTCA
ATATGTCTGTAAAATTCACAAAGTTAAGAACACATGTTAAGACAAAACCAAATGAAGCTA
AGACTAAAAACCAAAGCTAAGACTTACCTGTGCAAGTTAGTGCTTAATGGGTCTGTACCA
TTCTATTCTTACGCCTTTTAGAGTAAACTATATCCATATATATTATCATATATTACCTGT
GGCCCACTAAGAAACCTTTTTTTAATAACTTAGTTATTTTTACAGTTCATTTTTCCACCC
AGAAGTAAGACGACTCGATCTCTGAGGCTCCGCCTTTTGCTCCTTGTGGGTACCGCCCAT
TTCATGACGTCATCCTGGAGTCGGCCTCTGCAGCGTGTCTGAGTTTTTCCCACTAAAACA
AACAATGTCCTAACTTTTGCAAAGATGGATGTGCGTGTATTGTGAGTATAAAATGAAAGT
GTTTAGCCGATCAGCGCTAGCTCCACTGAGGAAGTAGGCGTGTCTGTTAGCCTGGGGGCG
GGCCTGGCAGCACAGACTCTTCCTGGAAGGGGCTGTTCCACACTTTGTGATGTCACAATG
TGAGGACCTCCTGGTTTTGGTGGATCACTCAGAGAGCAGGTTTTTAGAGGAATACTCAGA
GAGGCAGGAATGAGTTGTTAGGGATGTTTTTTGTGAGGAATTAACATTATAATACACTTA
AAAGCTCAAAAAAGAAGATTTTACATGATATAGGACTGTTGAGCTCTCAGAAGTGACACA
ACAATCTATTTTATTGTTCGTTTTGTTGGAGCTGCTGCTTTCTCCATGAGGTTTCATTCT
TCACTGAACACACGTGGGAGATTTAAGATCACGTCTAGAAGCAGCAGGTTCAATGTTCCC
CTCCAGTGACTCACTTCCTGTCTTTGTCCAGAAGTCGGCCTCTGCTGCCTGTCCGCATCC
AATCTGAAAATCTGCCCTTTTTGTATTTACAGCTCAGCTGTGTGAGATGCAGGGCAGCAC
GTTGAGAAGATTAGAGGTCAGTCTGCAGCAATCAGGGCTCATTGAGGGTCCAGACGGTCA
TATTTGAACGGACACGGAAAAAGCTGGTGAGTGTTGGAGTTCGCTGGTCTGAATCTATAG
TTTGAAAAATACAATCCTAAATAATTGTCTTGAAAAACCTGATAATTGTGTTGTAAAACT
GTCTTTGCAGAACAGAGTAAACAGGTCTCTGTAATGTTTGCAGTGAGCGTTCAGGATAAA
GCACCAGCGTGGGACATTGGGGTTTCAGCTGAACTGATGATCATAGGCAAACGTGAATCT
AAAAGCCACTTTGCTTTATACCAACATTTCAGTGATTTGTGAGTCAAAGGAATGAAATAT
AGCTGTTCAAAAAATGAAACTCAAAAATCTCTCAGACAGTTTCAGTCCTGGAAAGCTGTT
TTGTGAACGGGGGACGTTTTTTTCAAATATGTCACTTTCCTCTGGCTGCACAGGTGTGCA
CAGACACACACACACACACACACACACGCAGGATTGTGGACAGGTTAGGAACCTGTGGTT
TCAGGTATCATCTCACACAGCTGTGTTTGAGCTTCATCTTAGTACATTTGTTGTGTGATT
TAATATTAGAGCGCTACTTTACATTTTGACTATGAATACTTTTAATTTGTTGTTTAGTGA
AGACGTATTTGAGTAAAGACGAAGCGTCTTAAAATCTTGAACTACATCCACCAACACGAC
ATCTAATGACATTTTTTTTTGTTTAGGTTGACTGAGTCATCATTTCTGCCTGACCTTCGA
TTAGTGGCTGACTGTGAGAGAACCTTTCTCTCTAGATTTTTTTCTGCTGTTTGTTTTTCT
CCGTCTTGGCGATGAACAACCATCACAGTAGACTCACGGCAGCATCTGTTTCCTCTCCCA
CAGTTGAACACCGGACTCTTGCTCCCCAGTGATCCGTGTTGCCATGCCAACTTCTACAGT
TCTCGCGGCAACCAGGAGTCCTCAGAGGAGCCGAGGACTTTAGAGGCATATTTACATCCT
TGTTTGTGTACAAAGGAGACCAGTGGAGAAATTAGGTGAGGAAGAGGAGGCAAGGCTATT
TTCCTGGTGAGATGGGGTCACTCGTTTTAAACATCTATTTGTGTTTCAGACATGCCCTTC
CATTGGAGCCTGCTGTTGCTTTCTGTATGGGTGGGGCACATGGATCTCGCTGATGGATGT
GTTTGTCCAGAAGCCACCGTTCTCCCCCAGGTTCCCTCTGAACTTGCTGCTGGGGGTTGC
TGCCTGAACTATTCTGGCTCGGCTTTCACCCACGTGCTTTGGTCTGTGTTCAACAACGAC
ACAAACATAGAGATTCTGGATCTTTCCAACTGTAACATCAGCTTCATTCACAGTCATGGC
AAGGTGTCTTCTTCACTGCAGAAGGTTTACCTGGATCACAATAGACTAACTGTGTTGCCA
AGGAACTTTCTTGCCAGCCAGCCTAACCTGACTGAGGTGGATCTGAGTAAGAACCTTCTT
CAGCAGCTTCCTGAGGGCTTTCTGCAGGAGTCTAACAGCCTCCAGAGGCTATACCTGCAT
GGAAACCAGCTACACTCCCTCCCTGAAGATGTGCTTCAATTACCCCATCTCCAGCGGCTA
GAGTTGGATGGGAACCAGTGGGACTGCTCTTGTCTGTTACTAGAAGCTCTGAATGTTGGA
GGGCAGACTAATAGGACCTCAGCTTTTCAAGATCTTGTGGGAAACCTGACCTGTTTCTCT
CCTCGCCACGTCGCTGGGAAGATGGTTTGGTCTCTGAGACAACATGACATGTGTCGTCCA
GCCAGCCTCACAGCTCTCTTCATCGTGCTGCCACTCATTATTCTCTCCGCATTGCTGCTC
TGCTGGTGTTGTGGGAGGAAGAGGAAAAAGAAGAAGGAGGCTCCCGTGTTTGGCTCCTCA
AAAAAGAGGGCTCTTGGCTCCAGCAGCCACATCCAGAAACATCTCAGCAAGCAGCAGCCT
TCAGCCCACGAGCACTGGAAAGATGGAGACGGCAGCAAGCAGGGGATCCTGAAGAACCAT
CAACCCCCAGACCAGACCCCCACGCTTCTGGACAGCAGTAAGGACATCTATGAAGAAGTG
GAGATCAAGGTGGGCTCTGTAGAGTCTCTACCACACGTCTCTTCACTTTGCTCCAGTTTC
ACAGAAGGAAAGCAGGGCTCTCAGGGACCCGACGGGGCCGCCAAGACCCAGCTGGAGCTG
GACACGGTCAGCGTGACAGAGGTGCTGAAAGACTCAGCCGACAGGGAGAAAGCTTACATG
ACTCAGTCCACTGAGTACTACAGCCTGGTGCCAGGGATCGAACTGGAGGACTCGGACCAT
GCTGAGTACGAGAATGTTGTTCCCTCCTGATACAGTCTTCAAGAGAAAGTCCATCTTTGA
CAGATTCAATGCTTTAGAGTCACAAGGCGCTCAAAGAGTCCAAAGGAACCAAAGAACATA
AGATATAAACTACAAAATTTCCAACATTGTTTGACATGAATAGGAACTGAGTTTAATGCA
ACAAATGACACAAAAACAGCGATTCCTACTGTAAAATGGATCAGAAGAGAACTTCGGTCA
CTCTTTCTATTATTTAAGATGATGAAAAATCAAATCTGTAATTCTTAAAGGTCTGTTTAG
AGGAATCCTTCTACTTTTGTTACATTTAATGTTTTTTTCTTTCCCAAAGAGGAAATTACG
CAAGTGCTTTATTCTGAAAGGTCACCTCCAGTACAACTCAGACTTATATGAAGCTAAAGA
CAATGTTTTTGTGTATTTTTTATGAAATCCCTGTCAAAAAAAGAAAATTATAGCCCCCAA
AATCCAAAAACAAAGCTGCTTGAATCCATGTTACTCATCTTATCCTCTTTAGACCTGGCG
TCCACATACATGGACATCACTTTTTGGTTATATTAACACAGTAGTTAATTCTGCTGAACT
GGGACCCTGGGAACATGAACAAAAAACAGGTAATCAAGCAAGAGCTTTTGGGGTTTTAAG
AGGTTATAAGTACTGAATTTCTCTGGAATCGTGAAAGCTCAGAGTAAAACATATATTTCC
AAAAAACAAGATGATCTAGATTTCCCATCTGTAAAAAGATTCCATTTTGCCTTAATGAGT
GAAGCTTAAACACTGGAAGTTTCTGATCGGTGTCCACAACCAAGAGGCTTAAGATGTGAA
CATTTTTAAATCTCAGGGAAAGCCTCAATATCTGTGTCTTTAATCAGTAAACATAAACGA
TTCATCTGATATTCAAACAAAATCCAGCACTTTGGTGATTCATCACTATCAACACTGTCA
CCAAGCCACCAACAAAATCTGATTTCACCTTTTTTTGAAGAAGAAATGCTGAAACATTTC
AAAGGCATTAGTCTCAGCTTCATTAGTGTGTCGCTTTGCAGGAGAAAAACCGAACTCGAA
CCAGAAATGTAGTTACTTTGTAGGACAAACTCTGTGAAAGCCGTTTTTCATTTTAGTGAC
AAGTGTTTCAAACCTGCATCATATCACGAATAAAACTTCTAGACTGCAAACCAAAACAGG
CAACCGGGTATTTCTGAGTCGCAAGTTTTACTCAGAATCTTTTTCAAAAATAAACGTTTC
AGTTATCAAATGTATTTTTAGGGAGATTTTAGGAGGAATGAGTCAAAGTTCTGCAGAATT
ACAAACCCATAAAATCCTAACCTCAAAATAAAACAAGAATACATTTGAAGCAGAAAGAAT
ATCAACATATGGGTCAGTTTCCCTCTTTGTGCCCTTTACTGACACCATGGATATTGTAGC
TAGAAGAGTATCTTTAGAAAGCTTCAACTGTCATTACTGCATCTCCTCTCATGGTGACGC
TAAACATGTTTGAGAAAAACCTGAGCTGAAGGGAACCAAACATAAAGAGAGACAGCACAG
AAGCACAATGGCAGATGCTTCAAATGAAAGTTACCTGTATGAAATACAGATGTGCTGAAG
CTCGGAGTCTGTTTGTCCTTGAGGTTTGATTTCTGAAAAACACAGAGGATGTTGTGGTAA
AATCATGAATCCGAAAATGAAATCACAGCCCAACCTTTTTCTTCCTTCCCCTCATTCGTT
CATCCTCAACCACATGTGCTGTTAGCCTCGTCAGGCTGACCAATCAACTGACCAATCAGA
GCATCCCTGTTTTGATTGATTGTTCTGATTAAAACTGTAAAGGAGTCTTCCTCATTGAGT
TCTGAAGGACACTGTCAAACAGGATGAATTAGCCTAAACTGAAAGTAATTTCTGTTGATG
TACAGTTCTGTCCTCTAATAATATCGATTTTCTTTCAAATGAAACTCATTTTGCCTATAA
CTTGTATGCATGGGCCACACTTGTGGTGATCTCATTTTAAACTTGATGATTCTTCTTTTT
CCTGTTTTCATGTTAAATAATGTAAATCTCCACCCATTCTCTCTCAGATAAGAGCGCTTT
TTAAGTCTGTTTTGGGATTTAAAAAGGGGCGCTGTTCCTAAATGTCATGACAGACAGTTT
GTAATTGTGTTACAGCAGAAGCACAGTCTAGTCTGACCCCTGGATCACAATGTAGAGGGA
AGTGATTTAATCCAGGCCTTTTCCTGTGGGACCAAAGGAACGCAGGAGAAAGAGAGAGGC
AGGAAAAAGCTTCGGACAGATACACTAGCAGTGATTCTGTTTAGAAATCACACAAATGAG
GATGACAAGATGTTTTTAATACACCAAAACAGGACATTTTGAACTGATTGGAATCCTAAA
TTGATATAAATAAACACGACTTCCTGTTTTCAAAGTTGCAGATAGAAAGTTTTTAGAATA
ACCGGCAAACCAGAATTGTCGCTACTTTACCACAACTGGTTAATGGGATGTGTTTACATT
ACAGTATTAACCCTTGTGCTATCCTAGGCACTTTAACATTGGGAGTTGGGTCATCTAGAC
CCACTAGACAGTGCTCTGAACCTTTTTTTCTTCAATGATTTGTGATCTTCACTGGTGTCC
ATGGTTTACATGAAATCTTTCCACCTTTATCCACCTTTGTCATGGTAGGGAGAACACGTC
AATGNNNNNNNNNNATCTAAGATAGCACAAGGGTTAAAGGGAATATTAGTGTCTCTGGGT
AATGTTGTTTTATGTGTTAGGAGTTTTTGATATATATATAAAATAATTTAAACTTTGTTG
AGCTGCCTGCATAGACTGAAGGAAAAAGCTGGCACACGCCTCACCGTTCAGCAGACTCTA
CGTCAAGGTCATGTGTTTGAGAACGACACAACTGATTTTTATCTGGACTCTTTTATATAA
ACATCTGACACTTTCAAAAATGACCTATTTCAGTGGAACACAGACGCTGTGTTTGCTGTG
ACTGAGGAGAAAGAAAAAGAACAATTCGAGACGTTTGGATGGATTTTTACTTTTTATTTC
AACTGTTATTTTTGAAGCTTCGTCACTTTCGGAGAACACAAATAAGTCATTTATTTTTTT
TGTTTTATGCTGTTTAAAAAATGCTTAAAACCGAAAAAAGGGACATTTCTTATGAAACTG
GAATCTGATTTTAATAAATTCTCGATGACAGATTTGTCAGAATATATTAAGTCCTTAAGG
TCAGTCTGACAGTTTTTTTTCTCCTATTATACAAGAAGACTAAGAAACACTTTATGCTAT
ACTGAAAACAACTGTTGACAAACCCACAAGACATCAATGTCTGCATCTGATAATCCATAT
AAAGGAGATTAAATTGTGTAAGTATTTCTTATAAGTCATAGTTCAAACTGTTCTTTTCTG
TGTTCAATTTTTTTTCAAATGCAGTCTGTTAATATTTGCATAATGTCAATATTTTGGTAT
GTTTGCTGAGTCTGAAGCTTTGTCTTATGTGCTCCTTTTTCTGTTGTTGCTTTACTTGAG
GTTAAATGACTTTGTTGTATTCCAGAGAAGTGTTTAAAATACAATTTTATGCAGTTTTTC
AATCTTTAAACAAACTTCCCAAACCCCCAAACAAGTTGGAGGTTAAATTAGATTATCTGC
TAGTGTGTTGAAAACAAATATAAGCACGGCTAAACCAGATTCATGCTCAGCAGAAAGAAA
ATGTTGTTTATTGTGAAAGAATGTTCATTTTGTTGCTAAAAACCCCCGAAAGAGTTTATG
TTGATTAATGAAGCCATAAAGAGTTGATAATAAATTAAGGTCTGAACGTTGAAGCAGTTT
GTTTTCATGGAAAATGAGCTCCACATCCTGTTATTTGACTTCCTGTCTCACTCGGCCTGT
TACCTGAAATCTTTTCCCCTCCTTCACATATTTTTCCAACTTCAGCTCCACTTTCACTCG
CCGTGGGAAGATGTAATTGCAGCATTGGCCTTCTGAAATGCCCAACATGGAGCTGCTCAC
CGCGTCTGTCTCAGAAGTCCTCGCTCTAGCGTGGCGGAAGTTTTATGAAAGTAAAAGTCT
GAAACTTTGGTGAAAGAATCTACGATGGTTTCAAAATGGATATGGATCTGAAAGGCAAGC
AGCTGGTAAAATCCACTGTGAATCTAAAAAAGATGTGCCCATATTTCATCACAGACAAAA
GATGAGGTAAAAACATTTTTACATATCAATTATTAAACCTAATAAGAGAGTTTGACTCAA
ATACAACATTCTTATGGGTGTTTTTTTGTCAATTTAAAAGCTTTAACCCTTGTGCTATCT
TAGATGACCCCCCCCCTTACATTGACGTGTTCTCCCTATCATGACAAAGGTGGATAAAGG
TTGAAAGATTTCAGGTAATCCATGGACACCAGTGAAGATCACAAATCATTGAAGAAAAAA
GGTTCAGAGCACTGTCTAGTGGGTCTAGATGACCCAACTCCCAATGTTAAAGTGCCTAGG
ACAGCACAAGGGTTAAAAGCTTTAAGGTAATTTTGTTTATGAGACAAATCCAGGTTTGGA
GGTTGACTCTGATTTCTACGCGTTGCAACAACTCCATCTACTGACTACAAATGGAAACGT
GCAGAAGAATTTGTTTTTATTGAGAATAATTTATCAAGAATAACAACCCAAAGAACCTTT
TGAAAGTTTGGAGTTGTGAAACTCGACGGACCTGAGGCTTTGTCCAGAGGGCAGCAGGAC
AAACAGGAGATGTTCTGGATGGAGCAGCAGGATTTGCTGTTGTCCTACCAGGAAGCCAGA
GGGGAATCAGTGATTTTTATCTTTTTGGGAGAAATCTTCACAACACTGCCCCCCGCCTTG
CTGCCCTCAGCTGTGGAGGAGATCACATCAGCTTTAGACAGTTAGAGCATGCTCTCCACG
GTGGAGCAGTAGAAGGCCAGACGCAGCTTATTTTATGATTTATTCCTCTTCTAAAATAAA
GCTCCTTTGCTGGGTCTTGGTGTTAGCAGAGAAACATTCTTGTGGTGTTTCCTGTTTCCA
CCTCTACTCCATTTAAGAAGAGTGGGTGTGGTTTTCTGAAGTTCGTGATGATGATTTTGG
TTATTTTCTAAGCGACAGACTGGAAGTTTCTCCAACTCTGATGGCGTCCTCTGCATACTT
AACATTCTAGTTACATAAAGGTGTTCAATCTCTGTCCTGCATGATTTCTATGCTGCTCTG
CTCAAACATATCTGATTTAGCTCTTCATCAACCTTTGTAGAGACATGCAAGACAGAAAGC
CCTCAACACCAGATAGGAGAAACTCTGAGAGTAAGAGACTCATCACACAGGCTTGAGAAG
ATGCTGGGTAACTCCTCTAAGCTATCCAAATATTTCAAAGTATGGATGGTTTTACCTCAG
ATTAATTTGGATTAAATTCATTCATTCATTTTTTCATTCATCTTCTTGACCGTTTATTCC
CTTTCGGGGTCACGGGGTTGCTGGAGCCTATCCCGGCCACTTGGGCGAAGGCAAGGGATG
CCCTGGACAGGTCGCCAGTCTGTCGCAGGGTAGAATATCGTCAATCACACATCCATTCAC
TCTCACACTCACACCTATGGACAATTTAGAGTTGCCAATCAACCTATGAAGCATGTTTTT
GGACGGTGGGAGGAAGCCGGAGATCCCGGAGAAAACCCACGCATGTACGGGGGGAACATG
CAAACTCCACACAGAAAGGTCCCCCATCGATGTTGTGTTTTTCATGTCCCCCAGCTGGGA
CTTGAACCGGGGGCCTTCTTCCTTTGAGGCAAGAGCGCTAACCACTGCTCCACCGTGCAG
CCCGGATTAAAGTCAGAATCACCAATTTAATTTTATAAAAATGTCAAGTGATTAAAATAT
AAAAAGGTAGAGCTACTGCTAACTTTAAAAGTTAGTTATTTTTCAAATGGCGCAAATCAT
TGGTTTAGAAAAATATTCTCATGATTTAAACCTTGAAGAGAGTTTGGGTTCATGTTTACT
TTGCCAGCATTAGACGGAGATCTGAAATAGGGAGGAACTTGTCAGCAAGTCTGTGAATGC
CTGGATCTCTCTCCACAGGAGAAAAAACAAATCTAGGAATAATAATGTTTGAATAAGAAA
CTCCTTTGAACTGGATGCAGTTTTTGTCAGTCAAGTTAAAAAAAAATCATCCTGGAAAAC
CCATTGTCTGATTTTCAAATAAAGGTGCAGAAAATAAATATTTATCTCTTATGGACAAGC
AAGAATTGTCTTCCTCACAGACCTATTACTTCCTGTGTTAACGTCACCTGTTTGTACTGG
TTATCTGGCCACACCCTTAAAAAGTCATACTGCAACCTCTCCACCAAAGAGCTATCAAAG
CACACCAGGGATAAGACTGCAGACCTGAACAAGACTGGGATGAACCAAACTATGATAAAC
AAGCAGCTTGATGTGAAAAACCCGTCTGTTGGACCAATTGTTAGGAAATGGAAGAAACTG
AGCATCTGGTCCACCTGGAGCTTCATGAAAAATCTCACCTGATTATCTGAAGAATGGTGA
GGAAACAGACCAGAACTACACGTGAAACTGGTCAATGACCTGAGGAGAACATAGTACCAA
AGGTTACCATGGTGACACATGATGTCACTAATTTGGTATAATTGTCACTGATTTGGAGGG
GAAGAATACTGAGTTGCATGCCAAGAACACCATACCAACCATAAAGCATGGGGGTGGAAA
CATCATGTTTGAGGCTGTTTTTCTACAAATGATCTATATTAAATGTAGGATTAATGGGCC
ATGTTTGGCTAGATTTTGGACAAAAACCTTTTTCCACCAGCCAGAGAATTGAGGATGAAA
CAGCATGACTATTATCCCAAACACACTGCCCGAGTAACCAAAAAGCATGTCAAGGTTCTG
GAGGGTTCTCGCCAGTCTCTGGACTTCAATCCCACAGGGAATCTGTGGAGGGAGTTGAAA
ATCTGTGTGGCCCAGCAACAGCCTAAATACATCACAGCTCTTGAGAAGATCTGTGTGGAA
GACTGGACCTAAAGAACAGCTTAAGACCTGCAGGAAAAATCTGACCTCTGACATTACCAA
CCCCTGTTACACCAAAGTATCTAGGTGACATTTTGTTATTGAACAAATACTTATTTTCTG
CACCAGTGCCAGCAATTATCATCATATTAACCCCTTCCTGCCACACAAACAGCACATAGA
GAGCAAGAAAGTTGTCTGTAGCTTCCCTCGCAACTCCTGAGTACTGAACTGGAGCAGGAC
TCAGCTGCAGAAGTGGAGACATGCAGCGTCAGCGTACTAAGGATGACAAAGAAGAAGACA
TTTCAAGAACTGTGGCTGGGATTCAGAACCCCCCCAATGATTATAGTAAAATCCCTGGCA
TGAATACAAATCTGTTTCTGATAAACTGAATAAATCTAGCAGAAAAATGCAAACAGATGG
AGCCAACAAGAGCAGAGACGTCCACTGGTCTGAGCCCTGAGAGAGAATGCATAAATGTCT
GTTCAGTGCAGAGCAAACAGTCGGTGGAGAAAACCCTGGTGCAGTGTTGAGGTCTGATTT
ACAGTACGGTGCTGTAACCGTGTGAAAAACAAATACAAGAGCTGCGCTCAGATGCCAGCA
ATAAACAACAGAGACAGACTGCAGGAACGCAGCTGACAGGTTTGATGTCTGGACCCGTCT
TATCACAGTCAGCTGTAAATAACACCAGAGGCTGAAGCATTCTGAGTGATTGGATTTTGT
GTGCTGAGGCATTTAGTTCTCACTGATAACAGGTTCAATGTCCTCCCCTGATTTAGTCAA
GTCTCTTAAACACATCAACAGAAATTTGTGTATTTGTCCTGCAGAATCCATGCAGGACTG
ACCTGTGAAGAGAAATGACCCCACAGTGCGTCAAGGCGGCTTTTAAAACATCAACTGGTC
AAATGTCGACCAGAGGAGGCAAGCAAAATACTTACAAATACATCAAACAAAAATACTAAT
ACTTGACAGACAGATTTTTAGCTTTACATTTTTTAGTTACAAATGGAAACTATTTGTATC
ATATCATATCTGCAGACATTACAGCACAGAAAACTTCAAAAACTCTGTAAAAATCAGATG
AAAGGCAGAAGAAGAAACCACCAATTTACAGAATACAGACCTTTTCATACCTGTAAAGCT
GATTTTGACCAATTGAGAATAATAATTAAAAAACTAGTTATTAAAGATGATTAAAGCAAT
AGTCTTTCTAAAAAAGGCTATCCACTTTGATTCCTGATATGTGATTTATATCAGTGATTC
CTGATGATTATTTGTCATGAAATTTGTGGCGATAATTTCTAGGAGTTAATAATCAGATAT
TGAGTATTTGTGTAAAGAAAATAAAAAGTTAAGTAAAGCGTAACAGGGGTGGGATTATCT
AATTTCCCCTTTTCCTTCTCCATTTCAAGCAATTAATTAAACTCCTTTTAACAATCTTAA
TATTTAATAGTTTCATTTTGTTCGTGTTCTGTTTGCATAAGGGCTAATATTTCTATTTAA
TTTTCAGCAAAACAATTGAATTGTGTTGATGTGTATGTATATTCCAATCATTTCATGACT
AGCTATCAAAAGTTTGAAATGTCTCCGTCTAAATATATATTTCTGTTGTTTGTTTTTTTT
AGCTTTATTTTGTTTTAATTGTTTGAAATAAACTAAGTCCAAACATTTGTGTGGGTTCAA
CTGCCCCTTTGGAATCTCAGTTGTACTGAATGATTTCCATGATTTGTTGTTAAATTAGCA
GCATTAAAAACACTTAATTAGCGTGTTTTTTTAAAATAATTTTCTCTATATTTCTCTTTA
AATGTTCCGACGTTAATGTTTTTATTAACAGTGAAGTGAATGGATCTGGCTATAATGTAC
ACAGTTTTCTTTTTTCCTGAGAAACAGTCAACGTTGTTGCTCCTGTAGTCCCATCAGTGC
TGGTGAAATAGTACCTGTTCAGTTCCCATGTAATAAATCCAGGAGGTTATTTTATGACGG
CACATCAGAAGGTTTAAAATGAGCTCTAGAGGAAGACTCCTTCTTCCACGGGGATCTGAC
AGACCACCACTGTGTGTTTGAACACCTTCACTTAACCTTTTGAAGAGTTTTTTTTTTACA
TATTTAGTGGGAAATCCCTGCACAAAAATGACAATTTCCTATTCTCTGGAAGTGGCCAAT
GTGAGGTTTTACGGATTCTCCAGGCTCCTCTTCAGGTGGAAAGGAAGCATTTACCGGCTG
CTGTACAAGGAGTTCCTGGTGTTTTGTGGAGTTTATGTCTTTTTCAGTATCTTTTACAGG
TCAGTCCTATGGTTTCTAGCACATCCCATGCATAGAAAATTCAATGTGTCTCTCCGTTTC
ATAGGTTCCTGCTCACACCAAAGCAGCAGGATCTGTTTGAGCGTGTCGCCCTTTACTGTG
ATCAGTTCACAAACTCCAACTTCATCCCTGTTCTGTTTGTTCTCGGTAAGACAGAAGACG
ACTGCTACGCTCACAGATGAGCACCAATCAGTCAGAGCGTTTTTCATTCATCTTTGCAGG
TTTCTATGTGACCCAAGCCTTCAACCGCTGGTGGGGTCAGTACACAAGCTTCCCACTGCC
TGACAACCTGATGATGGTGGTGTCAGGGAACGTCCACGGTGCTGATGAGAGGGGCCGTCT
CCTGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTTAACAAGTA
CTGGATGCCTCTGACGTGGTTCTCCAACCTGGCATCCAGAGCCAGAGAGGAAGGGCGAGT
GAGGGATGACATCGCTCTGAGGCTGCTGATGGATGTGAGGGCTTTGAGGTTCTCTGAACA
ACTGAAAACGAAACTTATTATGAAAGTCAGAAATAATAAAGGTTGTACTCTTGTTTGACT
TTTCTGCTGTGTCTCCAGGAGCTCAACAAATACAGAACCAAGTGCAGCCTGTTGTTCCAC
TACGACTGGATAAGCATCCCCCTGGTCTACACACAGGTATTTATTTATGTGACAAAAGAA
GTTTTTTTTTTACTTACCATAAATTCATAACTGTTATCTTCACTTTCTGAAAAGCTTTAA
ACCCACCTAGAAACAGGTTTTGTTGTGGTATGAAGGATGCACTGGACTTCTTGCACCCTG
GTGGAAAGGATATCCATAGACACATTTGGCACACTTTGTAAATCAAACGCGGTTTAAAAA
GGTTTTTTCTGCAAATAGCTGCTGGACTGACAGCACCTGTAATAATGAATTAGATCTGCA
GCAGCAGGATAAAAGGTTGTTGTGCAGGAAAAGTAGCGCTTACCTTAAATAAAGATTTTC
TCTTAAACATCCTCCTACCGAAATATTGTACTATATAATTCGGATGGTGAACAAATGTTC
AAGCAGCACAATATGCAACTAAGACGTTTTCCTCTATATAGTTCATCCATCCGTCTTTTA
TATCTAGATAAAATCTTAGAGATAACAATGCTGCACCAGGTCAGAGGAAGGCCTGGACGT
TGTAATGCAGGGGTTCTCAAAGTTTTTATGGCAGAGGGCCAAATTAAGAACTCGACATTA
GACTGGGGGCCAATATTTGTGGGAAAAAAATTGATGAACAGAAAAATTTGTTTTTGATAA
CTTTAATGACCAAGTGTTATTTGTATAGTTAACCCAGGGGTCGGTAACCGGCGGCTCCGG
GGCCGCATCTTCTAAGATTGTCGTGGTGCCTTTAACACAGTAAGGTACCGCGAATGGGCA
GGAGGAAGGGAGCAGCGTGAACGCGGAGGGGGCGTGTCTGCAGCTGTGAACGCGGACCAG
AGTCAGTTACAGGATGGAAAGGTTCCTGGAAAGACAGTTAGTGGCGATCTCGTAATCCTT
TTATTCCCCTAGACCAGGGGTGCTCACACTTTTTTGGCGTGTGAGCTACTTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAATCTTGTGCTTT
TTTCCTTTGTACTCACAGATCAGTTGTTTCTTGCCTATTGCTGCCACCTTGTGACCAAAA
CATGGAACTAGTTTTGTTTTACTTGCTTTCAGTGAACCTGCAGCTTCAAGTGCAGTGAGA
GTTTTCACAGACATGACGTTACAATCTGCTCCTGTGTCCAGCTTACATGTCACCTGTTTT
TTGTTGATCTTGAAGTTTTCTGTCCAAATCTCAGTGTTTGTATCTCCAGAATCCATCACA
GAAATGACTTTTTCCACTGTGTTTACTGCTCCCAGAAACATGTCATTGTCACTTTCTCTC
TGCTCCACTGTATGCACTCTCTTTCCTTGCTGCTTCCTTTGAACTTGTGATCTGCACATT
TTAGCAAAATGATTCTTTTTCTTGCACAAATTGCATGATTGTCCAAATGCAGGACATTTT
TTAACTGCATGCTTGAGTCCACATCTATTGCAGTTTATTTCTTTGAACTCTGCTTTCACA
GGTTTGAATGTTCCTTTATCTTCTTTTGTCATCAGTCTACTTACTTCAGTGAGAGCTTTC
ACCTGGCTGGTCGTTATTTCACTGGCACGGCAAATATTAATGGCCTTTTCAAGTGTCAGA
TCTGCCTCTCTGAGTAATCTGCCTCTCACTTGGTCATTCGTAATGCCACACACAATTCTG
TCACATACCAGGGAATCATGTAAATCTTTGAATTCACAGTCCTTGGCTTTGTTTCTTAAA
TCTGTGACATATGCATCAATGGTTTCTTCCTGTTTCTGCGCTCTTGTGAAGAACATGTGC
CGTATGTAAGTTAAGTTTTTTCTAGGTTCACAATAGTCCTTAAACTTCTTTTTCAGCACT
TCAATTTTGTCTTTCTCGTCGTCTCCAAATTCAAAAGTATTGTATACTTTTACCGCTTCA
TCTCCCGCGACGTGAAGAAAAGTTGCACATTGCACCTTCTCGGACTTTTCCGCGATGCCG
CTGGNNNNNNNNNNGCCGCTGGCGGTACAGAAGAGCTCAAAACGCTGACTCCAGTTTCTC
CAGTTTTCCGCCAAATTTCCTTGCAAACTTAGATTTGGTGGTGGTTGAAACTGCGCCATT
TCCTCTTCTTTCCGAATTCTTTTCTTCTGACACCATGTAATATTGATGAGTCAGGACGAC
CTCCAATGTTTGAACAGGCTTTAATTATCACAGACTCGCCATTCACCATGCACTTCAGTC
ACATGTACAACACCGCCTCCTAGTGTGTGTCTCGCGATAACAAACAACTCGCATACGTCA
CAATGAGCTCGTATTTATCAGGCGAGAACTGCAGAGCTGATAGCAGGAGGACACACGCGG
GGCGGCTTCAATAAACACTCCGCTTGCGCGGAGCGGTCTTCTGACGGGAACTTGACGTGA
CGTGGGGCAGACAGCAACTCTCTTATGACAGAGAGTTCGCGCTCAGTGTTTTTAAACACA
CGTCTGCAGCGACGTATGCATCAGAGGATGTCCGATTGGCCGTTCTGCATGTCAATCAAG
TCCTGTACTTCTCGGTGAGGATTTTGATTGGCTGGTGGATTTTTAAGAAGTACTTTTTTT
TTCATCTTCTCTGTCCCGCGGTCTACCCTCATGTCCTTGACGATCGACTGGTCGATCGCG
ATCGACGTAATGAGCACCCCTGCCCTAGACTAAGACCACCCATTTCCGAGTAAAATTAAT
TACATTTGCGTCAGGGTGCCCTAACTATCCTGTCACCTTGCTGCTAGGATGACCGTATGT
TGCGCTGTCTGTGTAGAACATGCTGGGGGGGGGGCTTAGACTCCCCGCTTATGATTCCAG
ACCCGCCACAAACTAACAGCTGCTTCCTACTAAAAAATAGCTGTCATCCATAAAATTAAT
GTAATTTATTGGGTTTACTGCATTAAAAAATAAATAAATAAATAGAAAGGAGTCTGCATC
AAAGTGAATTTATTTCCATCATCTCATTTATCAAAACTCTGGATGTTTGACAGACAGAAA
AGTCTATTCAAGGTTGTGGAAAGTGGACAAAAGATCAAAAGAAAGAAATATCTCATAGAT
AATTAACTAATTAAACACAGATACTGACAGCATTTTGAATGAATACAAGTGGCCAAATGA
ACTATCGCGATATATCGGCAAAAACCTTTTTTCTATCACCCCTACTGTTGCGGCTCCCTG
TGCTTTCATCTAAGTGGGAAACTGATCCAAATGGCCCTTTGAGAGGTACAGGTTGCCGAC
CCCTGAGTTAACCAGCCCCTCCAGATGTTTTCCCAGTTGCGGTTAGAGGTTGCTGCGCAG
ATCTTCTACTCGTCTAGTATTTGTATCATTTGATAGACTTATTTCTTTAAACCTTTTCTT
TTGCTCTGGACAAACAATGTCAGCTACTTCCAGCATACATTATTTTACAAACTCCCCGTC
ACTTCAAGGGCTTCCGACACCGGACCATTTCCAAAGCCACAACGTAGCTACTAGCTTCTG
TCACAGCTTCACTGGATTTAGCCATTTTTGTAAACATCTGCTGTGCCGCATAGACTTGTT
GTTGGAGCTTATTGTTGCGCTCCTCGCCGGTAAATTTGTCATAGTTTTTATGATTTGTAA
CATTGTGACGATTTATATTGAATTCTTTGAACATTGCATTTACCTGCAAAGAAGGCACAG
GACTTTATCCACGAGGTACGACAAAGTAAGCATTTGTCCAGTTAGCTTGAAAGCGCCTTT
TCTCCTCGCCAACACGATTTTCCTCAAAGGAACCTGCTCTGGTTCTCTCCCTGAATCCCG
CTCTGATTCCATTTCTACTGCTGTCGTCACGCTCCTTCCTTTCACAGAGGCACTGACATA
CAGTAGATAAATCTTGTCTGCCCTCTTGTGGTGAAATGAATACACTGTACTGTTGACACC
CGAGTCTAATTACTTTTTTTTTTACTGCAGATGTCGCCAGAAACCACAAAACAGTATTTT
TCCAAGCAATGTTCAGCTGATTTAAAAGCAATCATTTAGGATTTATTGAGGGCCGCAATA
AATCCCGTGGAGCCCCTGGTATAGCGGTTAGCGCTCTTAGCTCACAGAGAGAAGGTCCTG
GTTTGCATGTTCTCCTTGGTCATGTGTGGGTTTTCTCTGTTTTCCTCCCACAATCCAAAA
ACATGCTTCATAGGTTAGATGGTGATTCTGCATGGGCCCTAGATGTGAATGTGGTTGCGT
GGCCCTGCAACAGACAGGTGACCTTTTCAGGGTGAACCCCTAACACTGGCTGGGATAGGC
TCCAGCAGCCCTGTGATGCCGAAAGGCATTTCTGTGGGTTCTGAAAATGGTTGGCTCAGA
GAAAGTAATGTTGTGACAGCCCTAAAGAAATAATGCTGCAACAGCTTTGAGGAAATAAAT
GCTATGCGTAATGCTGCGGCAGCTCCAACAGCTCTAAAGAAGAAATTCTGCGACACATCT
GAGAGAGTAAAGCTACTGAAGCTCTGGAGAGATGTTACTGTAACAGCTGTACACACAAAA
CTACATGCTCCCTACAATATCTTACCTCCATAAACAACATCTAGACTAACTTTTAAATTG
CACAAAGGTGACTTACAGTATATGGTCACTGTCTTTGAAGAACAGTTAGGATGACAGGTT
TACATGTTTTTTAATAGGAAATGTCTGAGCTGCAAGCTCTTGCACAGAAACCAGTCCTGG
GTAAAGAGAAGACTGTAGAAATCTGAATTCACTTTTTATTGCAATCATATTTAGGAAAAC
AGACATCTTCCCTTTATTGAAAGGACTTCACAGCACCTTGGACTTAAACAGCTAACAGCC
AATTCCTCATTTTTGGGTTTGAAGTTTTTTTGTTGTTGAACATTTTGTCTAAATCTTTTT
TTTTTTTTTTTTTTGGACAGGTGGTAACTATTGCAGTTTACTCGTATTTTGCTTTCTGCG
TGATTGGCCGACAATTCCTCAACCCTGAGAAGGGTTACAGCGGTCATAAACTGGACATGT
ATGTTCCTGTTTTCACCCTGCTGCAGTTCTTCTTTTACACTGGTTGGCTCAAGGTATTCC
AACAAATCTGTAAAGCATTTCTATGAAAACGTCCACCTAATTAACTTTCTGTTATTAACT
AAAAAGAAGTTTTAATTATTTTAGAATGCCCTTTAAAACCTCAGTTGGAATTCCCTGTTA
GTATCTTTTTAGATTTGATGTGATTTGGCTAAAATGTGTCAATGCCTTCCGAATCAGACT
TGAATTTCGCTCTGCAGGTGGGGGAGCTGATCATCAACCCATTCGGAGAAGATGATGATG
ACTTTGAAACCAACCAGCTCATTGACAGAAACCTTCAGGTGGTCCTCTCAGTGTCACTGC
CTCTGTTAGGATTTGCTTGAGTACATACGGTTTTTCTGTGCTTGGCTCTCCCAGGTGTCC
ATGTTGGCCGTGGATGACATGTACCAGAATTTAGCCCCGATTGTGAAGGACAAACACTGG
AACCAGAGACACTTCTCCATCCCTTACACTCTGTCTACAGCAGCCGAGTCTCAACGACCA
GCTTTCAAGGGTTCCACATTTGACATGAGGTGAAGTAAAAAGACATGGAAAGTTTTCTAT
GACATATATCTGTGAGTGCGGCTCTGAAGGTGGAGCTGTCATCTGCTTTGATATCTGGTC
TCCTTGTGCTGAGCAAGGTTATTATAGTTAACGAAAACGAACGAAAAAACTAAAACTAGA
ACTGAAAAAACATTTTCGTTAACTGAAATAAAAATAAAAACGAGAGTTTTTAAAAAAACG
AAAACTAACTAAAACTGTTTGTTGTGTGTATAAAACTAACTGAAACTAAATAATATTAAC
CCCAAAAAATACTTCGTTTTCGTCTTTGTTAATACATAAGTCTTTTGGGTTGAAATAAAG
TCTATTTACTTCACCCTGCTAGTTTTACTGTGTATCTGAACTAGAGGGCTGCATGGGGGA
TTGGGTCCCGCCGGGTCCCGCGGGACCCAACCCAAATCTCGCGGGATTGGGCGGTTTGAA
TTGTGCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGAGCGGGCGGCAGAAAAAAAC
CCCGCGGGATCAGTGCTGCCATGAATATCTCATGAATATATATTAGCGGACTACGTTAGG
CTGAGCGGCTGTTGGATTCTTATGTACTGAAGTTCCGTGAAGGCACCAGGTAGAGACGCC
CAATGGCCTCTGTCATCTAACCTGTTGTTGGGGGTGCGCCCCGCCCCGCCTCTTACTAAG
AGCGCGCTTCAGGCCGTCTGTCTGCGCGCGCACACACGCACACTTTTAACCGAACGGGAT
TTGTGAAAATATATTTAATAATTAAGTTGCAAATTACACAAAAGAGGAATGCATGAAAAG
ATGAGGCTGGAGGAGGGACATGAATCTCTTTAATAATATCAATACAAATACGTGTTTTTT
TCCTGCGGGACGGGAGACAATACAAAATCAATGCATCTCTATTACTGTGCGGGACTAAAT
TCTATGAGTTTTGCGGGTGCGGGCGGGAGTGGACATACATATTGCGGGTGTGGGCGGGAG
TGTAACGCATACGTTGCGGGAGCGGGCGGGATTGGTCAGAAATTCAGCGGGCGCGGGATG
AAGAAAATAGTCCCGCGCAGGGCTTTAATCTGAACCTTACGGCATCACGTAGTCTGTGAC
GTCACATGATGTCTGTCGGACACTGCCGGCTAGCGTTGTCATAGACATTTACATGAGCGT
GATGGCTGCAGTAAAAGTTGGGAGAAAGCGGGAGAGTCCTATTTGGGACTTTTTTGAATA
TAACAGCGTCGAAAACTAAAGTAAGTGCCTTGTAGTCGAAGCAGGAGACAAAATTTGTGG
AACGCTCCTCAAAGGGAAAAACCCTACGAATCTAAAAGTACATTTAAAAAGCGCACACAA
CAACGCAAATCAACAGTACCTAGACAAGCTAGCCTGTCGCCCGCCCTCCCCCGAAAAAGA
AGCCAGAGCAGATAACGTAATGCTGTTATCGGCTGTTGTATTTTAATTTAAGGATGGTTG
TCCTTGTGTCCTCTGAATAATAAGTGTTTCAAAATGTATCTTTGATTGCGTTTTTATCAT
ACAATACTTATTCTGGTGATTTTGAATCATGCACCTGACAAATATCCTAATTTACAAAAA
AAAAACTAACACTAAAACTAATAAAAACTAAACTAAAACGAAGCAATTTCAAAAAATAAA
AACTAATAAAAACTAGTAAAACAGCCTCTAAAAACTAATTAAAACTAAATAAATTTAAAA
ACAAAAATTCAAAACTAAATAAAAACTAAAACTAATAAAAAATCTGAAACTATTATAACC
TTGGTGCTGAGGTGACCTTTTGTAATGCAAATAAGCCTGTGTTGTTTTCAGCAGATAATA
GTTATTGCACCAGATTTAGACATGCACTCATGAGTGTGGACCATTCACTGAAAGTAGCAG
CTCAAACACTCAGCTTGAACTCAGTTTAGCAAATATAAATACATGTGAAAATGTTACCAG
CAGGCCCCAAATTCCTAAAAGCTCAGATGTTGTGACTTTATACATTCATCCCCAGAAGCC
AATACCATTAAAGTCATAACATGTATTCACTGACATTAAAAACATAAACATGAAGATGTT
TTATCTTAATTTTTTTAAAGAAAAAAATGTTGTTTCTGTACAAAGAGGAATGAAGGTGTA
CGCTAAATATCAAATAGTTCTAACTTTGCAGACTTTTAGTTCAAATAAAACTAAAATAAT
GAATGACTATATTAACTTCAATACAAATAATTGTTAATTCTATAAAGTTGAATACTCAAA
TCTAAGAGTGTTGTGTCTCTTGTAATGTAAAAGGGGAAATTAAACAAATAAATAACACCA
ATAATGTAAAAACTTATTTGGATTTTCATCATGCCTGACCCTGAAATTCATAAACAAGCA
TGAAAACCCAAAGAAAATCTCAAATAAGACAAAGTTAAGAAACAGAAAATGACACAAGAC
TTAATTAATGCAAACATCAACCTGAAAAATCTATAGAGACTTTTATTTCCAATGTGCTGT
ACAAAGTACATTTAGGAGCCAAAAGCAGAAGCAGGATTTGGAAATCAGTTAAAAATTTAA
CATAAACAGTCAGGTGGTTAGATTTATGAATTTTTATGATTCTTATTTGTACAAAACGAA
AGCGGGGGTTTGGCCTGCTTACTTTTAACTTCTGGATGTTTGTTTTTATTTTGAAGGTAA
ATTTCACTTTTGTTTTCTTTTAGCCAGTATCACACACCTGAAAACAATATTTTTCTTTTT
TTTTAAATTCAGTTTAATGTTTGCTTGTGTTGAAGGCACACTGCTATCCTGAAGACAAAA
CTTTCCTTTATTTACAGAATGAGCGTTGAAGATCTCGAAATTCACCAGCCTAAAGAAGCT
CCAGCAAACAGAGCGTTTTTGCAGCATCGGACCTCTCTGGTCGATGGGTTTGATGATTCT
CTGCAGAACACTAACGGCAGCGTAAACAGTGAGAGCCACATTTATCTCACTGATGTCTTG
TTTCACCCAGATGAAAAAGATGAGACTGATGAGCACAACACCAATGCTGCAAGTGACCGA
GAACAGGAGAACGCTCTGCTTCCACCTGAACAAAAATACTGAGAAATATGGAAACTGGCC
CAAATACTCTGACGAACTTTGTGTTTTGTTATCAAAGCTGAAGTGGTTTGTTGTTTCTTA
CATTTTATTTTGTACATCAATAAAATCAGGGGACTTGTAGATTCTGTATGAATGATGTTT
ACGGTATTGAAGATTTTTTCTGTTTATTAACTCACTGAAAAACATTGAATATATTTGTTG
AACAAAAAGCCTAATACATGGTTATAAATTGCATTATGCAAACACAATTATGATGCAATG
ACTTCTCAATGTTAGTAAATATCCCAACTGTTAATTTCTTTTTTTTTTTTTATGGGGCAT
TTGTTTGATTTTTTTACCTGCTTTGGTTGCTGCTATTATTAAAAACTACTCTTTATGCAT
CCATGTTCTTTTTGATTACTGTGTTTTTTGTTCCATATAATGTATTTTGACTGCTAAACT
ATAAAAATGTCAATAATTATTATACAATTTACTGATTTGTTTNNNNNNNNNNGCATCATA
AATGTCAATAACCTGAGGTGTAAGTCCTTCTGCTGCATTGGCTTGAAGACGGCACGCGCG
CATGTACGGCAACATACGCGAGCACGTGCTCCCAGACGGACGTGCTCTTATTTTGAAAGA
ACCGGAAGTTTACCGCGATCAGTGTGTACCTGGCGCTTCCGCGTTGTCAGAAAGTTCAAT
TAACACATCAACGAGTTTGACAGACTCGCCGTCTTCCAGCAGGTACGCTCCCGTTAGTGA
ACGCTGCCGTTTCCCTCCGTGAAGCGGCGGTGGCTGAGATGATGCGGGTGTTTTGGTGGA
CAGCATCTGTCAGTTACCCAACACCTAGCTAGGTTGCTAATATGAGCACACACACACGTA
TTTCATTGTTTTCAATGAAAAAGGTTTATCTGGTGATGAAAACGTGTCTGCTTGGATGTA
GATGGTTGAATGTTCAGGCGGTCTGTGAGTCTGAGGCTGACTGGATGCTCCTCGGCGAGG
CCTTGTTGGTTTCTTTTCTCTAACGAGCTGTTTTCCGCGGCACTGCAGGAGCATCGCTGT
AAAACACCCAAACAGGACGGGGGTGTGACGTCATCTGATGCCCCTCCGCTGCTACCTGCC
ACCATCACCGTTGTCGTCATGTCTCTGGGCGACAGCCCTCACCTGCTGCTGGGGAGGATC
CGGTTCCTGAACAGCTGTATCGAGAGTTTTAGGAAGAGCGAGCCGGTACCAGAGTCCTTG
TGTTATGTTCCCAGAGAGGTGTGCTACAAAATCTGCAAGGATTCCTCCTCCAACTTCTCC
GCCTCCTCTGGGGCAACCTCTGGAGGTTCCTTGGTTGGGAAGACCCTGGTGTCTGTCTTT
GAGAGTCCTCATCAGACTCCCCATAATAAGAAATCATGTAAGTTCAGCATTGAACCAAAG
AAAGGGACATGCATACGGACCACCGGAGAGGAGTACTGCAACAGCCAGGGCCTTTGGGTG
AAAATGAACAAGGTTTGTTGGAACTTGCCTGGTTCTACTCCTCCCTACAGTGGTTCCACA
TGTTGAAAGCTTCCATAACACCTGTTAATCGTTCACTGACCATGAGATTGTGTTAAGAGG
TTTGCGGATGTTTTTGATGACCACAGAATCAACTTGTGTCCCCAGGAGCAGCTGGACGAG
CACCGGCCCGGCCAGGAGCTGGAGGAAGGCTGGATTCTGGTGTGCAAACACACAGAGGGG
GGCGACAGGCTGGTCCCTGTGGAGTCACCAGAGTCGCTCAGCAGGCAACAGCAGCTCTTT
GGCTATGACCACAAGCCCTGCAACAGGTGGGAACAGGTGGTGGATGTAGGGAACGCGCTC
TACATTGGATCCAAACCAAAGATTGCAGACTGTGATGCTGCAGCGGTCCAAAGGCTCAGG
TGAATCTGCTGTCTGTGTCACACACTTCTGGGAGCTACATGCACATGACGCAAAAATGAT
TTTTACCATCTTTTTATTTATAGGTATGTTCCTCCAAACTGGACTTATGAAAGTGATGAG
GACTTGGTGCATTACTTCTACGAATACATTGGAAGAGAAGATGAAAACCTTGGAAGTGTG
AAGCAGTGTGTGACCAGCATAGATGTGTCTTCTTGCCTTGTGAGCAGCTTTTACATTACA
TTTACGTCACCAAAACACAATTTAACTCGTTTTTCCCCTCATGATTCCTGTTTTTCCACA
ATTTACTTTTAGAAGATCTAAAGATCTAAAGTGCTTTATCTCATCCATACAGTTGAAGCT
GGAACAGATATTGGAATATGAAACATTATTAAATATATGAATTATTAGATATCTGATATA
CTCTGACAAACTTTGGCATACTCCCATTAAACTCTGACATACTTTGAGAATAATCTGACA
TGTTCTTCAATACTCTGATATACTTTGACAATACTCAAATACTCTGACTAGTACTTTGTC
ATTGAATACTTTGTCATTTTGTACTTTGTCAACCCAGTTTCAACTGGGTTGAATGACATG
AAATACAAAAAAACAGAATTGCTCTGACAATACTCACACATACTACTTTGACAACTCAAA
TATACTTTGAAAATACTTTGACTAGTGGGTTATGTCACTGATACAGTTGAAACGGGAATG
CATGCCGTGGAATAACTGAAATACTCAGACTTGAACATAGTACTTTGACAAAGTCTGAAA
TACTCTGACAATACTTTGACGTACTCTGACCTATCCTTACAGGAAGATCCCAGTGTGGGT
GCAAACTGTCTGACAGACGGCGACACTGAAACCTACTGGGAGAGCGATGGGATGCAGGGA
CAGCACTGGATCCGTCTGCATATGAAGAGAGGCACGGTCGTGAAGTAAGAAGAGGAGCAG
CTGCACAGTGATCACTGCTGTCTCCTCAGAGTCACGTTTTGTGGGGATTTATTGTAAAAA
GAAAAAAGACACTGTTATTTGATCTTTATATAACAAAGGAGAATCTGATATAGCTTATGG
CCTGTAATAACATGAAGACAGATTTTATAATGTTGTCAAAGAGCTTTTAGAGCGTTAGTG
CTGTCTCACTTCTTGTCTTTTCACATTTGTAATACAGACTGTTTTAGTTTGGTTTCATCA
GCCAAGTCATCTCATTTAGTCTTTTTCTTGACCGTTCTCTTTTACCTATATTAAGAATTT
AATCATTGAGATCAAGCCTGTTTAATTTTCTAGTAAGCTGATCCTGACAGTGGACTCCAC
AGATGACAACTACATGCCTAAGAGAGTCACAGTTTATGGAGGGGAGGGAGACAACCTGAA
GAAGCTGAGTGACGTGACCATCGATGAGTGAGTCTGAGCATTAGTGCTTCAGAACAGAGC
CAAAGTGTTTATTGACACATTAACGTACTAAAAGGCTTTTCTGATTGTTGTCTGGAAGAC
CAGTTAAGTATAATAGAATAGAATTTTTCTTTAAATAGAAGCACATTTGGTGTTTATGTT
AGCTGGCTTGTGTTGTCCTTTGGCTTGCTTTATTCAACCCATCATGACGACCAGCAAATA
TATCACTTTCCTTTGCCGCTGCACTCGGTCTGAGCCGACTAAGGGGAGCGTTGTGACGTA
ACCGTGACAACACGCCGCACCACATAACGAATAGTCCTGAACCGAAAAAATAAGAAGAAT
AAAGTACTAAAATCTGACTGAATTTTTTTTTTTGGTAAGTGACCATGGTATAAGCAGGTC
AATGGCCTTCGCAGTGTGCATTATCAGAATAAATACACTTGGCGGAAATAACCGTCCTCC
ACTCAGCGTCGAATGGTTCAGGCTTCCACGGCGTGCGTTAATTTCTGATAATGCACACTT
CGTCGGCCATTAACCCTTACGTAATAACCTTCTTTTTACCTAGTTAACTCAAACAAATAT
CAGAAGGACTGACATTTTCCATTTTCTGGAAGAAAAAAAAATCCAAACCTGGCTTTTCAT
GTTTACTTCAGCAATCTGATAGGGGAAGTGTGTGTGCTGGAGGATATGACCTCCCACCTG
CCCGTCATCGAGGTTCGAATCGAGGAATGTCGCGGTAAGGCGCTTCTTCTTGGTGTTACG
TCTCTTTTTCTTCAGTGGCTGAAGCTAAAACTCTGGTAAAGCCTAAACCTTTTGTCCTGT
TTTGGGATTTACAGACGAGGGGATAGACGTCCGGATCCGAGGTTTGAAGATCAAGTCTTC
CTGTGAGAGGGACTTGGGTCTGAATGCTGATGTTTTTCAGTCCTCTAACCTGGTGCGCTA
TCCGCGTCTCCAGGGAACGCCGCCCGATGTGCTGTACCGCAGGGCATTGGTCATCCAAAG
GTGGGCAGGCGATCGTGTGATCTTAACTATGGGCTGTACAAGAGAACTGGATCAATTAGT
GTGACGTCATCCATAGAAACTGGTTCACTTTCATCTCCAACCAAATGAAGTCAATTCAGT
CACCATTTTCTTGCAATCTTTAAGTCGCCATGTTGGAGCCAGAAGATATGAGCAAGCAGC
GATGGATCCAAGTTGGTGTGAGTCAACGTTTGTATGGCAACCACTCTCGCCAACCAGGGG
TGGAATTGTTAGAAAACCACACCCCTTCAATATAAAGCGGGCTCGTTCCAAACATTGGAC
GTGGGGGCCAACAAGCACCACCCGCGTATATTGAGGCATCTGATTGGTCAGTTTATAACT
TCATTAACTTGCAATATAGGAAAAAAAAAACGAGGATTATCAAGAACATGTTTGAAAAAG
GTATCAGAACAGGAATGGTTTTCCTGACCAACAGAACCCATAGACTCTATAGCAGTCTGT
GGGGTTTCGACTTCTTGGAACCAGCGGGTACTTCCTGTTTGAAACACCAGCGGGAGGGGT
CACTCGGTCCAGTTTTCTTATACAGTCAATAGATCTTACAGAGAGGACGGTGGGGGTACG
CAGCAGTCCCTGGTTGTTAGCGGTCTCACATTTTTCTGTCTCTTTAGGTTCATTTGCCTC
CTGGACGGCGTGCTGCCACACTTGGTGCCAGCCTGGGATTATAGTCTGGGTACCTTCAAC
CAGATCAAAGTAAGTAAGCCTGAATGTCTGTTTTCTAGATGGCTGGTAATAAAAGTACTG
GAGTTTTGTTTCTGAAATATGAAGGCAGAAGTTATGGTTGGGTTTTGGGAGAGTGTATTT
GAGAGGCTGCATAAAGTTATGGAGTGAAAAGCTGCTCTGAATCCATACTGTTGGGCTAAA
GTTTTATGTTTCACATGAAAAGAATGCAAGGCTAAATGATGCACACAGCAGACATTTCTT
ATTTTAAGTTTGGATTTTGGTTGATCGGCACAAGTATTATCTTAAAACCCTTCTCTTCTA
TGTTAATTTGGATAGACATTCATCATGAAACTGTGGTGTTTTTGGTCTCTCTCAGAGTAT
AAAGCGGTTCTTACTGTTGTCCAAGCGCCGGTCAGCCCTCATCACTCAGTGTCTGAAGGA
CTCAGAGACGAGTAAGCCAAACTTCATGCCACGACTTTACATAAATAGACGTCTGGCCAT
GGAGCACCGGGACAACCCGTCTCTGGACCCAAGCTGCAAGAATGCTGTGTTCAGTCAGGT
GCCGACACCAAGAACCCCCACAGTGCACAAAGTCTATTTTCAGGTTAGACGTATTAAGCT
TGTCTGTCTTATTCCTCTTTGCAGGTTTACGAGGGTTTGAAGCCATCTGACAAACTAGAG
AAGACTCTGGATTACAGGTGCACCTTCTCTCCGTCATTCCTCTGATCCGAATTTGAGTGT
TGGATTGTACTTTTGAATCTCCTCATCAGATGGCCAGCTCGATATGACCAGTGGTGGGAA
TGCAAGTTCATCGCAGAGGGAATCATCGACCAAGGTGGAGGGTTTCGGGACAGCCTGGCA
GATATGTCGGAGGAGCTTTGCCCCAGCTCAGCCGAGTGTCCCATACCTCTGCCATTTTTC
CTCCGGACGTCTAACCAGGTCGCTACTCCTCATCTCTGCCTGCTTTCTGTTAGAAAAATA
TTGGAGTTCAGCTTCCTTACCTTTTTCTTATTGTTGTCAGGGCTCCTTGGAGGCCAGAGA
TTACTATGTTCCCAATCCATCCTGCAAAGACTTCCAGAAATACGAGTGGATCGGTCAGCT
GATGGGGGCTGCACTCAGGGGGAAAGACTTCTTGGTGAGTGAAGCTCATTTCCATCAAGA
ACATCCTGGTCACTACAGAATTCCACTCAGAAGCTAAAAACCTCTTAGGTTCTACAGCAA
GCATGGCTCCAAATCACACAAGTCCAAAGATACAGAGATACAAAGATGAATGGAAATTCC
TCCACAGCTCAGTAAAACGTGAATTGACTCCTATTCCAAATGCTTGCAGCTGTTGATGTG
AAGGTGGCCCAGATTTAGATCGCCTTTAATACAGAACCACTGAGGTTTGGTGTTTGTTTA
TTGATAATACTCAAATGAGACAAACACCACTGTATTCAGTCTGGAGGACGAGTAGATGTT
CAGCGTTGTTTTGCCTCTGCAGGTCCTGGCTCTGCCCGGCTTGGTGTGGAAGCAGCTGAC
TGGTGAGGCCATCAGCTGGAGCAAAGACTTCCCTTCAGTTGACTCTGTGCTGGTGAGGAC
ATTCAGTTCCCTGCTGCTCTACAATCATGATATGAAACCAACAAACACCTTAAACCTTAA
GTTTAGATGTTTTATTGTCACATTTCACCTTTTTCTGTCACATCCTGTTCTGTGTTTCTA
TCGTGTTAAAACTGTCTATTGCAGTTACTCTTGCATGTGTTCCGGTGCTTCCTCAGCTGG
AACCTCTCCCTCTGGGTCGGATGCTGTTCAGCCACTGCGGCTCTGGATGGGGACCTGCAT
CACCACTTAGCTGTGGTGGAGGGGTCCCCGCCTGTGATGCTGCATTTGGCTGATCATTCA
GCTGTTCACAGAGAGGGAGGTTCCAGTTATCAGCGTTTTCGTGCTCAGGCTATGTCTTAT
TTCTCAATTCTCACTGTCTTTCCCCATCAATTAGGGGGTGGGAGAGGTGTAAGAAGTGGG
GGTTGTGTAGGTACGGGGAGGGGGGACCTATTTTTATTTTGTGCTTGTTTATTTTAATCT
CTATTTTGTTTTATTTTAATGTAAAGCACTTTGTGTTATTCTTTTATATGAAAAGTGCTT
TATAAATAAAATAAAGATTGATTGATGTAGCTCATTTCATTGATGTGGTTTCAGGAGTTG
GGGTTCTGTTAACTCCACTCTAAACATGAATCAAATGTGTTGCAGGTAAACTTGCTGGAG
GCCATGGAGAACATGGACAAGGAGACCTTTGAGTTTAGGTTCGGAGAAGAGCTGGTCTAC
AACACGCTGCTGACAGACGGTCAGATGGTGGAGCTTATCCCAGGCGGCAGCAGCGTGGCG
GTGCGCTACGAGGACCGCAGTGAGTTTGTCCACTTGGTGCAGAAAGCTCGACTGGAGGAG
AGTAAGCAGCAGGTCGGACACGCCTTCCTGAACCTGTCACGGCTTTGCTTTTATTCTTTT
CTGTCCAAAGTGTTCTGATGGAACTCTACCTGCATGCGTGTTGCAGATTGCAGCCATGCA
GGCAGGGCTGCTGAAGGTGGTTCCTCAAGCTGTGTTGGACCTGCTCACCTGGCAGGAAGT
GGAGAAAAAAGTCTGTGGAGACCCTGAGATCAGTGTGGAAGCTCTGAAACGACTCAGTGA
GTGCCCAGCTTGGAAATATTGACATCAAATATAAACTAAGCAGTAAAGATATTAGATATT
TGTAGCTTTGTTTGTTGGGGGACCATAAACCAGTATGCTTTTCATACAAAAAAATAGACA
TTTGTTTCAGATTTAGCGCAAAGCCCTTCAGCTTTAGAACAATTCAGTTTTCATGTAAAA
GCAGGGAAGATTGTCCCTCTGATCACTTTATTCTTCTGCCAAGCACGCTTTGAAGATCTG
GAACACAACGATGTTCGAGTGCAGTATTTATGGGAAGCCCTGAGAAACTTCACCAATGGT
CAGTCGTTTGTTCTGCTTTTTCCAGAACTCCATCTTTTTGTTTTTGCATTTCTTCAGCCC
GTCTGAAGAAACTGAAACCTTTGAATTCTGTTTTCAGAGGACAGAAGCAGATTTCTGAGG
TTTGTCACTGGGCGAAGTCGTCTTCCTGCGCCCATATATGTCTTTCCTGAAAAACAAGGG
TGAGAACACGTCCAGTTATTAGTTAATGGTTAGCAAGCAAATAAAAGAGCAATGATGTTT
CTATCCACCCCTGTTCTGTTTCAGCTCTGAAACCACGGATGCACTTCCACAGTCCTCCAC
ATGTTCAAGCACTCTTTATCTGCCCAACTACCCGAGGTTTGACGAGTTCTGTGGTTTCCA
TGTTTTTACTATTGGCACTTTTTTTAATGTCAGATGTTACATTTCCTTATTAACGTCATT
TCCTTTGTACTCTATTCTTACCTGTTGCTGCAGCGCAAAGGTCTGTGAGGAGAAACTGCG
ATATGCTGCGTACAACTGCGTTGCCATCGACACGGACATGAGTCCATGGGAAGAGTGATC
TCTCTGCTGTCTCCATCAATGCTGCTTTCTTCAAATCACAGCTACTCCCTTCAATTTACA
GTTTATCGACCCATATGTCAATAAAAAAAAAACTGTAAATAATAAAGTTATGTCGAAACA
TTAAGTGACTGGTTTAAAGTTTTGATTCATTGAAAAAAATGATCTCCAATTATTACTTTG
AAAAGAAATAACAATAAGTCTTATTGAAGTATAAAAAAAAATAGACCAAACCAAAAAGTG
TAAACCTTTTTTATGTTCTCATTTCTAACTGAAAATGCAACATTTCCTTTTTTAAGGACC
AAATTTAAAAGAAAATCCGTGATACTTCTTGATTTACTTTATAACATTGATTTTTTACAA
TTAGGACTAAAGCCAGGAATGAATGAAATGCAAAGAAGAGATTGTAATAAAACATATTTG
TGATGCTCTTTTATAATTTCCGGAGGAGATTTATTATAAAAAGATTTAAAAAAAATACAA
TTTAAAATAAAACAGAAAATAATCTTGTGTCTTATAATGTTGAGACATGTCATTAGATCC
AGTTAGCCTTAACCTAACACGATGTTTATCGACATTTGTTATCATTTAGAGTTCATTAGA
AAGATTTTTTGTCGTAAAACTTGCAGAACTATTTCTTAAAGTAATCATGTAGATCCTAAT
ACTCGTGAAATATTAATATTTAAATAAACATTGGCATAAAAAAGTACATTGTACCTGTCG
GAGCTTCGGTCGGTTTTTGTATTCTCGCGAGAACTCGTGTCTTCAAACTTTCCCATGAGC
CTTTTCGCTCCCTCTTTCTAGCCGGCGCCTGAGAATGGGTACGTGTTTTGGTTGCATTGG
AGGCAGAATCTCTCAACATCTGATGTTTTAACGAAGGAATATACTCATCATGGTTTGCCA
TATTCATGTTAAAAACTTCTTCTAAATGTCTAGCTCAGTCTTTCTGATTACAAATCGTGT
GATTGAGATTATTTGAGTAATTTTCTGCAGAGGATGGAAAATGCTTCAAGATGGCTGCTC
TCACTAGCCATGTCGTTAGCTTTCAATTTAGAGAAAAGCTGTTATTTGGCAGCAGTTTGG
TTAAATGTTTTATTAATATTGCGAGATTTAATTTATCCAATTAAACCTAAAGTAACTTGT
TTCGTTGGGGACTGTAAATGTGCGAGGCTACGTGAGTCATTTAGCTAAACGATGTTGACG
TTAGCTCGTTTTCATCATGGCATGCCAGTGGTCTCGTAGCATTGAGCTTAAGTAAATAAG
TTCATATAACGCACGTGTTTTACTGTGGTATAGAGAATTTAATTTAGAAATGATGTAGTT
CTGGCACATTGTGCATTTACTTCAGCGACTAGACGTGGTAGTGATGCTACTGAAATAGCA
TAGCACTATTTAATGTAATGTTTGGCTAATAATGGGACTCCGTTTTTACTATTTCTAGTT
GTATAAAATATTTATCTGCGGGTCTGTTGCTTGAGTGACGTGATGATGCTTTTTATGCGG
AATCCAAGAAACACATGCGGACAACTTACCTTGGAGAACTGATCACTCAAGCAAAAGTGT
CATTTTTTTGTGTGTGTTTGACTTAAATATTGAAAATGTAACCAATGTCTTTCTGTTCTT
GACCGGCATGCAGGTATCTCAAGGGACAACTGGCATAAACGCCGCAAGACCGGTGGTAAA
CGCAAGCCCTATCACAAGAAGAGGAAGTATGAGCTCGGACGCCCTCCTGCAAACACAAAA
GTGAGTGTTATTGTGCTTTGGTCACGTCAGGTTAGCGTGGATGATGAAAACTGGACCTTA
GGTAGGCCTTTTTTGGGCTGTTTTGGCCTAAAGCTTTGGGCTTACCAATGGTAGGGCTTG
TCATAGTTACACTGACACGCACATGGACATAACTCATGGTCCTTTAATGTATGTGTTGCT
GCAGCAACATTCTTTTACTAATGGTCTAATATGTCCTCATAGATTGGGCCTCGCCGTATC
CACACAGTGAGGGTGCGAGGTGGCAACAAGAAATACCGCGCTCTGAGGTTGGACAGCGGA
AACTTCTCATGGGGCTCGGAGTGTAAGTCAGTTTTATTGGACGTATTTTTGCTGAACCTG
CAACCATCTTTCAGTGATGATAACTTTGACCAGTTCTGCTACTGAATGGAAGTGGTGATA
TTCAAGTTCTGAGAAAGACTCTGTTAATAATGCTATAAATTTAACTTAACTGCTGGAATC
TAGATAATGCCTTTGATTGTGTTAAAGAAACTTGTTGGTTATGTAGGCTGTACACGCAAG
ACCAGAATCATTGATGTGGTCTACAACGCCTCCAACAACGAGCTGGTCAGAACCAAGACC
CTGGTGAAGAACTGTGTGGTCCTGGTGGACAGCCTTCCCTTCAGGCAGTGGTATGAAGCT
CACTATGCCACTCCTCTGGGACGCAAGAAAGGAGCCAAACTGGTATGAGGCTCTTTTTTA
TTTATTTCTTTTTTTCTTCTGTGTTTTTTCAGTGAACTTTTTTTATTAAAAAAGTAGTAA
ATCTGGTGATGTCTTTCTGTGAAGATAACTTTGTCCAGTTCTGCTACTGAATATAAGAGA
TGAATTTTAACACTCTGAGAAAGACTTGTCACCAAGCAACCATATGTTATAGGGTCTTAT
TGAAACTTTGCACACTATATTATACATCATGTGTAAATTTTTCTTATTCTGCGTTTTCTT
TTAATAGACTCCTGACGAGGAGGAGGTTCTGAACAAGAAAAGGTCAAAGAAGACCCAGAA
GAAATACGATGAGCGTAAAAAAGTGGCCAAGATCAGCCCTCTGCTTGAGGAGCAGTTCTT
GCAGGGAAAGCTGCTCGGTAAGTTCTGTCTCTGCTATTGTCATCGACTCCAAAATAAGAA
CGATGTGTTTGGAAGTTTATCAAAGACAACCCCATTTAATTTGAAATGGTTTATTTCAAA
CAATCCAAGCAAGAATAATGCACAAAACGATCCGATCCATAGATTTATACTTGGACGTAT
CAAATTTAGGATAATTAGACATTTCCATGGATCATGAGTTCATGGGAAGAGTTCATTGGT
GGCTGTCCTCAGCTTTGGATTGTACAGTATTTTTTTGTTTTTATTTTGTCCTGGTGCTGA
AAACATAAACCATAAAGGGACGAGACAAAAACTTTTAAGTAGCGTTTTCCTTAACGGTGC
AGGCGTTTCTTACAGCAAGCATCTTGCTACTGGTTTGTACATCAACCATTTTCCGATTAA
TCAGCTGATTCTGAATCCATGGGAATAACATTAACTGCATAAATGTTCAAAGTTTCAGCA
ATCGAAAGAATGTCAAGACAGAAGCCAAAGCTCCGCTGTTAAGAGGTTACGTTATCATTC
AGAATTTAAACAAGCAAATACTGTTAATTTAAATACGTTTTTGTTTCAAACCATAAAGCT
AACAAAGTTCAGATTAAACATCATTAAAAGTCATAATCAACAGCAGTATTGGCATTTATA
TTGATGCCTGTAACACCTGAACACCTTTGTTTTTGCTCCACAGCTTGCATTGCTTCTAGG
CCTGGCCAGTGTGGCAGGGCAGACGGCTACGTCCTGGAAGGCAAGGAACTGGAGTTCTAC
CTGAGGAAGATCAAGGCCAAGAAAGGCAAATAGATGTACAGCTGTTTGATACTTCAATAA
AATCCAATGTCCCAGAATCCTCTGTGCCTCTGCTTTTTTGTTTTGTTTGCTCTGATTCTG
GTTTTCTTTGAGTGGAGAAGAGTTTCCAGTGGCTGTTGATTTGCAAATTAAATAATTAAA
GGGAAAATTTTGTTTTTTGAAATCAGTCAAGAAGGGAAGATGAGTATCGTGTTTCAAGAC
TGGCTCTAGAAGAAAATACTTCAATACTTACCGGTAAATCTGTTTAAAAAATAGTTTAAT
GTATTAAAAAAAATTTAGTGGATGTTTTTAGATAGCAATTTTTGGCAAATGGTTTTAACC
CGTGTGCTATCCTACGGGGTCAAGGTGGTTTACGTGTTATTCCTACCATAACAAAGGTGG
AAAGATTTCATGTAATCCATGGACACCAGTGAAGATCACAAATCATTGAAGAGAAAAGGT
TCAGAGCACTGTCTAGTGGGTCTAGATGACCCAACTCCCAATGGTAAAGTGACTAGGATA
GCACAAGGGTTAAACAAATACAGATCACATCTCCTAACCCTGTAAAGAAATGTAAAAATA
CAACTGACCTGTGGTACAGGACTTCAAAAAAACNNNNNNNNNNATTTTTTAGGAGCAACT
GGTTCATAAACTGAAAACGTCAAAGAATGACTGCAGGCTTTTAATCCAACTAATGAACAC
AAGGATGTTGGTATCTACTCATGGGATATGAACATTTTTTTTATCCTGAATTAGTTGTAT
TCAGACTGGAAAAGCCCGTTGGTACAGACAGTCTGCTTAATTGGTCCAGATTGAGTCCTG
AACCTTGTTCAGTCTGCATGCCTGTAAATAAAACCACGTCACTAAAGATCTCTTCAGTCT
CAAGGCCGGACAAATACAGAGGGATGTGTCAGGAAGGCCATCCCATGTAACATCTTTGCC
AAACCAAATATGCGAACCGGACATATGAAGCTGATTCGCTGTGGCGACCCCTGAAGGGGA
AAGCTGCAAGGAAAAGAACAACTTTTTAAAATTCCTGCTTTTTTTAAATTTTGGATCAAC
AAAAATGACTTATTTTATTTTAATGCTAATTTAAGCCTCCTAGGCTACGTTCACACTGCA
GGGCTTAATGCTCAATTCGGATTTTTTGAAAAAAATCGGATTTGTTTGCTAAACCGTTCA
CATTTCCAAGTAAATCCGAACTTTTGTGATCTCCAGTGTGACCGTGACACGACCCAAACG
AGACCCGCATGCGCAGAAGCCAGAAGAATACTCAACGGTGAACGACGTCACTTGTTGTTT
GACGAGCAAACGTTAACATGGATGTCAACAACAGTGTTGTCAAAAGCGGAACTCTTTTTG
TAATATTAAATTTATTTTCACGAAGGAGCAGCACAATTACAATCTTCTCATTTTAAGAAG
GCAATGGAGTCGGGATCGTCTGTACCCACTGTTGTGGAAGAGGAATGTGTATGTGTTGGG
CCCGCGCGCCCGCGTGTTTGTGTGTGCAAGCGCGNNNNNNNNNNCCCCCCCCCGTTTTTT
TTTTGCCAACCCCCGCCCCCCAAAAAAAAAGGGGGGGGGGGGGGGGGCAGTGTGTGCGCG
CATTCATGTTGTGTGTTACGGATGACGGTAATAAAAGAAGGTTTCCCCCAGAATAAATGC
TATGGCTGTGTCCGAATTACCGCCCTAACCCCTAACTACTGAAACCCTATATAGTGCGGC
ACTATATAGTTCTCTATATAGTTCTCTGAATTTTCAAAGCAATTCGGACACCCGTGCTCA
CTAGTTTTCTCTTTCGGGTGTTTTCGAATGGCGCTTTGCACGAAAACAAAGTGGCGCATT
ACCGCCACCACCTGGTCTGGAGGGGTACTACTTCTATTTGACGCCGAGAATGACACCATT
TGTCAAAGTAAAAATATAATAAATATGAACATTTTATGAAGACTATTTATGAATCTGCTG
TTTTCTGATCATGGAAAACGTGGCTGATTTATAAATAATAAGATTACAAACACATTGGTG
TAGATTTTATGTATTTGCTGATAAATAAACCCTCATGTCATTAGTCCATGGCAATATTTA
TTTTTGTGCCGCTGAACGATTTACGGGCTCTTGCGAGGAAGCATTTTTTTTCTGTAGTTT
TATCTTCTACCTTACTGAAAATAGCTTTATATATGAATCTGTCCGTGTTCCTGGCAATAA
TTCAACCGTTTTTCGTGAGATCAAACCAAAAACGAGCAGATATGCACCATCACACAGCAA
GGAGGAGGAACAGACATCTCAGAAGATTTCCTCTGGATGCCCCTGACCAGACATGAACAA
CCTGTGAGTTAAACTTAAAGTTTTTTTATTAGTTCAATTTAAGCATTTGTTACTAATTGT
GCTCAAGGTTACACAGTCAGCTGGGTAAGAGTTTTTAACATTCTTTTTCAACACTGGACT
ATGAGTTGTATAGTCTAACTACATGAAACACTTGTGAGATCAAAGTTTAGTATTTTTTAT
TCAGAGTCAAACCATATCACTTGTTTTAAACAAAAATACTTTAATTTTTAAATATTTATA
TAAAAATCCAAAAACCCAGCCAAAAAAAAACCCACAAGATTTTCCAGCATTTATAAATAC
GTCATAAACTAAAATTTAAGACATCAGAATAAAATGAAACATTAAAAAAATATCAGATTA
AATTTTTCTCAATGAAATAATTATTTTTCTATTTTACAGGGTCTTCCACGTCTCTACTGC
TTTGCCAACATAAAGGTGTCTGTCGTGGCCCTTCACGCTGACGGTCAGTCCCACACAAGA
CCAGACCGGCAGACCTGCAAATCGGTTGACCCGCAGGACCATTGAGCATCTGGTGGAGCA
GCTTCGGGTTCCTCACACTCTGGGGGGGGGCACACAGGAGACTGAGGTCCTGGTGTTTCT
TTTCTGGCTGGCGTGTGGCGCATCTTACGGCGTGGTAACCAGGGCCTTTGACATGCCACG
GTCCACTGTGAGCGGCAGACCGCATCCTCCGGCTGATGAGCAGGGTCACCCAGCATCCAG
TGGGAATGAACTGCCATTAGTCACCTCTGGTTTTTTAGCAGCTCGCTTGTTCTTGCACCT
TCCAAAAGGTCGTCGGGAGCATTGATGGCTGCCACATAAGAATAAAGGCCCTAAAAGAAA
ATGCAGCTTGTTATTTTAACAGGAAACTTTTTATTCCATTCAACTGCAGGCTGTATGTGA
CTCTAATGCCAAATTTATAGATATTTTTGTTGGGAATCAAGGATCAGTCCACAGTTCACA
GGTTCTACGTAAAAGCCCAATTTATGTAAATAAAACATTACCCACCTGAAGGATCCTTTT
GGGTGATGGTGGGTATCCCTGCATTGCTCATCCCATCACGCTGCTGACACCCTACAGGGA
ACCCATGAGGAATGCGGTTCAGGCCCGTTTACACCAGCACCACNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGTGCATC
AGCAAAGGGGACTGCTGGGAGCCACAGATGTTGAACCACAGCAGGAACCAGTAGGACGGG
TAAAGTGGCGTCCGTCTGCGAGGACGAATCTCTGCTTTCCTTTTAGCTCCAACTGTGACA
CACATGACTCTAGAAGACCAGGATTATTGTTAAGATGTATAAAAATAAATGTTAACATAT
AAAACGAAAATGTAAATATGTACATTTGATATTTATATGAAAATTCTTTTGAGATTGTTA
AAAATGGCTCAGATTTAAATAATACATGTAAATAATTCATTTTTGTTCCTGCATTTATTA
AACAAATTGCAAAAACAACGACGACGTTACATTTTGTGAACAATATTTTAAACTCAGGTA
ACCTTAACAGACTCTCCTGTCACTCTTTGTCCCTTCGTGCTCTTTCCTCCTCTCCTCTTT
CAACAACAACCTTTACTCCAACATGACAACGATTACAGTTTAATGATAAATAAATACAAA
TCTGATCATCAAGTGTCTCTCACTCCCATCCGGCACGAGCTTGCCTGATAACAAACAGGC
TATCTTTCTCCATCCACAGATGGATCAGATTTTCCTTATCCTCGTCAGTCCCTACATATA
TAAACACATTTAAAAAATGTGTTAATAACTTATTACTACGGTTAGAACTCACTCATTTCT
TTATGTAATATCAACAGCGTTTGTTTTTAGCATTCGGCGCTAATTCGCGCTAGCGTTAGC
TTTAGCATTACCGAAATTGATGAGCTTCAAAACAATGTAGATAGTCGATTGAGGAATATA
ACATATTAAACACATCATCTTACGTATTTACAAATATATTTTACAACAGATACTTGATAC
TTTTAAATATACTTACATTTTTAAGTCCTCTATCTTGCGCAACCGTCCGCCATCTTCGAA
TAATTGAAACGCAGTGTATTGTGGGTCACACGCAATGCATTCTGGTATGAACGCAGTGCA
TTCTGGGCAATATTCGCCGATCAAGTGAGCATCGATCCACACTGGTTTTTCGTAGAGAAT
TCTGGGAAATTTCTAGTGCACATGATTTTTGAACTGTAGATTCGGACAGCACTACAAAAT
GGCGACCGCACTATATAGTGCACTATATAGGGGTTAGGGCGGTAATTCGGACACAGCCAT
GGACTCTTTATTAACCTGTTCTGGAGAATCTAAGGATCAGAACAGGGAGGAGGAGGGGGA
TCGCCTCGGGTCCCCTGCGCTTCTGAGCACGTCGGAAAGGGGAGAAAGAAAAAAAAGTTA
TCGCGGGAAAGGTTCAACACCACGCTCTGCCATTTAGCTGGAATTTTTTTCAAAAACCGC
CCAGCCCTGGAGTTTGGCCTGAATAGAGCGATTACCCCAACTATTAATCCAATCGGGGAT
CTCGCTTCCCTTCCACTGACTGATCTCAGCAGCATCGTCCACCATGGTTGATGTTTACGT
TGTCGTTCCCGCCTACTTCAACGCAAAATGATGACGTTTGTTGCGTGTCGATGACGTACG
ATTCGGAGTCAAGTCGCCTGGCCGGTCAGACGGCGGTCGCAATTGAAAAGAACGGCTACA
ATTCGGAATCAGGACGGCAAACCCACGGGGCCTGGGTCGCAATTGAAAAGATCGGAACTG
TGTCATTCAGACTGTCATGAAAAGATCGGAATTGGGCCGCTTAGGGGGAAAAAATTCGGA
ATTGGGTCGTTTCAGCCTGCAGTGTGAACGTAGCCCTAGTGTGTGGTCCTTCAAATGTTT
TTTAATGCTTTTTCTACAAATTCTAAATTGTATATGCCAAATAAATAAACCCGGTCTGGA
CTTGGCACCGTCCTCGCCAACCCAACTTCTATATGAAGACGAAGAAGCCTTAACTGAACT
TTAGAACAACCCCCACCAAAGGCAATTAACCCTTGTGCTATCTTAAATGACCCCACCCTT
ACATTGACGTGTTCTCCCTACCATGACAAAGGTGGATAAAGGTGGAAAGATTTCATGTAA
TCCATGGACACCAGTGAAGATCACAAATCATTGAAGAATAAAGGTTCAGAGCACTGTCTA
GTGGGTCTAGATCAGTGTTTTTCAACCAGTGTGCCGCGGCACACTAGTGTGCCGTGGGAG
ATGGCCAAGTGTGCCGTGGGAAATTGCCCTCATTAACTGATCTAAAAACATTTCCCATCT
CCAGGATTTTAGCTCTGTGTTCATCCAAACAGGCCCTGATAAAACACTGAGGAGTTAGGA
ATATGAAAGATCGTAAAATACCTTTTCTTTGCGTTTATTTTATTTTATTAAAGACATTTT
GATAAGAATGACGTACAGCGATTCAGCTGCACCTTCGGCTGTATTTTGGAAAAGTCCCGT
GTTGGGGGGGTTAATCACATGTCATCGGTCTGACCAATCAGAAGTGCTTAAAGTCTTCAC
TTCCTTGTCCCGATTTAGCTTGTAAAGTCGCTCAGTTCTAACAGAAATACCAGCTAAAGC
TCGTCTTTAGCGCTGTAGCTTTCCACAGAATCCGATGTCAGACCGTGGAACAAGTGAACA
AAACAATGAAGCTCCGAAAACTGATCTTCGGCCGTTTTATGCACTACATTTCCCATGATG
CATTGGGTTGTGAGAGTGACAGCGCAAAAGGAGATCTGTTGTTAAACGTCTTGAAACTAA
CGAACACACATCAAACTGTTTTTAAATCTTCTAACTTAACTTTTATTGAATCTTTTAGAA
AAAAACAGCTGCAGTTTCCAGCTTTTTCTGTAACAATTATCTCAAAAATGCATGTGAGAT
TGTGCAGGGGCTGTAGATCAATACAGACTATGAGTTTGTCCTTTTTTTTTAATTTTTGGA
TGCTGGTGTGCCGCGGGATTTTTTTTAAGGTTAAAGTGTGCCGTGGCTCAGAAAAGGTTG
AAAAACACTGGTCTAGATGACCCAACTCCCAATGTTAAAGTGCTAAGGATAGCACAAGGG
TTAAAGAGAGATCTCTTCTCCATGGTTGGAAGGGGGTGTAAACACACTGTGAAGCTCACA
CCATGCCAGGAAGTACAGGAAAAGAGAGAAGACACGCTTGTTAGCAAAGGACACAGCTAC
CAGGAGGGGTAACATAGTCCTGGGGACAAAAAGTCAGGTATACGTTTACACCAGAGCGCT
TTCCCTTTCTGTCTGGTTGGGTCTGTCCGTAGCCCCTGGCAGCGCTCACGCTCCAGGCTT
CCTGTCAAAATAGTCAACGTGACCTGGAAAAGACTGGACCCATGTGGTCCTCCCTTTGTC
CTGGACAGTAGCTGACATAGATCCCTTCACTGTGACTAAGGTGGAGCAAATTTTCTTCAG
TAGACATCGATGTTCACCTGTTCTGACCCCTATTGGGCCAGTTCTGCTCTGTGCTGACTC
TTCTACTCACTCGTCATTTCTCCTCTTTCTAAGATAAATTTAGATTTCTCAGTCATCTCT
TTGTACCTCAGAAGGAATTCAGGGGGTTCTGAAAATGAATGGATGAATGGATCTGTTTTT
GCAAGTTTGTAAACTGGAAGGGTTAAGCTGTGATGAGGGGATTTTTTTTGTTTTTTTTTA
CAGATTCTGGAGACAAAACACCTTAATTAAAACTTTTTTTTTACTCTATATTGATAAAGG
TTGTTCAGGGAGCCGGTTTAGCTCGTGCTGGTTTGCAGTGCCTTCCGTCTGTGAAACTAG
GGTTCAAATCCGGGCTGCTCCCTGTTCCCTTCTCTACCTCTGTGCCGGTCCCAAGCCTGG
TTGCTTTGAGAAGGTTGCATCAGGAAGGGCAGCCGGCATAAAACATTGCCAAGTTTGACA
TGCGACTCGTTCGCTGTGGCGACCCCTGATGGGAAAAGCCAAAAGAGGAAGAAGATTGAT
GAAGGTTATTCATTATTGTAGACACAGATGTTTAACTGTAAAGGGGGAGTTAAGGCCCGT
TCACACCGGGACGAATTTCGCCGGCGATTTTCGCCAACGTTTAACGCTTCGTGACTAAAC
AAAGGGCACCAATGAGAGTGTGCACACCGACGCGAAAAAACGCCACGCGTCAAAGCGTCA
AAAAAAAACGCCTCGGGTTCGTTTTTTTTTTCGACACGTCGCGTCGAAATCTATTCGACC
AATGAGAATGGCGCTTTTGCACACGTGTCTGGAGCTTCTGAAGTTACAGTAAAACACCAC
TTGGGGGCGCTCAAACACAAAACTGCCTTGCTGAGCACACATACCAGTGAAGAAGATAGA
CGCCAAGTAGCGTCAACACTGCCGCGAAGAAATAATGACGGACATTCTTAAATATCCCCT
TACCAAGTACCAGTTGGAGCTACTGGTGCTTGAAATATTCATGTCTTCTTTGTTTGATTC
TGACAAGCGTGTAAATACTTGCTCTCTTCTTCTGAGGGAAAAGCGACTTTAAGAAGCGTA
AAGTTGCGCAGCGCCACCTTCTATACAGGAGTATTTCTGTTTACATTAAGCGCCATCTAA
TGTCAGGGAATGAAATTGCATGTTCGCTCGGCTCATCGTCAGCGAAAATCGCCTTGGTGT
GAACACAAAAAACGTGGCGAAAAACGCTGGCGAATAACGCCTGGCGAATATTCGTCCCGG
TGTGTACGGGCCTTTAGGGTGTTAAAAAACATTTTAAACAAATTTACATTAATGCCCAGA
GGAATTGGCAAGAGAGATGAGCAGTGACAGGTTCTAATTAGCAAACCATTAAAAATAACT
GACTTAGGAACCAATGACTCAGATATGACCAAAAACTTACTTTGAAAGTTGAATACGGTC
CAATAACTTAAGAAACAACAGCGTCGCCAAACTGCAGGAAGTCTGGTAAGCAAATTCATA
TGATGGCAAAATGACTGAAGCTAACGACAAAGCTAAAAAGACAACGCTAACTCATCACTA
CGTTTGTCAAGAAGTTATGGAGACAGATGCAAAGGAACCAAGGAAAACAGAAAAAACAGA
GAGGGAAGAAGATACAGCCACTGCTCCAAAGAAAAGTGACTTGATTTTGGCAGCAGCTGA
AAATCTAAAAGAAATGATGGAAAACTCAGTGATGAAATGAAACAAAATGTGCTCTCCGTT
TCAAACAGTGCCAAAGCTGTTGAGTTAAACTGTGCTGAAATTAAAGAACGTAAGGAGAAG
TGTGAAGGGACGCAAATAGAGCTAAAGAAGCTCAAAAATGTGAATACTGAGCTAAACAGG
AAAGTTGTTGAAGTTGATGCTGAAGCTGCTGACTTGGAACAAATCAAAAGAAGGTGGAAT
CTGTGTCTCAACAGCTTAAAAGTGGAATAGAAAAAAAGTTTCAGACATCATCAGAAAGAA
AACGTTTGACCTGATCTTGGATACAGTGCATCACCTTGGACAGAGCAGCATCAATCGCCC
CAGACAAATCAGCATTCAGTTTACGAGAAGAGACTTCAGGGATAAACTATGATGCTCCAC
AAAAATAGACATCTGCAGTGAGCTCACCATTCGCTTTGCAGAGGATCTCAACGAGGAAGA
CAGAGAAACTAAACTTACTGTGTGGAACAATCTCGTAAGGCCAGAATGAAGAAAAAAGGA
TTTTATCAATGGCCAGAAAGTTATTCCTAAATTATAGCCTAAAAATATTTTGTGAGTTGT
CTTGATCTTGGTGGACTCAGGGATTTGCAGGGGATTTGGTTCTACAGGTTTGTTTACTTT
TTATTTACGTGTTTATTAGTGTTTTATGTCTCAGATGAAAAGTGCACTTTCTCTGATTTC
TTTAAATATAAGAAACTTAAGAGGAAAAGTTTATTTTTTATTTTTTATTTTTGTAAAAGG
AAGAACACCAATGCGTCTTTACTGACAGGGAACTTGCTCAAAAATTGAAAATTGTAACTT
CTGGTCAAAACATCGAGGAGATGAAGCTCATTTTCATCATGGCACCTTAAGGTCAGCAGG
GGTTACTATTTGGCTAAAAAGCCTTTATGGTCAGTTAATGTCCCATTACAAAGACCAACA
AGATCATTGGTTAATCCTTCCAGAAGTAACATTTTCAACTTACAATGTAATAATTGGGGG
TAACCTTAACATTGTTTAAAATAATAAAAGATTTCATGTAATCCATGGACACCAGTGAAG
ATCACAAATCCTTGAAGGAAAAAGGTTCAGAGCACTGTCTAGTGGGTCTAGATGACCCAA
CTCCCAATGTTAAAGTGCCTAGGATAGCACAAGGGTTACTAACGTCTGTAATAAACAAAA
CCTGGTATATGTGTGGCATCATCTCAACCCAGATACAAGTCAGTATTCATGGTTCAGCTC
TACTTAAAAATCGAGACTTGACAATTGACTTGTTGCAAGTGAAATATCAAGTACTGAAAT
ACACTCTGATATATCTGTTGCACCTCTGACTGATCACAGTCTTATTTATTCAATCCTAAA
ACAAAAAATCCAGGAAATCTAACTCTGATCTAGATTCCTCAATCAAAAAGTGAGAATTCT
TGAAATACAAAGTCAGGAACTTTACCATCTCATTTGGTAAAAAACCTAAAAAGAAACTTA
AAGAAAAAAAGCTCGATCTCCGGTTTCTATAAAAAGGAAACATATTTCGGAAAACAAAAG
TCATTTACAGAAAATAAAATTAAATGTTAAAAAACAAAACACAATTTAAAAAACCGAAAA
GGAAAGTATTATGGGATGTTTGCAGATTGGATGATGCCGTTTGTGCATCATTTCAGACGA
TATACTGGATATCATCCAGTGTCCAACCATTCCTATACCGGTTTCTCATTGTGTTTCATT
TTTCTAACATTTCATTTTGTTTACTGGAAGGTTTTTCTGATCTTTGGTTTTTACGTTTTA
GTGTCTGAAATTTTTTGAGCGGTGTTTTGATGTAATTTGCACTTCAGGGCCACCGTAACA
TACTCAACAGAATGCAGAATTCTCACAACTGGTTTATAATCAATTTGATTATGTGTTTAC
TTGTGTTGTGTTTACTTTTTAGTTGTCTGGTGCTCTCGCAGCGCATTTGTGGTGTTATTA
TAATTTCCAGCACTCTGATGCTACATGATTCCTACGCCAAACTCGTGTCAAAACCCTTTC
CTTTTTTAGGTTTGGCAAATTTGCTGCTCGACACTTACATGGTGCCTTTGTCAGTTCTCC
TTCCCCAACCCCTCTCTGCTTGGCCTCTGATTCATCCCAGCTGCTTCCACTCATCTCATC
TTGCTTTCAGACCTTCATAAGGAGCTCCAGGACCAGTATTCATCACCAGTTCATTGCCCC
AGATGGTGCTTAGTCTGGTCTTCTTAGTCTTCAAGTTCCATGTTTTTGCTCTTGCCTAAT
CAACCTTTGCCTTGTCTTCAGGATCACCAAAACCACGAGTGGATGCCAGAGGTTCCAGAC
AATCCAAGCAGTATTACATCACAGAAGCGTCTTACCTCGCCACGAAGCTTCGCCGAACCT
CCAGCCACGTTACGAGCCAATGCCGAACCTCCAACCTCGCCGACTTCCTGCTACGCCTCA
AAACAAAACACATCTGAGAAAATAAAACTCCTTACTTACCACTTCACTCAACTGTTGTCT
TCCTTCCTGGTTCCAGCGTCTGGGTCTGTCTAGCCTACCAAGTCATGACAGTCATGTTCA
TAAGCTTGATGCCCTGGCCACATGTGGGAGGAGCTACCATCATGGTTTTAGCCTGATCGC
TGCATGGCGTAGTGTCTGTGTTTATCTAATTTACTATGCATGGAAGACACAGATGATGTT
AAAAGATCTGGTTTATTTAATTAGAAAAGGTCTATTAAAGCATCGGTTCAAATGTCTGGG
TTCAAGAGATCATCCAGAGGCTCTTCCGGTACGGGGAACTTCATTCCTGCTGCAAAAGCT
GCAGCTGAATGACTGTTGCTTTCTCTGTGGTGTTTCTGGGTCTTTGAGTTGTTGTTCTGC
GTTAGTCCGAGAGGGGAAAAAGAAGATTAGAATTAGAGGATCATTTTATTATTGTCTCGA
GGAAATAGAGAAAATTATCACTAAGTTTTTTTTTTTTTTAAACAAATAAAGTGAGATGTA
TTTTATAATGATCTATGTGATGGTTCTGCAGCAAGTCATCTGCAAAAGGCCACAGAAGAC
TTTGAGCTTTGAGGCTCTAGGCTACTTTGTAGTGAAGCAATAGTTATCTGGGACACAACC
TTGAATTAAATCCAAATGTGTGGTTTACAGGAACATGATGGCTAAACTCCAAAATACATT
TAGTTTACAGGCAGGGACCAGAAGAAGCTGGAAGAAGCCCAAACCCTGACTGATTATGGA
GATTTCAGACTGGATCTTCCTCCAAACCCTTGGACCTTGATTCTCAAATGATCCACGTAC
TTTCCTTTCATCAGAAAACAAGACCGTAGATCACTGGCCAACAGTCCAGTCCTTCTAGTC
TTGGTCCAGTTGAGACGTTTCCTCCTTTTTTTCCAGGCTTAGAAGTTTCTTGACCAGAGG
AAACTGACAGTTGTAGTCCGTCTCCTGAATGTGTCTGAATGAGGTGGTTTTTTTAAGCTG
TTCTTCGACCTCATTCTACTCTTTCAAGAGTCCTGCAGGTTCTTCAATCTTGTCCTTTTG
ATGATCAGCTGAAGCCCACAGTTGCCACTGTTGCTGCTGCATCTTCTCCTGCCACATTTT
GCTCTTTCATTAGACTTTCTGTTGATCTGCTTGAACACAGAGCTCTGTGAACAGCCAGCC
GCCTTAGCTATAGGACCTTTAGTGGCTCATCCAGACTGTGGAGGTGATCAGTGATGGTCT
TCAGGCTGGTTGTTAAGTCTGTAGTCTTCTCCATTTTGAACCCAATTGAACCAGTTTAAG
GACATCTAGGGGAACCTGTGCAGGTGCTTTGAGTTTAATAGATGTAACCATCTTTGAGTG
GATGAAACTCAGATTAAAACATTCATGTCCAGCAGAATTTGGGCAGATTTCTCCAAAGTA
TTCACATTTTTTGAAATTTAGATTTTTGTGGATTTCATGATTTGGAATCCCAATTTATGT
CAAACTATACAAAGAAATACTTGAAATCAACTAAACAGTGAGCTCTGAATCTATAAACTA
TTGTAGTTTTGTTTTTAAAGGATACATGGAAATGAACAGTTTAATGTTGCCAGACATGAA
AAAGTTCTGTTCAGGTGCAGCGTGTTACCTTGTAATCCAGAAAATGATTTCATACAAATA
CTTATCGAGATCCTTGATTCTCCTCATCCTGGTAACAAGACTCCTCTTCAGCTTGATGAA
GATGTTAAAGTTCTCCCAGTACCCCTCCCCCCAGCTCTCCAGGTATCGTGCTTGTTTGAC
AAGATAATTTTGCTTTATCAGATGCTCATTGATGAAGACATTTGTTCTTTTCAGCTTGTT
TAACAGTGCAATCGTATGTTTCCGGTTAAAAAAAACTCATGAAAATGGCTTGTTTTTCCT
TCCTACTTTTCCTGGGCAGAATGTGACAATCCTCAATGCCATTACTGTCCAGCTGAACTA
ATTTCTCCCACTTGTTGCTCAATAGAGCTGATGTCATTGTCATCTGGTTCTCCTAGGCTG
TTGATGGTCACAGCACGCCTGTAGGACCGCGGTTAGATGCTTAGGCCGGTGACAATCACA
TCTGTATTGCTCCGGCTCCAATACCCTGCTTTCTAAAAATGCAATGTTTCGCTCCTGCTC
TTGTTTCTGGACCCAGAAAAACTCCACAGCTAGGTACAAAACTGCCTTCTGCTGCAATTT
CATAGCAGATACTTCCTCAGCCAGTTAAAAGTTTGTTAAAAGAAGCTTTCTCTTTCTTAA
AAGGGGGAAGACACTTTTTCTGTTTCCTCACTGGAGCTTTTCTGCACAAATTAACTTTCT
GAAGATGTTTGTTTTTGGTTAATTTAGCTGTAATTTAGCAGTCAGCCACTTTCAGAATTT
TTCTGTGGCCTAGTACCAAGTGACCCAAATGACTAAATAAATGCAAGGAAGGAAGCAAAA
TGAGACGTTGATAAAATGGTCAGTTAGGTTGGTAAAATCATGCTGAGGTTGGAGCTACCA
GGAAAGAAGCTCCAACCTGGAAGATCAAGGAGAAGATTGATGGATGTTGTTAAGGCAGTC
ATGCGGGTGAATGAACAGAAAGCAAAGAATAAGGTTGGAGGGAGGTGATTTTCTTTGGGG
AGCACTGAAGGGAAGAGCTGAAAGGTTAAGAAAGTACGATCATAACACAGCTTGAATAGG
TGATAGTTTTCCTATTGTTTAATAATAATTTTTGTTTTTTATGAATACAAGCTGTCTACA
TTGACTGCATTTCATCAAATTTTAAAAATGGAATAATTTATTCCGCTATTAAATCATTTA
AAAATGAAATGTGGGACTGCAAAAGTGGAATGACATCAGTGCTGAATGCATGTTGTACTC
ACACTAAGGTCATATTACTGTAGATAACATGTGCAGACTCTAACAGTATGTCAACAAGAC
AGTCCTTGAACTACCAAAAGGGTCGAGAACTTCAGCCATGGACTTTTTTTCATTCCAAAA
AGCATCTATTGCTTGTTCGCTGATCTGTTGAGACAGAAGTTCTGCTTGGCTTCAAATTCA
TCTGCAAACACTGATGTAGGTTACATGTTGTCACTGAGATCACCACATTAATATTAACAA
CCAGTATAAAAAAACAAAACAATGCTGGATAGCTGTTTTCTATGGATAGGTGTTTTTTAT
GGATAGTAATATTTATTTATAAAAATAGCTTTATTTTATTGAATGTAAGAAATGATGGAT
ATCTATTTATTTTTTTGTGGCTTCGTGCAAAGTCAGTATATAGTAGAGATGTAAAGGATA
AAGATACCTTAAAAATAATGATCGAGCACTCCGAGTAACAGCAGTAAAGGTTAGGAATGT
AACAGATAGAAACGTATTGAAAAATCAATAGAGTAACAATAGTGTTGATTGAAAACCACG
AATATTAAGAGGATTTTTTTGGTAAAAAGGTATAAAATCAACCAGAAAGTAAACAATCTC
CTTCTGTTAACCTTAGTCAGTTTCTCTTCCTGTTAAGTCTTTACTGTTTTGCCTTTTTAT
GCTATGTGATGCAAACGAAATGTATCCATTCCAGTAAAATAATTGGACTGTATCATATCG
CCACAAACCTAGTAGAATCTTTTATTCATGGAGCATTTATGGAGATAAATTCTATATCTT
GAAAGGTGCTATACAAATAAAGGTTATTATTATTATTATTATTATAGTGTATTTGCTACC
GACAGCAACACAAAAGAAGAGGCGCCGTCCAAACAAATGTGGAGATAAATCTGATCTTTC
TCCTCTTGAACTTTATGATATTTTTCTTATTTCCATAGAGACATTATTATTTTTACTTTT
ATTGTTTCCTTCCTTGGACTAATCCGGGTCAGAAAGTCATCAAGTCACAGAAAGACGGAA
GTACCGCTGAAGGCGACCATCATTTAGACACAGCTCTTGGATTAGATGGTGAAGCCACAG
ACAAAAAGGCTGAATGAAAAAAACCCAGACATGAAGATGTGTTTACTGATGCTTTTGTAG
AGCTCTTTAAAATAAATAAAGCTGATCTCTTAACGCTATACATGCTTTGTAAATGATATG
TACAGTCAAGTAGCAATGAGACTGAAAACTAGGGGTGTATTGTACACTGGTACAATGAGC
CCCAGGTAAATCTGTGTCTTGTCAAGACTCTGACGATACGATGCAATTCCCGATATATTC
AGAGATGGAAACAGAGACAATACAACTTAGATAAAACGTTGTCTAAATATGAATACACCT
CTCACATTAGTAATATTGTAAAATACATTTCATGTAATGATCAGAACATTAAACACTGCA
ACTGTATTTCATTTACAAGTTGCTTTTACCAAAGCAAATTCATGGTGGTTTTCTTTCAAT
AAGTTAAGAAATGTTTTTTCAACAGTCAATGTTGTCTGATTTTCAATGCAAAATATTTTT
CTGTATAGGAAACCCTTCAAGGATTAAATATGCATAAGACTATGGTCTCGTATCTCAAAA
TACCACAGCGCAGCAGCCTAAAGGCAAGTTTTTCAGCAAATACAGCGGGTGGCAGCACGG
CAACATTTGTAATCGGGAGGTGGCAGTCGCATTTTTACACGCCGCATGGCAGCTGCAGAG
ATTTTAGAAAGTTAAAATCTTACGGTGACTAGACAATTTTTTGACAGTGGCCGCCTGTGG
AGGTCATGCAGGGGCAATCCAGTGACAGGGGGTGGCAGGAGGGCAGTAGTGTGATAATTG
ACCAGTAGGAGGGTCTCCAAGGTCCCCAAAATCGTCTGATGATCGCCCATTTCAGACTGC
CCCCCTCCAGCCACCCCCCTGCCCCCCATGCTGCCACCTCACTGAAGGTTCGCCGCAGCA
AGACGGGGTAAATGTGTGTGAAGTATCTTAGGTCAACAGTCCAGAGTAATGGAGAGTGTG
GGAAAAAGTGAAGAAGCAGGTTGGAATGGTTGGAGAAAAGTGTCAGGTGTGATGTTTGAT
ACAATTTTTCAGCTCAAATAAAAGGAAAGGTGTAGAAAACTGTGGTGAGAACAGCCATGT
TATTGGGCCCAGAGACAGTGGTACTGAGGAAAAGACGGGACGCAGAGCTGGAGGCTGCAG
AGAGGAAGATGCTGAGGTTCTCCTTGGAAGGACCAGGATGGATCAGGACTGAGGACATCA
GAGGGACAGCACATGTTAGAGGTTTCGGAGATAAAGTCTGAGAGGCCAGACTGGGATGGT
TTGGAGATTTCCAGAGGAGAGACAGTGAATCTATTGGTAGAAGGATGCTGAGTCTAGAGC
TGCCTGGCAAGAGGTCTAGAGGAAGACCAAAGAGGAGGTTTTTGGATGCAATGAAGGAAG
ACATGAAGGTAGCTGCTGTTAGAGAAGATAGGGTTAGATGGGGCAAGTTGAGGTGCTCTT
GTGACCCCTGAAAGGAAAAGAGGAAGTTTATGCAGAATACATTTGAACAAGAGAGACTTG
TACTTATCATTGCACATGAGAAGAGCAGCTAGAAAGCAGTCACTATTGAACAAAGAAACA
CTGTTTAAAGAAAGTGTTGTGCAAGTAAAGAAATCTTTTTGACCTTGCATTTCTACATTC
TGAATGCAGTCTGGCCTTCCTTTTTGCACTGAGGGTACAAAAAATATTATCTACAGTTTT
GCCAACATCCTCTTCTCTCCCACAAGGTTAAGAGTCCAGGGGGCAGCCCAGGACAGAGAA
CACGATTTACGTGGAAAATGGAATCATTGACAAGAGTGATTGTTTACTAAAATAAGATCA
GCCCAAACTTGCCACGTGACAGTTGACTATATAAAACAACTGTCTCCCTGAGTGCATTTA
GACTGCAGGCATGAATCTTTGGGCTGTCCTGACGGTTACACTCTGTGGCATACTGCCCAC
GGGGGCAGAGGTTGTTAATACTTTCATCTATTGTTCTGAGTACTTTTACAAGGGGAAACA
TCCTCTAGGCTTTGATCAAAATGCAAAACAAATATGTCAAAAGACATTTTATAGTGGGTA
TTACTTTGCATCGCTGTACTCCACAGTCCATAGGATCCCCCTGTACAGCGCCTACACATT
TAGCTTTGCCTGCAACAACCAGGAAGGACGTAAAAGTGGAAACTGGTACATTGAGCCCCA
GGTAAATCCTCCTCTTTACAATAGTATATGTAAAATTGAGCAAAGATGGACTATGTTTTA
CTGATGCAAATATGTTATCTATCAAAGTTTAGTTTAGTTTATTATGATTTTTAATGCATT
GATTTGTGACATCTCGCATCAATAAGAAAATGTATGAAAATGAGAACAGATTTCAGATCA
AATACAACATATTCTCTATTTTATACATTTTTTTGGTATGATTGCTGTTGCTAAGAATTT
TATTCTTCAAACCTTCTGATTTTTTTTTTCTTTTTAACACAACCTTTGTATTTGGGAAGA
TCTGAGGTGAAATGTGTCTTTCATTTTGATTATTCAAATAATATAATTCAATACAGTTGT
AATAATAAATGTTAAATGTACACCAAAAAAAGTAAACATAGAAAACACCATTTAACTTTA
ACATTCTAAAACAAATCTAGTTTTAATTGTTTTACAATTTCCAATTTTTATGGATCAAGC
ACATGTTTATGTTTCTACATTGTTTATAAATTTGTCTTTATCTAGACACTGAAGATTAGG
GTGATAAAGTGTCACAATGCACATGTCACCTACAAGATTTCACTGAACAATTATCAATAC
AGAACCAATAATGGTTTCTCTAATGGTGCATTTAATCATTTCAATTTCAATTCAGTAAAA
ACTCTTCCTTTTTGCATGTAAACTGCAGATTTCTTATCTCCACACAACTACACACATTAC
AAGGATCTGAAGTTATTTACAGACATCTGAAGAAGCAGCCATTCAACAATTTGTCTTTTC
ATTTCGTGTGACATATCTTTTTTTAAAAATATTTGCTCCATTCTTTGTTCTGTTTTAAAA
TAGAAAAAGCGAGAACTTCTATGAATCCAGGGATTAGTTTAAAAAAAGTTTTTTGACTGA
TCAAAAGGCAAATGTTTTCTCAGAAAAAGACCACAATTAATTTATTTTCTTTACTTTACC
GACCATAACAGTATTCAATGAAAACAGAGTTTGTTTCCTGCAGATACTTTTTGAAAGTGG
GTCTTTGAGCAACAACACTGATGCTGTGAGATAAAAAATAAAGCTTTTAAATGACCCTTA
TGTTATGGGATATAAACAAAGCACCTTGTCAAAACGTTTGTGAAAATAAGTGAAGCATTT
TGTCAAATAATACTTATTTAAGTCTAATAACAACAGAGGATAACCTGATTTTTGATGTCT
CTTTCCCTCAGCTCTCACAAGATGAAGACCCTAACTATGCAACCATGCCTTACATGAAGT
CATATACTGCAAGGGATTCAGGCAACATCAAAGTCAAACAATCCATTGATGAAGACTACA
AACACACTGGCTATGACAGAGGTCACTTGAACCCCAACAGCTTTCAGTGTAATGACGGGC
GTGGGGCCACCTTCACCCTCACTAACGCTGTTCCCATGGATGCCTGCTTCAACCGAGTCC
ATTGGAAAGACTGGGAGGCTGAAGTGATAGCAATTTTGAGGCAACAAGATCGAACAGGAA
CTGCTTACCTGGTGACAGGGGCTGTACCATCTTCCAATGTACTTGAGAAAATACCAAAGC
AGGGAATTTTTGATGATGATGATGACCGAGACTTCAACAGAGTAACAGTACCAACACATA
TTTGGACAGCAGTGTGTTACATCCATCCAACGAATGAGGAGGAGTCATTCTCTTTTGGCT
ACATAGGGTTAAATAAACCACATGGCAGCATTCATGTCAAGAAAATAACTGATCTGACAA
ACCATTTGTCTACCCTTTACGTCAGCAACAACTTGAAGATTTTTGAAGATGACTGCACCT
TTTCAAACCAAAAGCGGAAATCTGAGACAGTGATAAAAAAACTCGGTAGGAGAATTCAGC
TGCCAATGGGCAACCGCCTCACCATGACTCCAGATGTAATGAACACTTTGCATGCCGCTA
TGAGTCTCTCTGATGATGAGACTGTAACATACCCTGCAAAAAGAGGAAGGATAACTGATC
TCAAAGTAGATTTCATTTACAACAACGTACAAACATGGCTACGGGGGATGGAGGCAATGA
AACTAACTTTTGGACTTGCCTGCGTGCTTTCTACACCCTTTGCTGGACGTGTGAGGGATG
AGCTGCGGCGCAAAAGGCAAACGTCTGAGGAACTCGTCTGCAGAATTGCACCTGAGGTTT
TAGATAGTTGTGCCACCTCCTGCCTGTTCAATGAAATAGCTAGAGACTACTACTGTTCCA
CTGGGACCATGACTGTAAGATGTTCACCAACATACTCAGATATAGCAGTAAACGGAGAGA
GGTGTAAGAGCGACCACACTTGTGGCCATCATGGCTCGTATGACTATTACTGGTGCAACA
CCGAGAGCAGCTGGCAATACTGCAGTCCTCCACTGCCTCTAGGGAAAACAGACAAAGGAA
AATTTTGCAGTTCTAAGCGCAACTGTGCTAAATATGGGTATTCTTACTACTGGTGTGACC
TTGATGATGGTAGTTGGCAATACTGTACCAGATAGTTTCTCTGGTTTGGCATTAATAAGA
GACATGAGTTTAAGTTACCATGGATATATTCTGTATTTGTGTTATTTCTTTACAGTGTAT
AAAGATTATCCACGATTACTTTATAGCTCAGTCTTTGGCTTCATGTTTGTAACTTTGTTT
ACATAAAGTAAATGGATGCCTGAATGAAACTGTCAAAAAGAACGATATGCATCAAGACAA
AGTTGTGCACAAATTTGAATGCAACATTAGTTTTACGTTAAACTTTTCTGTTTTGAATAA
GATTTGTCTTTGTTTTGAACCCGACTTTGGACTGTCAAAGATATGTCACAGGGTCACAGG
CATATACATAGAGTCCTGAAACATTGATACAGCAAAATGAGTATGTGTATTGAGTCTCAC
TTATTAAACAAAACTGGAAAAGAACATTTTATGTCTATTTTATGATATCAGTTGTCTACA
TTTACACAACATTTTTAAAAGTAATGCTAAAGAAATTAAAACCAAAAGGATAAGGACTGT
TCCTCAGTGCCTGATTGTTCTCCATTACGGAGGCGTCTTTTTTTTTCTGACTCTCGATCT
CTAGTTGTGGTCAGATGCATGATGCAACCTTTGCCAAATCGATATTTAGTGACTCGATAT
AAATGCCTGTGAACCTGTGACTCATTTTTGACAATAATCTAACAGGAGAAATTTGGTATG
GGAAATGTGTAGGGACAGCTACACAAGTGTCACAGCTAGGGACACTTTAGAATCATCTCA
CTACCTTAGAAGCATGTTTTTGGACTACGAGAGGTAGTTAGAGTGCCCACTCATGCACAG
AAAAAACCCAGCTGGGATTTGAACCAGGGCCTTTTTGCTGCAAGCTGAGAGCGCTGAACA
CTTCGCCATTATACAACCTGTGCAAAAGTCATGTAAAAAATAAAGCTTGAAGGCAGACCA
TGTTTGTGGAGTTCTGTGATAAGTACTTTTCTCTCAAAGTTTTCAAATTGTCAGCTGCTT
TAACGAGCAAATTTTGGCACATTGAGTTATTTTAAAATCTTAATTCAAGATCTCTTTAAC
TAATTGTCTTGTTGTGTTACATGATTAAGCAGAAATGCACAACACTAGACCAGCAAGCAA
TACCCTAGTTAGGATATCCAGGGGATCATTGGAGGACGTAGTTGGCAGTTTGGGGGCCCC
AGGCCAACGATAACGTAGGGGCCATTTAACTTCCTTACTGGTCCACTTTCAGGAAAACGT
CAGTGTCAAGAATCCAAATGTTTTGATAAGAAATTAAAAAAGGAAATCCCTTTAAAAAGA
GTCATGTACCACCAGATCTAACAAAAAAGGTTAAGCAGTAATTAATCATCCATTATTTAT
TACTTCGTGATTTGATTGAAAGTCCAGGTTTTACATATTTTAATGATATTACATCGACCA
TGTTTGCAGTCAGTCAGAGAAAAACAAAGAAGAATGGATTCCTATTGAACTTTACTAACA
ACCACTGATGTTTTGGTCAAATATTAAGATCAATAAAAAAAGAAACACTATAGAACTTCT
AGTTTAGCTTATTAGCCTTTCATGAACAATTGTGGAAATTGTTTTTTTTATTTCACTCTT
CTTTTATTTAGGTGAGATAAAAGAAAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTG
GGGGGGGGGGGGGTCACATCTGTTTCATCTTTACTGTTAAATAGATCTACACAGAAAGGA
TTTCTATTTTGAAATTATGCTTTCTTACCTTATTAGTCCATCAAAAAGATAGTAAATGTG
CACCTACTTTTACTCTAAAAGCAAAAGGCACTGGGTCCCATTCAAAGAGTCTTTGGTGTT
ACTTGGCCTGGACTTGAGCTCACGCCCTTCACAGTCTCAGGGTGGACACTCTACTACAAG
GCCACTGGCAGAGCTAGATGACATTATATGGCATGGCAGGAGGGGGGCAGAAGTTTGGAA
GAAGAGCAGAGGGGAAGGCCACTACAAATGAAAGGATCAAAAACACGCATTTCAAACATT
AATATCAAAACAGCAGTTCTTTTAGTTGAAGTGCTGTTTGTAATGATTAAAGAAGCTTGT
ATTGATGATTTCTTAACTCTATGAAACCTGAATTTATTTTCCAATTATAAAAAAAAGATG
TTTTCATATCCTAGTAAATGCTAAATAAAGTTATGATGGTACATTTGACCAGAGTACATC
AAATAGATATAATTTTAGGTTTGTCGCTAATCTGCAACAAGCAACATCTACCATATGATT
GAAAGAAAACAGTTTCCATCTCCAGTATGAAGAGATTTTTATTCATGCAACAGTTATTTT
GTTAGTATTTTCACTTTAATGACTGACACGGTGTAATAGTTATCATTAGTTCTAATAAAA
CACGAACTAAAAAATAAAAAGAAAGCACACAAAGCTATNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTTACACCAATAAGCGTCAAAGTTCTTGTTATTTTTTTA
TTTTATATCAATTACAAAAAAGTTTGATCTTAATGTACAAAAAAGGATGAGGATTATGTT
ATAAATCTATATTTAATTTTATCATATGTTACTATTTATTTTCCCTCTGTTAAATTTACT
TGTCCATTTTAATTAAAGAAAGAGTATTATGGAAGTGTATTGCATTCAATTAAAATAAAG
GGCAACCTTTTTGCCCATTAAAAAAACAAAAAAAGAAGGAAAAACAAAACAACGGGTGAT
CTTTGTTCAAATGTTTTCCATAATTTTTGTTCCAAAATTTCCAGAACTATATAAGCAATG
AACTCCAAACAGGCAGGACTCTAACCTCATCTACTCATAAAAACTAGAAGATGAGCTGCA
ATTAAATGATGAAGAGCCGTGGCTCACATTTTTAAAGACCCCAGCATGTTTATGGAGTTT
CCTTTTTACAAACAAGATCCAAATAATCAAAAATCTTTATCAACACCATTTGAATTACAT
GTGAAATAAATAAAAAATAAAGTTTTAACCAATCCTAAAATAGACGGATGTTTTAGTCAT
ATTTATTCATAAAAGTTCCTCACTATACAAATAAGAAAAAAAAAACACACAGCAGCTCGA
ATACAACATGGGAATTAGTTTGCTAACTTAAAAAATGTTGGTATCCACGGTGACCAGATT
ATATTTTTACACAGAATTGAATAGACTAGAATCTATATCTTCTATGCCGTTCTTTTCTGT
AAAAGTCTGGATTGAATTTGTTATCTGACAAACTGTTGGTTGCCACGGCAACCACATTTT
ATTTTGATTCAAGGAATCAGTTCTCAGAAACCTCACTTTGTGCTGAGACTTCGCTGAAGA
CGGTACAAAAGCGACTTGAGAGATTTATTTTCCGAGTTTCTGAAGGAAGCCATACAGACC
TGAAAGGTGAGTTTAGAGCTTTTTTCTTTCTGTATCTTTTCTTTAGGAACACGGTCGTTT
CTGTGCATTTAGCTCAGATAATGTTAGCATCCACACCAGACACATTTTGTCATTATTTTG
ATATTATAACACATTAACTTAATGATCTTAACTTTACATATCAGGTCGATCATTAATAAG
TTCAAGAGCTTTTATTCCTCTATTTTTGCTAAACCTTTTTTAAAGGACGAGACTGTAGAG
AAGAAGGTAACGTTTGCATGTTTATGTGGATGAAAATAGTTGTTAAAAATGAGAAACGTT
TGATAATTCTGTACTTTTCTTCACTTTCGCATGGTAATCTTTCCAGATGTTTCCAGTTCC
TCGTCATCTCCAGGACCACAGCTACTGCAGGAGGCCGGGGCAGAAGGTAAACAGACATCT
GCTGTTGAGAAAAGGGCAGAAATGATGCTGAATGTTACTAAACCAGTCCCAGAATCTCCA
TGTTATGTACTGGATCTCACTGTAAGTTAGTGCATGTTAGATCTTTAGGATTTGTCTGGA
AGAACAGCTGTTTTTGAACGGCTGTAGGTTGGAAAAGTCCATGAAAGATGATTGTCTCAT
TTCTCAGCACAGGTTTCTGTCAGTCAGGTTGTGTTTGATTGGAAGCAGCTCTGATGTTTG
ACCTTTTCTAGTTCATGTTCTGCTGGCAGACGATCCTGCAGACGTTTATTTGTCTGCAGT
CTGCGTTTCACTTGCTAATCAGTGACTGTGTGGCGTTTTCCTTCAACAATTAGAGGTCAA
GACATGAGAAGTCCTGACTGACGTGTCCCACATGTCTGTCATCTGTTTCAGTGTTTCTTG
GTTGATGGCAGCTGGGAGACAACACTGCCATCTAGCTGACTCATTTTTGATTCATTAGAT
CAAACATGGAATCATTTGTCTGAAATTCCAGTGATCCGTGTGATTAATTAGACGAGATTC
CCAAACCCTCTGACATCCAGATCTGTCTGTTTTCCAGAGACGGCGAAAGCAGCAGGACAG
CAGCTCTGGAAGGGAAGACGAGCCTCCAGACAGACAGCCGCGTCTGAGTGCTGCTGCTCC
ACAGCCAGATGTGAGCATTCCAGATGTTTGTGGAAGAGTTCCTTTGCTTTGAAAAGAAAC
AGAACTGTGGTGCCACACAGGCCTCCACCTGCTGCAGGTGTGGTGAAGGTAAAGATGCAG
CTGAAGGGTTTTCTGACTCCCGCTCCTCTGTCTGTCAAAGGTCCCGCCTCCGATCCTCCA
GGAGCCCGAGGAGAGCGTTCAGCCCGCCGCTCCCCAATCTCCGCCGATGCCTGACTCTGT
TGCACGGGCCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCG
CAAGGAATTGTGGGATACCATTCCCTTTGCCTGTCTGGACGCTGTGGAGTTTAAGTGTGG
GTTTTTGACCAAATGTGTTTTTGGTTGTTTAGCTGTTTTACTCTGTTTTACTGAGTTATT
TGTCCTGCTATGTTTAATTCTTTCTGCACCCTGAGTGAGATGGACGGAGAGAATGATGAC
ATTATATTGTAACTCCTACTGTATTCTGGAGCAATGAAAATGTCAGATGTGATTAAAGCT
GTCATATTGCTAATTTGTTTTGTTTCAATCAAATTATTGTTATGGAAATGAGAAAATCTG
CAGCTTAACTTAGACATATGAGAGTTCAAGAAGTACAATAAATTAATATGGAAAAACATT
TAATTGAATTGGAGAAAAATTACATTTACATATATAAATATGTAAATTTGAGTTGTAAAA
ACAACTATTTAGTTGGATAGACATTAGTCTGAATTAAATTTAACTCAAGTAATTTAACTT
AATTACTTGTTACCAAATAAGTAACTGTAAACAAGAAAAGTATATTTATGTACACCCCTT
TTACGCCCATAAAAAAAGTAAAAGTTTCTGCTTCAAGAAAAAGAACGGACAAAGTAAACG
CATTCGTTTCTGATCTTATTTCCGATTACATTGTGATGTATATGTACATATACAACGTAT
AAAACTTAAATGAATTCATTCAATTGGTAACATGTAATTGAGTTAAATTTATTAAACCTA
ATTTCTTGTCTCTCCAACTCCATAGCTGTTTCTTCTTTCTCTTTCGGCTTTTCCCATCAG
GGGTCGCCACAGCGAATCATCCTTTTCCACCTCACTCTATCATGAACATCTTCTACCCTA
ACGTTAGCCAACTTCATGTCCTCTGTTAAGACATCCATATATCTCCTCTTTGGCCGTCCT
CTTGCCCTCCGGCCAGGCAGCTCCATCTCCAACATCCTTCTACCAATATATCCACTATCC
CTCCTCTGAACATGTCCAAACCATCTCAGTCTGGCTTCTCTGACTTTGTCGCTAACACAG
GCAACATGGGCCGTCCCTCTGATGTACTCGTTCCTTATCCTGTCTAACCTGGTCACTCCT
AAGGAGAACCTCAACATCTTCATCTCTGCTACCTCCATCTCAGCCTCTTGTCTTTGTCTC
ACTGCTACCGTCTCTAACCCATAGAGCAGAGCTGGTCTCACCACTGTCTTGTACACCTTT
CCTTTGAGTCTTGCTGANNNNNNNNNNGCACACACAAACTCACTTTTTACATTTCACTTT
TTTTTAATTACCTTTTGTTTTTTTAAGTCCTTTAGCAGAATGAAGACGACATTTAACTTT
TTTCACTTTGAGTTTTTTAGGTTTTTTTTTAAAAAAAAAAACATCCAGCTTAGTTTCTTT
CTTTTACCTATTTCATTTTCCTTTTACAAGTGAAAAAAGTTTTTTGTCCTTTTTTTTATC
TTATTTTTTTTGTTTCATTGTTTCCATTTTATTCTTTGAGTTTTTAGTTTGTAAATTGCC
TTTCATACCTTAAAAAGTAAGTTTTTTTCCCTTTGTAAAAGTTAAAATAATTTCAATTAG
TTTCCTCCTTTTTTCAATGTGAACTTTTATTTACAAAATAATAATTACCTTTTCAAACTA
CTTCTCCATTTTTTTGAGCAGCAGAAACACAAACCCCTTTCTCTAAAAATCAGTAAGTTT
AACTTAAATTAGTCTTTAACTTTTAGCAACTTGTGTGAAATAACAAACAAAAACAACAAA
AATGACAAATTCTTTTTTCAATTAAAGGATCATCTTCAGGATTAAGGTGAGTCAAACTTG
AATGATTTACACAGATTGGTTACAGGATTACAGAATAACATCTTTGTTTTGTTATTTTAG
ATGTTTTTTTGCATTTAAATGACTACCATGATATTTTTTAACCATTTGTTGTTGTTTATG
TTTACTGTTTGGAATGAGACTAACCAAGTCGTGGTGAGTAGAAACACTGTTTCTTTCAGC
CTTTTCATTGCAAACGTTTAGCTCTTATTTTGAAATGGTTTTGCTGTTATTGTAATTATA
ATAATTAAGGGGATATTTTGTGATTTTTTTTTCTTGTCCTCGGTGTTGGTGAAGAGAACA
CCAACACTAAACTCCATCTCCATCTCAGAAACACGCTGTAAGTACGGCAGCCTTTATTTT
GAAATCCCTACAGACTCAAAGACGCAGATAGTTCCAATTTTCTAATGAATGAGAGTTTTG
CTTCAGGCTGGAGGATGGATGGAGTTCCCAAAGGCCTCATCAATCAGAATCTGGATCCCA
GACATGGGGAGCTCCAGTTTAGAGAATCGCCATTCTATTTCTGCTTCATGATTGTAAAAC
ATTTCAAGATGCAGAGATGACTTTTCCTTTTCTAACTTGTTCTCCGTCTCCACAGGACTG
AGCCTCCAGCAGAACAGTGCAGACCAGCTGGAGTCTGTTTGTGTGCAGAGGAGCAGCGTT
CTTCAGGATGACCAAGGGGGTTTTCCAGAAAGCAGGTTATGTGAGTTACCACGGTAAGTT
TGAGGCTAAGGAAGTTGATAACCTCAGCTTTCGGTTCCAGAAATGGAGGTATGTTTCAGG
GTATGTCAAGTTGCCATAGCAACTCATGCTCTGAACATAACCTGGTCTAGAGCAGGTTTA
GTTGAAGGTTAGTTTGTTTTCAGAGAGAGGTGAAGCAGCATGGCGTGTCCATTTGTAGAT
GATTTAGTGGATGAAGACGCTCAGATAATACTTTTTCCACCGTGAGAGGGTGATAAGACC
ATGTATGGATGTTGGAAAAATAATCTTTTATACATTAATCTAACTTAATTATTTGCTTCA
GTTAAGATAAATCATTTTTTTGATAAGTTAGCTTAAGAATAACACGTAGTTTTCAGACAT
TTATTTTACTTTCATTCAAATTAATTAAATGAAGTAGGTGTAACTTTGGTGCTGCTGTTA
GATCGGCACCGCAAGGAATTGTGGGATACCATTCCCTTTGCCTGTCTGGACGCTGTGGAG
TTTAAGTGTGGGTTTTTGACCAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGACTGCAGGGTTTTAATGGCATTATAGGGTAAAGATTGCAGACGATGC
TGTACCTTTAGTTAGCTGTCACGTCTTCAGGACATTAAGGACTGGTTGGCCCAATGCTTT
TTGAGTTTTAATCAAAGAAAACTGAAGTTTTAGTTTTTGGACCATTGTGGTGAAGACAGT
CCTGAGTCAGAAAGCAAAACTCCCGTCATGGGACTGGGTCATGACTGAAAGGAGGTCCCA
GATACAAGCTTCCTCCTTAGGGTGGCTAGGCGCTCCCTTAGAGATGGGGTTCACCCAAAG
AGAGCTTGGACTACAGCCGCTGCTCCTCCATATCTAGAGGAGCCAGATGAGGTGGCTCTT
GCATCTGGTCTGGAGGCCTCCTGGACGCCTCACTAGAGAGGTGTTACGGGTGTTTCTCAC
TGGACGTAGGCCTCGGGGAAGACCCAGGACATACTGGAGAGACTACGTCTGTCAGCTGGC
CGGGAAACGCCCCAGAGGAGCTGGAGCAAGTGGCCAAGGAGACGGAGGTCTGGGAATCTT
TGCTTAGACTGCTGCCCCCGTGACTTGGTCCTGGATGAGCGGAAGAAGGATGGATGGATA
TGTCCTTACTAGATGAATGCCACAAAAAGTTGTTACTAAAACACCATTTTACATTTAAAG
TTGATCTCTTGAATGTAAAACTGAAAGACTTGAAGGTGACTTTAGCAATGATGTCTTGTG
TCTTGAAGGTCTTCAGAGCTGGTCTACAGTCTGGGATCCGTCTGCAGAGTTCCAGCGCTG
CTACAGCCAAAGCAGCAGCAGCCTCCAGCAGCAATGCAGGATCTCTTGGGTTTTCTTTTG
GTAAGTTGGCTTTAGAACATAATGTAAAACTAAAAGGTGGCAGTAAAAAACAATGCCTCC
TATGCTACTAGCCATGTATTGATTTTGAATAATAGCTGAGCTTAGTGGCTGTTGGGTTCA
GTTTTATCGGCATTTGGAGCGGATCAAGTCATTGTAATGCGACTGTACTGAAGCATTTCT
CGCCTTGATTCCTCCTTCAGAGCTGACGGATCAGCAGAAAGAGTTCCAGCAGCTGGCCAG
AAAGTTTGCACGTGAGGAGATGATCCCTGTTGCAGCTGCTTATGACAGAAGCGGTGAAGT
GAGTTAAGAAAAGATGAGACTGAAAACTATATGCCCAAATTCAGTTTAACATGCTAATTT
GGTAAATGCTGAACAGTTGATATTTAATGTATTGGGTGTAATTCTGGATGTTTTTGCAGT
ATCCATTCCCTATCATCAAGAAAGCTTGGGAGCTTGGACTCATCAATGGTCACATTCCAC
AGGAATACGGTACTCCTCCTGTTTTTGTTAACTACCCAACCCATGTAGTCATGAAGTAAT
GATGTGAGGGACATTTAACTGTAAAACAAAAGTAAAAACAAAAGATTTAATCTAATCAGC
ATTTGAGGTCCAGATGAAAGCTCTCTGATAGAAGCTGTTGTGTGTCCTTCATTGTCAGGT
GGAATGGGCTTATCCATCTTTGACAGCTGCCTCATCACAGAGGAGCTGGCTTACGCCTGC
ACAGGGATGCAGACTGCTATGGAGGCCAATTCTCTGGGAGTACGTCTGTCTTGTTTTAGA
ACATTTTCTCTACCGTTCGTTTGGCTGTAACTTTGATTCCTGCTCAGTCAAACAGATATT
TTACTTCACTGTCGTTTGAAGGGAACTTGTCTTGCAACAGTGGCCAAATACAACTAAAAA
CTACTTCATTTCAGTTTTACCTGTAAAAAGTAGGTCCTCTGGACCCAGACGCCTGCTTTT
TCTCATTGTTCTTGTAGGAATGAAAGAAACAAACTTTACCCTACCCACATGGATGTGTGA
TCCAGGCTCTTGGCTATATTTTATGTCTGGGCTCAAAACACGTTTAATTCCCTCAAAGTT
AACCCGCTGTTTGTCCTGTCTCTCAGCAAATGCCCGTCATTATTGCTGGCAATGACGCAC
AAAAAAAGAAATATCTTGGGAGGATGACGGAGGAGCCTCTAATGTGTGTAAGTCTTTGTC
ACTTTGACTCAAGGCTGCAATGAACTTTGACCATTGACGACACATGTGTGTTTTTGAATA
CATTTTTTTACATTTCTGACTGTCCGGCTGAAACCGGCTTTCCTTCTGTTCCCGCCTTCC
AGGCGTACTGCGTCACGGAGCCTGGAGCGGGCTCTGATGTGGCTAACATCAAGACCCGAG
CTGTGAGGGTGGGTGACGACTACGTCGTTAACGGCCAAAAGATGTGGATCACCAATGGAG
GGAAAGCCAACTGGTGCGTTTTCCTACTGCTACTGTTGGCTTGAGAGCTCATGCACACAA
AGAGACAGAGCTTTACGCTGCTTCAACAGAAAAGATGGAGCATAGCATTTACTTTTATTC
TTTAGAATTTCCACTTTAGAGGACTTGAAGTTTTTTTTTGTTTTTTCTCCAGGTACTTCC
TCCTGGCCCGCACAAACCTAGATCCCAAATGTCCAGCAGGTAAAGCTTTTACTGGTTTCA
TCGTAGATGCAGACACTCCAGGAATTCAAGTTGGAAGGAAGGTGAGGAGATATTGATATG
TAAATGTTACAGGAATTCTGTTCTACATGGAAGCTTTCAGTGAGAACTAGAGAAACATAC
CATCCTTTGAGTTTATTATCAGATAAAATGAACTAAATGTCTCCATTTGCAGCTAGAACT
GAATGTTCTACCTGTGTGCTGAGATTTAGATTTACTTCCTGGGTTTTATGCAAATTCCGT
CTAATATTTGATCAGTTTTATGATGTTTGCTGCGTGTTTGCTGTCTGCCTGCAGGAGATG
AACATGGGCCAGAGGTGCTCTGACACCAGAGGCATCACCTTTGAGGATGTGAGGATCCCA
AAGGAGAACGTTCTGATCACAGAAGGAGCTGGCTTCAAAATCGCCATGGGGGCCTTTGAC
AACACCCGGCCACCAGTGAGTTCTGTGAACCAACTCAAAGTTTCTTCTTTCCACCTCATT
TAAATTGCATCGTGACATCTTTGCGTATTTAATCTGCCACGTTTTTAAATGGAAGGAAAT
CAATACTTGTGTTAAAACCACTTCAAAATAAAAGACTTGAAGTTCTGAAATCACAGAAAA
CATACTGAGAGGTCATCTTAATCTTGAGTTAGTCTGCGCATTATTTAAATGTAGATTTCA
TATCTACAGATAAGCAAACCATCATCTAAAGCAATGTTTTTCAACCGGTGTGCCGCGGCA
AAATAGTGTGCCATGGGAGATGGTCAAGTGTGCAGTGGGACATTGCCCTCATAACTGATT
CAACAACATTAAGCATCTCCAGGATATCAGCTCTTTGTTCTTCCAAACAGGCCCTGATAA
AACACTGAGTAGTTAGGAATATGAAAGATCATAAAATACTTTTTTCTTTGTGTTTATTTG
ATTCTATTAAAGACATTTTGATAAGAATAACGGGATACCGCGATTTAGCTGCAGCTTCAG
CTGTATTTTGGAAAAGTCCCGCCCCTGTAACTGTCTCCACCAATCATTCTTGGAGACTTG
ATCACATGTCATCAGTCTGACCAATCAGAAGTGGTTAAAGTCTTCACTTCCTTGTTCTGA
TTCTGTTGATAAAGTCCCTCAGTTCCAACAAAAATAGCAGCTAAAGCTCGTCTTTAGCAG
TGTAGCTTTCCGTGGGATCCAGTGTCAGACCGTGAAAAAGGTGAACAAAACCATGAAGCT
CAGAGACGCTAGTCTGTCTGCATTTGGCGGCTGTTTGCACTACATTTCCCATGATGCATT
GTGTTAGCAATTTCAGTGCACAATAAGTCTTTCCTTAAATGTCTTGAAACCAAAACGAAC
ACGCATCAAACAGTTTTGAAATCTTCTAACTAAACTTTTACCACATCTATCAGAAAAAAA
AAGCTGCAGCTTCCAGCTTTTTCTGCCACAATTATCATAAAAATACATGTGAGATTGCGG
AGGGACTGTAGATCAATACAGACTGAGTTTCTCCTTTTTTTTTTTTAAATTTTGGATGCT
GGTGTGCCGCGGTATTTTTGTCAAGGTTAAATTGTGCCATGGCTCAAAAAAGGTTGAAAA
AACTGATCTAAAGCCACAGCTTAAACACAGAGAATTCTGTTTTTACCATAAAATCTTTTT
TGTTGATCATTTTGTCACAAGGATAATTGCAGTTTGAGGGTGTCTTTAGTTTGGGAATTG
TCTTATTTACTTGGTAAATAAAGATTAAGTAAATAAATAAATGATATACTTTGATGCAAT
TTCCAACACTGACTCCATGTAAAAAGTCAAAACTTAGACCAACCTAGCATGATAGCAGGC
GTTAATGTAGCTCAGACTGTTCCGACCTTTCACCTCCGTTTTTAGGGTAGTTTTGATCAA
CAAAAGTAGTTGGAGTTTTCCCTCCAACACAACTAGATCCTGCTTCAACCAACCTAACGT
GAATCATTTATCCTCAAGTTAAAAGGATTATGGAGTCAGACTGTAGGGAAGAAAGAGAGA
TGTTCTTCACTTAAAAGGGCATTTTGGTTCCCACGTTCAGTCCAAATTGAAGCATGATTA
CAGTTTTCCCTGAAAGTCGGATCAAAAGTGTCTGAATCCACCAGGTGGCAGCAGGAGCAA
CGGGCCTGGCTCAGAGGGCTCTGGATGAAGCCACCAACTACGCTCTGGAGAGGAAGACCT
TTGGCAAAGCTATTGCTGAGGTTAGTTGCCCCCAAATGGAAGCTTTAAACACTTTTTTGT
GTTGTTAAAACAAAATACTCGTAAGTTATCTGACAAGTAGAGGATCTTTAAGCTGTGCTT
GGGTTTCCCAGCATCAGGCTGTGTCGTTTATCCTGGCTGAGATGGCCATGAAGGTGGAAC
TGGCCAGGATGGCTTACCAGCGCTCCGCGTGGGAGGTGGACCAGGGCCGCCGAAACACGT
ACTACGCCTCCATCGCCAAGGCCTTTGCCGGAGACATCGCCAACCAGGTGGCCACGGATG
CCGTCCAAGTTTTTGGAGGCAACGGCTTCAACAGTGAATACCCAGTGGAGAAGCTGATGA
GGGATGCAAAGATCTACCAGGTTACTCTGCCTGTTGTCTGACGTCACTATCAGGAGGAAT
TTTGTGGTCAGATTTTTAATGGTTTTGCTTTTTTCTTCGCAGATCTATGAAGGCACGGCT
CAGATCCAAAGGCTGATCATTTCCAGAGAGCACTTTGGAAAATATAAGAAATGAGCCCAC
AGGTCCATGTGCTCCTCTCTGCTTTTCTGTGCACAATCTTACTGTTCAGACTGTAAACGT
CAGGACGCAGCTCAGTGGTTTGCCTTGACGTCGATTCATGCGTTGTTTGGTCAACGTAAC
ACAGCTCTTGAATCCACGCTAACTTAGTTTCTGTCCTGTAAGGATTTTGTCTTTTCCCGT
CCAGTAGATCTCAGCAGGTCGCAGTCCCTGCAGAGGAACAGAAAAGTGTTCCTGTCAATC
ACAGAAGGAAAAACCTGCTTCAAAGATTGTTTGCATGTCGAATCCCACACTAAGCTAAGA
GAGCTAAAAGTATCAAAGTTTGCAGTGAACATCTGTTGTGTAGATTTTAAACGAGGCATT
ACTTCAGACTGTATCTTTTCATCTTTACTGCAGTAAAATCTCGAATAACTAACCCTGTTT
TCCCTCATTCTGGACTCATTTTAAATGTTGATTTTGTAAAATAACCGTTAAGGTGAATCC
TGCTTTCACTAGAATGTGTAGAGAGCTGCTCATCTCTTCCAGCTGGTGCCTAAAAAGATT
TTCTGCTCGATTTTATTATTAATGCCAAGAAATGTTGAGCTGAAAAGCAACATTTTTGTA
CTTCTGTACTGCAGATTTTAAGGCTGGAAGTGTTGGAGGAAGTGCGGCATGTTGGCTCTC
TGTAAAGCAATTTATTATCATTCAGTTTGTGCCTCTTTTTATTTAAATTTTTTCATCCAT
TCGTCAACACAATGGTTTAAATAAGAACAATGAATTAAAGAAATGAAACTGTTTCTGGTG
TTTGTTGTACTACATATACGTATTTTTAACTTTGAATGAAAAATGTCTTACAGTAAAAGG
GCAGATTTAAAGTCATGATTGTGTTATTTTTATTTTGTATTCCTATGTCCTGTTTACCAC
CCTGCCAAATGGTTAGAGGCTGGGAGCCTTATGGTGATGGGACTGTAATTAAAAGAAAAA
TAATATTTTAGTTGAAAATGACAAAAGATAATCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 157320..157439, 157640..157737, 157859..157928, 158098..158198, 158546..158626, 158762..158892, 159052..159160, 159414..159554, 161204..161299, 161411..161659, 161742..161813
1017..1029, 157320..157439, 157640..157737, 157859..157928, 158098..158198, 158546..158626, 158762..158892, 159052..159160, 159414..159554, 161204..161299, 161411..161659, 161742..161810
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved