Oryzias_latipes Locus RPS12
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RPS12
Oryzias_latipes
RPS12
24
SNORD100
3028..3110
5311
TTCGCAAGTGTATGATTGAAAATTTTAAAAAGAAGTTTATTTACTAAACATGTGTATCT
GCCTCTGTGTGGAAGAACTCCTGTCATATGCTTATTCTAATTTATGTATCTTTTCTTTCT
TCCAGGATTTCGAAGCATTTGAGAATGCAATTGAAGTGGGAAAATTAGAAGAATTCTTAA
AAATTTAAAACATTGACCAATACCTGGCTGCCCTTGTGATGGAAGAAGCTGTTTCTTTAA
TAAAAAAATAATTCATTTCTGTTTGATTAAAATGAAAGAAAAAGTGGAGAACAATGCTTG
CAAAGCCCAAGTCTTATTGTTTATTTGAAAATAATTGATTGGAAAATAATTGATTCAGTT
CTTTGAAATAAATATCTCTAAAAGTTGGAATTACTTGTCTGTCTTTTTTCGTTTTCTCCT
TTCTATGTGCAAAAGTGACTCTGTGGTACTTCATGTCTTTTTTTCTATATGTCAACAAAA
CCCTTCCACAATCTCAACTTACTTTGCTATTATAAAGGCAATTCATATCTATCGGACAAA
TAATAAACTACAAATCAAAAAATAAATTAATAATAAAAATTGACTTTTTTACAAGATAAA
AAAACGTCTAGAAAAGAGCCATTAAATAAAACAATGGAGGGAAGTTCAGTTTTTTCCTTT
AATACAGACATGCCAGTGATTTATTCCTCTTTTTCAGCTAAACAATTTGCCTTAAATTTA
TCATTGTACCCGATACAATTTTTGGTTGGATTTGATCATTCACAATGTGCATTATTTTAA
TTTTTTCAGGACATTTGTAGAGTGGTTTCTTGAAGCTTTTTCTAATTTCACGATTCAAGT
ATTATGTAAGTTAGTTAATGACATTAAATATGCATATTTTGTAGTTAAAAGCAAGTAAAA
CTTTAAAGAAACTGCATCAGGCACCACGTCGGGCGCACATCGGGGGCCTGCTTGTTGTAA
AACGATGTCGCGAGCTGATGACGTCCTCTTTCTCCGCTGCCCGACAGGAGCACAGAGTAT
GTTTGTTACTGTGCGATGACAATCCATGATTTAAATAGGCATCGTAGCTTTTAAAATCAA
CCCTGGAACATTTTTGTGATTGATTATAACTATTTTCTTGTATTTTTGCTTTATTGCAGA
ACTTTGAGTCCGCCATCCATCACATTTGAACAATGGCCGAGGAAGGGTGAGCATGACTTT
CTGTGAGCTAAAAGTACAGCCTTTGGGACCTTTGTCGTTATGCTAACCTGCTTGAAGTGA
CTAAAACTGTCCACAGAACAGACTGACATCCGCACAAAATTTATGATAAAATGTAACTAT
CGTAAACGATAGAGAATGGGTCCTTAAAAAGTCCCTAAGTGACTGACATAGTTAGCTAGC
CTAGCCAAGAACCCGGTATGGATTAGACATGTTCTTGTGTCGCATTCAAATAATAGGTTT
GTATCAGTCTGAATAAAATGAAACAAAACAACACGCACAGTTGTGCAGTGGTTAACACCG
TTAGTGAAAATGTAAATATCAAAGTTCGAACTCTAGTTAGTAAACACACTTAAGCGAACT
AGGTGGCACTGGCATAATAAATCGCAAGCATCACCAAAACATTCTTCTTCCTTTTTTGTA
GCTATGGAGTCCAAAGCTGTTATCACTAGGTGTGTTTGCATTTATACTACCCACCAATCC
AGGAATGCTCATTCTTTTAAACGAGAGATGCTACAGCCTGACCCACTGGTTTGATGGCTG
GTCTGGTGGCTAAATTAAGTCATGTGAGCATGCCAATATAAGTTTTCTGTCGAACTTGCC
AAGTTTAAAAGTATGTCAAGGCTTTAGATAAATATTTGACTTTTTTTAAAGTTTGAAATC
ATATTTTTTGGCTTTAAAGAAGAATGCCCTTTAGTTTGGATAACTTGTTTAAAAAAGTGT
AATTGGTTAAAAAGTTTAGTGTTAAAAGGCTTGTCAATAAAGTTTTAATTGAAGATGAAA
ATTTCTGTCATCCATGATACATGCTTTCATTTCGGATTTAGAAATTCATGAGTTTTACTT
ATGTCGTGTGGGTTTGAACCAGTGTAAAATATGCACTCATCATTCCAAAACAAATGATAA
CCTAGAAGTGATTATTAAAATGTTACCACCAAGGTATGCCTGATTCGATCCTTGCAGTTT
TGCAAAAAGAGCTCTGCTGCATGAATGATGACTTTACATTCTTTTGTCGGATACCCCTTC
ACTCTTCAATGAGTGATATCTTCTTTCTGACATGCCAGGAGCTGAATATAATGATCACAT
CTTTTAGTGTTGCACTTGCACTGTAAATGTAAACCCTTTTTTTCCCCCCTTTCCCTTGGA
CAGCATTGCTGCCGGAGGTGGGATGGATGTGAACACTGCTCTCCCAGAGGTGCTGAAGAC
CGCACTCATCCATGACGGCCTTGCCCGTGGAATCCGCGAGGCTGCCAAGGCCCTGGACAA
GTAAGCCCAAATGCTCCTTGACTGCCATTTAACCCTTGTGCTATCTTAGATGACCCCACC
TTTACATTGACGTGTTCTCCCTACCATGACAAAGGTGGATAAAGGTGGAAAGATTTCATG
TAATCCATGGACACCAGTGAAGATCACAAATCATTGAAGAAAAAAGGTTCAGAGCACTGT
CCAATGTTAAAGTGCCTAGGATAGCACAAGGGTTACAAGAAAAACTGATATTTCTGTGAT
GATATCCTGGCTCCCTCTGCTGAACATCATGTGGAAGTCTGCCATCGTTACCCAATGTCT
GTCTGAGATATGTAGTCCTCTCAGAGCATCGGTGTTGTTTCCATTTGTGCTTGAAAGTAA
TTGTGGTCTTGCAGGCGTCAGGCCCATCTCTGCGTCCTGGCCGCCAACTGCGATGAGCCG
ATGTACGTGAAGCTGGTGGAAGCCCTCTGCGCTGAGCATCAAATTAACCTGATAAAAGTA
CGAATGCATCACTTTGCCTTATAATGTTAGCAGTGGAAATGTTTTCATCCCTGCAGCATT
AGAGACGATGAGCTGCACTTTCTAAATCTGTATCACTGATGATAATTTGGCTCCCTCTAC
TGACCTCTGTGAAGAGATGGCCATTGTTACCCAATTTCTGTCTGAGATGCAGTCAAAGCG
ATTTTAAATATCTATTTTCTCTTTGCTTTTTACCACAGTTGCCATGTTTTAACACCTCGT
TTGAATTGCTTTGTAGGTTGACGACAACAAGAAGCTCGGTGAGTGGGTCGGTTTGTGCAA
GATCGACCGGGAGGGCAAACCCCGCAAGGTGGTCGGCTGTAGTTGTGTTGTTGTCAAGGT
AAACATCTTTATTTATTTTAATTAAAGAAAAGAAAAAAGGGGTAAAGCTATGATTTGGCA
GAGCAGTTGTGTTTAGGTGATTTTTTTTTTTTTTTTTTTCCCCCTCTTCTTAAATAGGAT
TTTAGCCAAGCAAGTGCAGTTGCTGTGCTTTGTGCTGCGCAGCTGTTTAATACCTGGCGA
GATGACAGCCATAGTACGAGCCCCGACATCCTCATGTGATATCTGGGGTCCCTATAAGTG
GCTACATATGTTAGCAAAACAAGCTATTATTTCATGTTTCCGTTTATGAATCCATCTGAA
TTGTTTGTATTTGTGATTGATGTAGACTAATGACTTTTCCGACTGGTAAAAAGTTTAAAA
GCTGCCTGTGGAGAAACTTGGCGAGCTTGTACTGCCGCTCTTTGCTTTGAAATGTACAAA
ATAAATATTGTAACTTGATTTTTAACGATGAGCCAACATGACTGCTGCAAGTGATGTGAA
GCTCTGAGAATGATCAAACTTTTAAAAAAGTAGCTTTGGTTTTAATGAGCATCCTTCTTC
CCGTCTAGAAAAGCTTCTCACCATCCAAGAATCTTATGTTGCCTAATCCTCAATGGCACT
TTAATACTTTAAATTCTATGGTGGCGTCATCTTAATCTGTAATTTTGTGCTTTCAGGATT
ACGGCAAGGAGTCTCAAGCCAAGGACGTGATTGAGGAATACTTCAAAGCCAAGAAATGAA
GTGTTAATAAAACATGAAAATGAAATTGTCTTAAGTATTTCCTTTCTGATTTGTGAAAGG
GTATTTGGCAGAAAATTGGGATACACAAAATGCATCCAGGTTAGTGGCAGTAAGTTTTAC
ATTTGAATGAATATTGTTGAGGTTAAAGAAAATACTGAGGTCTCCTTTTTATCTACATAT
TCCTGAAGTGACATTCCAAACCAAAGAAGCCCTTCAGAAGAAAGCAGTACAAAAAATGAT
GAATAGGACAAACACTTAAAATTTGCTTCCATGACAATTGAGACTAATGATCTGTAATTT
ACGTTTATTGGAAATAATTTACATTTTATACCACAGACAGCATTGTGTTGTGATTATACC
ACCAGGAAGAAAATTATTTTTTTTAAAGTCCCAGTATTTGTTTGTACAGAGAAGCCTTCA
GGTAGAGATGCTCCGTTCCAGGTGACGCCTTGCTGCTCCCAGGATGCTCCGTGTAGCTCT
TCATCTTCCGCCTTTGTGCTTCAGCTGCATAGACATTCTAAACTGGGGGTTTCAGAGGGT
TGTTCCTGCATCAGGACCAGGTTGCTAAGGTGACCCCTTTGTCTACCCCTCTAAAAACCT
CTTTGCTTAAGACCGCTCAGAATTATTCAGACATTCAAAAAGAAAAAAAAAGATGAGAAA
ACAAACAGTTGCAGCGTAGAGTGCTTTTGTTCTTAAATAGTAATACAAAAGGAGGAAGGG
GGCTGCCTGGCTGACCATTTCCATGGTAACGTTGCATGAGTCCATATTGCTATGACAGTT
ACAGGTATTCAAACTCCAGTGCTTGGTGAAGCGCCAGCAGGTCAGAGTGACTGGATATCC
TCCAGAAAGGCATGTTGTGCTGTGGAGTGGAGACAGATGATTAAAACCCAACGGCTCTCT
GCCACCAAAAGTCATGCAAGCTACAGCAGCTTGTTTCTTTGCAAAGGCACCACAAACACA
GCCCCATGCATTTCAAACAGAGAGCATTTTGGGAAATGTTATGTAGGAAGTAAGGAATTA
ACCTCACTTACATCCAGATAAATCTGACTGGAAGTGAGGTTTGCTGAGTAAAGGGAAAGT
GTATTCTTTTTTTTTTTTAATTATATGAATTTAAGTTTTCTGTAAAACCTCAACGAGGAC
TACATATCCCAAAATGCTGTGCATAGTTTCAAACAATTCCAGTCCCCCTCAATATAAATG
GAAACCAAAGTTAAAGACTTTCATATACAGACCACCACTACTTTGTTTAGGCATAATTCC
AGCATTGTTGGTTGCCATAAACGGACTTCCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1017, 1141..1185, 2343..2459, 2834..2936, 3196..3297, 3956..4311
1172..1185, 2343..2459, 2834..2936, 3196..3297, 3956..4015
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved