Oryzias_latipes Locus RPS7
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RPS7
Oryzias_latipes
RPS7
24
SNORA73, SNORA73, SNORA73, SNORA73
1879..2094, 2963..3178, 4500..4715, 5308..5523
6841
TTTTCTCATCTATGTTAACATTCTCCAGCAGTAACGTTTTGGGCTTCCCTTCATGATCA
GCTCTGGTGGGAAAACTTTCTGCCAATCATTTATTTGAACAAGGTCAAAGAGGTTTCATT
AAAAACTTGCATAAATTTGATCCAACGAATCAGTTCATGCAAAGGTTAAAAAAAGCTGTA
AAAACTGGACATTTCATGAACAATATGAAACACTAATACACAAATTTTGGATCTGTACTC
AAACTAAACTAGTATGGAACAAATTGTTGACTCCCATCAGTACTTAAATCTATTCCTATT
TCTTCCTGAGCTGGAAGAACATTTTGTTTGGCTTTATTGATTATCATAATAAACTATCTT
CACAATTCTAGAAACCTGCTGATTTTATAGCAAAAGATATACAAAAGCAAATTAAGTGAT
AGAAACCTACATCTCTTATTCATTTGCTCAAATCACCTCCGTCATCTTTATCACCTTAAA
AATAACATATTGCCTTTATCGTTGTCTTCAACTGTTGTAAACTCCTTGGCTTTTTAAATA
AAAATATTTTTTTCAGTGTATTGCTCGTTGATCTATTATATTTGTCTTATACGCGTTTTG
AATAACGCTTTTGAAAAATGCTCTGCGATCACCTTCATCTCATGCGCCTTTCCCCGCCCC
CTCTTTCAGTCCCTGGTATCGCCGACAATCCTTTTTTTTTTTTTTTTTGGCGGGCAAAAG
CCCCCCCAACCCCCTTTGGATTTTGTAACNNNNNNNNNNCTTTTTTTATTCCCGGGTTTT
CCGGCAAACCCTTTTTTTTTTTTTTTTTGCATGCTAAAGTCATCTCAATCATCATTTGTA
TTTGTTAGCGATTTTGGTGTAATAATTTAGAAGTTCTAATGAAAAAAAAAGTTTTCTGCT
GAATTATCGCGATACCTCTTGGATTATAAACTGTACACAGGAAGCCACGCGATGTTTGGC
ATACTCGCCTGATTGGTTGTATTCAGCTCTCGCGATGTTCCGGTCTCTTCCTTGGCCGTC
GTTGTTGGAGGTTAGTCGTGCTATCTTTCAAGGAACAGCGTTTTCTGGCGAAAACATGTC
TTTTCAGTGTTGAATTGGGATATAACTTCACCAAAGGAACAACATTGTGTTGATACCTTA
GATTGTGTTCTTTGTGGTGACGGATGGTTTTCTAAGAGCTTTATTTGATCCGTACTAAAG
CAGCGGGTTAGCAGGCCTTGCTCATTAGCCACTCAGCCTCCAGAGTGAAAATGTGGAGCT
CAGCTCAGGAGATGTTCTGATTATTTTTGAAAAACTATTCCTGCCTTGTTTTATTAAACT
TTAAGAAAGCGGGTCAAGTTGGACGTGTTCTACAGACCAACTTTTCTCGGCTTTCATCCC
CACGGTGGTTTTCAGTCCGCGGGGCTGAAGGTCCAGCTGTGGTCCGGGCTGCGTGCCTCT
GCTGTTCCCGGTTTAGCAGCCAGCGACCTCCACGCCGCAGCCGCGGGCCTTGACGGACGG
AGCAGAGCGAACATTAACATGTTTCATGTTTCCCTGCAGACACTGAGGCCATGTTTAGTA
CCAGCGCTAAAATAGTGAAGCCTAATGGCGAGAAGCCGGACGAGTTCGAGTCCGGGATCT
CCCAGGTAAGCCAGAGTATCTGAAGGCTGATGTTTCATGAGGTTCAGGACTGAGCATGAA
ATCTGACAGACCTGCAGAGTTAACGGTGTCTGTTCATGAATCAACCTGACTTTAACAGAC
GCTCCTCTGTTTCAGGCTCTGCTCGAGCTGGAGATGAACTCTGACCTGAAAGCTCAGCTG
AGAGAGCTGAACATCACAGCTGCAAAGGTGGGTTTAGTCATCCATGCAGACAGTAAACTG
GTGGATGATTGGTCTAAACCCGACGCGGACGTCCAGAGAGTTATGCTCCTGGTTCTGTCC
GGGTGGCGTATGGGAGCGTAGCTTTGAGCTGAGACGTACATTCCCGTTCCACAGCGTCGT
ACAGAAAGCTCTGCCCCCGGCCTCGGCTGGTGAGGGCGGGCGTCCTGCATATTCCTACAT
CTTCCCAGAGTCCTTTGGGCCGTTACTGGGGAGCTAAACCATGCAGTGCACATTGAAAAC
ACATTGTTTTTGTGTATTATCAGGCTTAAAGGGGGTATTATCGCCTCAGTTGGTTGAGGG
TTCATCGCTTCTTTTTGCTTTCTTTCAGGAAATTGAGGTTGGCAGCAGCAGGAAAGCCAT
CATCATTTTCGTTCCCGTTCCTCAGCTGAAGTCCTTCCAGAAGATTCAGGTGCGCCTGGT
TAGGGAGCTGGAGAAGAAGTTCAGTGGGAAACACGTTGTCTTCATTGCACAGGTACGCCC
AGGTGCACACACCAGGTGATGTAAGTCCTTCTCCAGTCATCTTTGATCAAAGTGTTCCCC
GTGGTCTTCTAATTATGATTATGCTATTTTTAGTTCAAATTAAACCTGTCGCTTTCCAGG
ACCTAGTTTCTGCAGAGCAGCAGCTCAGTAGAATTTCGCCTGCCTCACTTCCTGTCATCC
ATCTGTTTACTCTCCTTGCTAGCTTACAGCCCTCACACACTCAATCAAGCATTAGCGGTG
CAATCTCCTAGTGTATATCCAGATTGCAGCTCAGACGAATTGATGCATCAGAATAGAGCA
GAGCAGGGAGCTTGTAGCCTGCTGACCTACGTTGCTGCCTCTCAGTGGAGTGGCTCTTTA
AGAAACAGAAAGGGACTGACCTGAAAGGAAATGGCAGCTTAGGACTGGTCACAATTAAAG
TGAGGCTCAAACAATGCTTGTCTAAAAGTCACCTCTGAAGATCTGAAGTTATTTTGATTT
CTGACGGCAGGTTGTAAAACATATCTAAAAGCATGAGGTCATGTTAGTCCTCTGCAGAAG
CCGGTGGCTGTAGTCCTGATTGCAGGGATGTTCTGTCCTCTAGAGGGCGATGGATGGACG
GGTACGGTTTGATACCTCGTGTAACGACGCGGACGTCCAGAGAGTTATGCTCCTGGTTCT
GTCCGGGTGGCGTATGGGAGCGTAGCTCTGAGCTGAGACGTACATTCCCGTTCCACAGCG
TCGGACAGAAAGCTCCGCCCCCGGCCTCGGCTGGTGAGGGCGGGCGTCCTGCATATTCCT
ACACCTTCCCAGAGTCCTTTGGGCCGTTACTGGGGAGCTAAACCATGCAGTGCACAGACA
TCGATGCTAAACGTTTTGTAAACTGACCATTTTCTTGCAGGTTGAAAGGGTATATATCCT
GCTTTCCCCAAGCCTTTCAGAGAAAACTATGCATAGAAATAAGAATAGATTACTTTTTGC
ACATTAAAGAACACATTTGAATTGAAATGGGTTATTTTTGCAACTCATTTTCCAATCTGG
AAGTAAGACGACTCGATCTCTGTGGCTCCGCCTTTCTATCCTTATGGGCGCTGCCCATTT
CATGACCTCATCCTGGAGCCTGCCTCTGCAGCGTGTCTTCCTTTTTCTCTTGAAAACAAA
CATCTAAACTTTTACGAAGACTGAGGTGCATATTGTGCTATGAAAGCATTTAGCTGATCA
CCGCTAGCTCCACAGAGAAAGTGTGTGTTAGCCTGGGGGCGGGGCTTGCAGCGCAGACAC
TTCTTGGAAGGGGCTGTTCCTCACTTATCTATGTCACAACTTGAGGACCTGCTCATTTCC
GTGGGTTGGGAGGGGCTGGTGCTCAGGGCAGGATTTTTAACGGAATACACAGAAATGTGT
GAATGGATCAGAATACCGGTTTAGGTTGTTTTGTGAGGAATGAGCATCAGAAAACACTCA
AGAGCTCAAGTTGATTTTGTACGATATAGACACTTTAATGAAACAAATATCCTGACTTTG
TTGAATTTCAGCGGAGGATTCTGCCCAAACCCACCAGGAAAAGCCGCACAAAGAATAAGC
AGAAGCGTCCCAGGAGGTATGATGTCTACAACATTCAGCACTGAAACCACCTTTAGAGTT
GATTCTCACTGATCTAAACCCAGTCAGAGCTGCAGAGTCATTATGAATCTGTTTTTCCAT
TTATGCTACATATAATTTAACAATTGTTTTTGTCATAAATAAAACCAATGTAAAAAGGAG
AAAAGACATTTTTGTTTTTCTTCTCTTGACAATAAGGTTGAGTGTCTTTTTAAATTAGAC
AACTTAAAACTGTTTACTTACTTATAGAAGCACCTCAGTCCGAAATTTAAACATCTGCAT
TAAATAAGCACTAAAAAAATTATGCCTTTAAAAATGTCTCTAACTTACATTTTTGTAGCC
AGGATGCCACAGTGCAGGGTAACAGAACTATAAAGCCTGTGTTTGCAGACCTCTGAAGCT
GCTTCATTAACGGTGACCGAGGTGGAGACTAGATATAAAAGCAGAGTAGTTGGGGCGGAT
ACAAACCTAAAGGCTTTCTCAGTGTTGTGAGCCGTGTGTGATCCTTCCCATCATGCATTT
GTTGAAAGTGCTGACTCGGGGCTAAACGGTGGTGGTAGAGGATAAATGATTGGTCTAAAC
CCGACGCGGACGTCCAGAGAGTTATGCTCCTGGTTCTGTCCGGGTGGCGTATGGGAGCGT
AGCTCTGAGCTGAGACGTACATTCCCGTTCCACAGCGTCGGACAGAAAGCTCCGCCCCCG
GCCTCAGCTGGTGAGGGCGGGCGTCCTGCATATTCCTACACCTTCCCAGAGTCCTTTGGG
CCGTTACTGGGGAGCTAAACCATGCAGTGCACAGATTTTTCAAAACCTAATATTTTCTGT
TCCAACAAAAACGTTATGATCAAAATTCAAGTCTTTAAAAGTAATTTTATAAATGTTGAT
ACAGGATCGGGGGGGGGGGGGGAACCCCATGGGGTTCAACCCCCCTTTGGTAAAATTCNN
NNNNNNNNGGGGGTAGTCCCATGTGGTTCAGCAGCAGCTTGTTAGACTTCAGAGAATGCT
TTAGATCATTCTTACTTTGTCAGTCAACCTAGTTTTGTGTTTTATTTTAGAAATCAAATC
AAACTATTGATCCGTGTTTGGGTTAACGTCCTGATGGGTTTGTCAGTACGGTAAGGGGGA
GCCCGGTGTGGGTGTTCAGGTTTTAACGGGTGTTTGGCTCCTTCCTCAGCCGTACGCTCA
CCGCAGTCCACGACGCCATCCTGGAGGATCTGGTGTTCCCAAGTGAGATTGTGGGAAAGA
GAATCCGGGTGAAGCAGGACAGCAGCCGGCTCATCAAGGTCCATCTGGACAAGGCGCAGC
AGAACAACGTAGAACACAAAGTAAGCAGTAGCCTGTGGCCGTGGTCCTGGCTGCAGGGAT
GGACGGATACGGTTTGATACCTCGTGTAACGACGCGGACGTCCAGAGAGTTATGCTCCTG
GTTCTGTCCGGGTGGCGTATGGGAGCGTAGCTCTGAGCTGAGACGTACATTCCCGTTCCA
CAGCGTCGGACAGTAAGCTCCGCCCCCGGCCTCGGCTGGTGAGGGCGGGCGTCCTGCATA
TTCCTACACCTTCCCAGAGTCCTTTGGGCCGTTACTGGGGAGCTAAACCATGCAGTGCAC
AGACATCGATGCAAAGAACAGTTTGTTTTTTCAGGAATGATGCAGTCATCAGCCTATTTG
AGGCTGATTCATCTTTGTGATTAATGTTCTTTTCAGTTCTTTGTACTTGTGACAGATTTT
CCCACAACAGAACAGACGCATGAGAACAAATGATGTTGTAATTGAACCTCTGAGGAGACA
GGAGAATGTGACGTTTGAATCTTTTTCAGGTGGAGACCTTCTCTGGTGTCTACAAGAAGC
TCACAGGCAAAGACGTCGTGTTTGAATTCCCAGAGTTCCAGCTGTAAATGCAGATGACAA
AATAAATTTGTTTACTGTCTGCTGTTGTCGTATTTCAGTCTGTTCAAACAAATGTAGTTT
AATCCTCAAAGCTGGTTTTGTGGATAACTGGAGCGCGTTTTGGGGGAAGCCCGGTCTCAT
GCGGAGAGACGGCGTCCATCCCACCCGGGACGGTGCCGCTCTTCTTTCTAGAAACATTTC
TGCTATCCTTAGTCTGTTAACCTGACAACCCAGAGACGAGACCCGGGCGCAGAGCAGCAG
TGTAAAACGCTCCTCTGAGCCTCCCTTAGGGTTAGTGCCGGTGCAAAACCCATGCAGGGA
AAGTCAAGCAGGTCCGAGCTTTAGCTTATGTGCTGAAAGACAAATGAAAGGAGCGCGTCA
TAGAAACTTTACAGTGACAGACAGCAGTTCTCACAAGCAGAATTATGAAAAAACTTGGCT
AACTATCAGGATTTCAGGGAAAGGAGGTGGTTTGGCAGTAATATCACAGTCTAGCCTCCT
CTGCACTAAAGTCAAACATGTTTATAAGTCATTTGAAAGCATCATACAAGGAAACGTGCA
ACAATGTGGAAAATCCTTGGTGTGATCTGGCAATGTGGTGTGATACAGCAATAAACAAAA
AAGAACAGCAAAATCAGTGAAAAGCTGCAGGAGACGATCTTCTAAATGTGCTTTACTACT
GTCATGATTATTAACAGGTTCACAAAGTAATGTATAATTATAGAAATATTTTTATTTTAA
ATCTAGAAATTGAGTTTTATGCCAATAGGGTCCTTCAGAGTTGGGTATAAATTGATGCCC
CCCCCTTCCCTTTTTGCTGTTTTGTGGGGATGGGAATAGAAGCCCCATGAAGCCTCATTG
GGGTTCATGTAATTGTGCCGGAAAAATGAACCACCCATTCAGGGCTTTGAAATCACACAG
AACTGCGCCATCTGGTGGCGGACTGGACGTATATCGACATGTTTCAACAAAGCTCCTTGT
AACACTTCAATGTGGAAATGATGATGAAAAAACGTAAAACAAAAAAATGCTGTAATGATC
AT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1539..1624, 1755..1826, 2188..2331, 3851..3915, 5089..5239, 5729..5841
1550..1624, 1755..1826, 2188..2331, 3851..3915, 5089..5239, 5729..5803
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved