Oryzias_latipes Locus POLR1A
snOPY snoRNA Orthological Gene Database
Oryzias_latipes POLR1A
Oryzias_latipes
POLR1A
10
SNORA5
15129..15264
24251
ACTCTGGTTACAATACAAACACAAAGGATTGGGCTTTAAAACTGCACAAAGGGTGTTTA
AACAAATAAAAACACATTTAAATACACTTCGAACTGTAATTTTCATTTATTGGGTTGTTT
CCAAAAAGTATATAGTAAATTCCAGGAATGATGCAGGAAAAACCTCTTTACTGCATTAAA
GTGTTATGACGTTATTCCTGCTGGAACAGAATAAATATTATCAAAGTCCTCTTGGTTTGT
GATTGAAGTTTCAAAAGTCAAGTTCTTTTCTTACCCTTTTTAACTTCTGGAGCTTGTTGC
TGCAGCGCAGAGGTCCATCCAAAACTCCTGATAAGAGACAAAAATACAAAATAAGTTTCA
GCAAACATGTGATCCCTAAAACATCTCTGACGTCACAAAATATTGCAAAATATAAAAGCA
AAGCTGTTTTCTTAAAATAAAAAAGAAAACATTTCCGGGACACAAATGAAATGTTGACTT
ACGCAAATGCTTAAAATATTTACGTAATTCTCATTTCCACATTTTACTCATGCAGATACA
TTCCTGTCAGCTGCTCCTGACAGAAATACGTTTAAGTAAGCATCATGATTATTTAAAAAA
AAACAGAAAATATTCATATGTTCACTCCTCGTACCTGTTTGACCATAAACCTTCAAGGTT
AACCCGAAGAAACCGTCCGTTTCTCTGGATGTAATGTCCTACGTGCCTACCGGACGCCGC
CATATTGCCACAAACGGAAGAAGAACCAAACCATCGGATAAAAAAAATAGGGGTGGTGGT
GAGACATTAAATATTTTTATTCCAGATTAAAAATAAAATATTTTTTTTATTTTTTGTTAT
ATATGCATATACGGTTATGTATATACCAACGGAATATATAATATCTCAAAATGCAGCAAT
CAAAACAACCCAAATGAGCACAATTTGGTCCCCCCCTCTGATCTGACGGGTTGGTCTTTA
CGATCCCACGTGTAGGTCAGGAGGGATCCACAGAGGAACATGCTTCCACCATCATGCCTC
GTGGTTTGTGTTTTTAAACGCGCATAAAGTTTACAAGTAGCTTTTACAGTTTCCAAAATG
ATGTTTGGAAAGGACGTGCCATGGCGGCGTTTAAGCGGCATTTCGTTTGGAATGTACTCC
GCCGAAGAAATAAGGTGAGACTAAACTTGCTAGCTTTGTTTTAGCTAATGCTAACTAACC
CTAACCCAGTTTGTAAAAAAATAAAAAGGATACTCCTAAAATATTCATAGAGAATGAATG
AAAGGATTTATGTGATGTTGTGGAAGAAGCTTATATTGTGTGTTGTTTATTTTTGTAGAA
AGTTGAGCGTGAAGACAATCACAAACCCCAAGTTTCTTGATGCAGTTGGAAATGTGGCCC
CCAACAGTCTGTATGATCTGGCTCTGGGGCCAGCAGACTTGAAAGAGGTACATAACTGCA
TTTAACGTCATAAATCCAGTATTCTGGATTGTTTGTTTACCTTTTTGTGTTCCAAACACA
GTAATAATTGTGTTTTCTTCTTGTACTTTTATTTTGACATATCCGACTTTACGTGTTTTT
ACCTAGGTGTGTTCAACCTGCTGTCAGGATTTCAATAACTGCCCTGGACACTTTGGGCAC
ATAGAATTGCCTCTACCTGTATACAACCCACTGTTTTTTGATGTAAGTCCATGATAAAAC
ACAGACAGTACATGTTCCTTGTGTTTTGGATATATTTACTTATTGACCCTTTTACGCTTT
TTAGAAACTGTACCTGCTGATCCGCGGTTCCTGCCTGTCCTGTCACATGCTAACCTGTCC
TCGGGCTGCCATCCACCTGCTGCTGAACCAGCTGAAGTTAGTGGACCATGGAGCAATCCG
GGAGGTCTACCAGATCGAACACGTTCTCAATCAAGTGGGCCCACTCTGCAGCAAAAGCCA
CATTTTAGGCACAATTGGAAATTGAGCCATTATCTAAATTCTGGTTACTCCTGTTTATCT
GTGTGCTAGCACCTGGAGGAGAATCCCAAAGCTACAGGAGATGAAATTGAGGAGCTGCTG
CGCCACTATACGAATGAAACTATTGAAACGAGCGTCAACATTTCTGAAAACTTCAAACCT
GTGAGTTCAGGCTTACAGAAACAAAAACATACACATCTGGGGGTCCCTCTAATGAAGGAA
AAATGCTTTTCTGTGCTCGTGTCAGACTAAACATGTGGTGGAAAAGAAGGCTTGTCTGAT
AAATGACTTCTGGAAGATTCACATGAAAACCAGGAAGTGTCCTTACTGTAGGTGAGCTCA
CAACCTCTTAATTACTTTTTATCCGGACATTTTCACAACATCTTTTATACCAAACCTTGC
TGTAAACCTTCCATCTGATTGTGCTTAAAGGAGCGGCAGGACTCTTGTGCGGCGTGAACA
CAACAGTAAGCTGATCATCACAGCTCCATCAGGCGCACAGACCAATGAAAACACTAATGG
TGAGTTTGTTTTACAGAAATGTGCATAAATGAGCAAACAGGCAAAGGAAATTGGCTCTTT
TTAAAGACTCACTCTGGTGAAAATTGTATTTTTGGGTGATTTTAAGATGTTCTTGTGTCT
TTTTTCAGATAATTTAGGACAAACATTAAGTAAATTAAACTTAAAATTACATTCCTGAGT
TTTTCTTTAGTCAAACTGTTTTGAATCAGGACCAGATCATAAAAATACAGTTTGAAAAAG
CAAATATTGTTGATGCATAAAATATGCTAAGTGGTCCCTTCTGAAGCGGTTGCGCTGCAC
CACAATATAAAGTGAAATTCTAATAACCTACTGCTGCTCTGCAGAAACTATGTCCTAGAA
AACGACACACATTTTTGGATTCTGGCTTACACCGGCGTAATTATAATTAAGAGACCACCG
GAAACGCTTTTACAATAATTGGATTGGAGTGGGACTTTAAACCAGCTACTTAAATGTTTG
CTAACACAAACATATATTTTTGATTGTCTCTGCGTATTTATCAATTTAAAAATGTAATTA
TTTTTAAGGTGGTGGATTTAAAAATAAAGCTTCTTTCTGTCTTCTCACAGAGAATGTCAT
GGCTGGAAGGAGAGTCTACCTGACAGCCAGCACAGCCAAAGACCATATTATAAAAATCTG
GGAGAAAGAAGGTGGGTTGTTATTGAAGGAGGAGAGTCGGATTCCTCACCTTATCAAAGC
AAGTTTAGTCCTAATAGCAGAAAAGAAAGTGGAGTAAAATAGTGTACATTCCATTTTTTT
AGGACCATAAAATAATTTCCACTTTGACTTTTTAGTGGGGTTTGTTGTTAAAACATTTTA
TTTTGAAAAAATATTTTAGGATTAGCAGAAAAAGACAAAATGATCGATTATTTGTCTTAG
GGATTAAAGGTCAGCATCAAAAGTGACAACTATTTCTTTGCGGGTGTTTAGGTTTCTTCC
TCAGCTGCCTCTTCCCTGGGCTGGAAGAGACCGCCAGTCCTGCAGACGGACAGGGGGGCT
TTTATCCGGACCTATTCTTCACGGAGCTGCTGGTGGTCCCACCATGCAGGTATATACAAT
GATTGGTTTAATCCGGTATGGTACACCCCCAAACCGTCAGTCTGATCTGCATTTTCTGCC
CTCTCTGTCAAGGTTTCGGCCCATCAACAGACTCGGTGACCAGATGTTTACAAATGGTCA
GACTGTCAACATGCAGGCTGTGATGAAGGACTGTGAAATCATCCGAAAACTCCTGGCTCT
CATGGCGGGAGAGAAAAACGCGGAAGGGGAAGAGGTGAGATGAAGGAAACTCGTATTACC
TTTAGAGAATTAAGTTAATCTCATAATGAGGTATCTGTAACTTTTCTTTTTATTTCTCAG
AGCTTTTTTCTGCTCTGATTTAAAGTGATTGCTGTTGTCCTGATTACTTGTGAGACTTTT
TCTGAAATTCCGCTTCATCAAATCTTCCAGGCTCCCGATCAGATGGATCCGACGTTCCTG
TCGGGAATCACCGGGTTGACATTAACAGATAAACTCTACAACATGTGGATCCGCCTTCAG
AGCCACGTTAACATCGTTTTTGACAGCGACATGGACAAACTGATGACGGAGAAATACCCC
GGAGTCAGACAGGTATGAATTCGATTTCAGGTTTTTAAGACCTGGTCAACTCTTTTATTA
CAACGTTCGATTTCCTGAGGGCCGTGTCAAACAGCCACCTTCGGTCTTTTGTGATTCATG
CGTGACATACGGAATTAACAGGTGTTTCTCGCGCTCATCATTCGTTTAAGTGCACAAATG
TCTGTCAAGGGTTTTGTGCCAACACCAAATTAGTACATCAATCTTATGCAACTGTGTGTG
ATTTTTGCCAGATGCATATGCAAATTTGTGGCTTTCATTTGATCTTTTGGTGGTACAATT
GTGACATCTAGTGGTGAAGAAAATGTACTACAGATACAAAAGTATTGTCCCTGCGCTTTT
ACCGTAGATTCTGGATAATTTTTAAGAACAGATTTTTATGATATACTGATAAAAAAAGAA
TTTTTTTTTAGGATCAAGTGAAGATTTTATTAAAAATAATATAATTAAACAAATATTTAG
TTGTAAATGCATTATAAAATCCACTTCTCACTCCTTACTTTACACAGTTTTGGTTGCATA
TTTGTGCCAAATGTTCCCTGATGCAGCCGTATTACTTTATAAAATCATCCTCTAGTGATT
TTATTCATCTCTTCAATTGTTTCATTTTAAAATATGCAGGTTGCAAATAAAACTCAAACC
TTTGCATGAGGTTCTTTTTTTATCTAAATTTTTTGAACAAAGCCTGCTCTAGAACTATAG
TTTAAAAAAGTTTAACTCCGTTATTAAAGTTTATATTGTATTATTGGCATGGAGCAGCTT
TTATTGTGCATTTCCAACCTTTTTTTTTGTCTTTAGTTTGATGTTTAATGTTCTAAAGTC
ATTTTTAAAAAAAAGCTACCGTTCATAATTCACATGGATGTGGAAAGACGAGAGGAAAAA
ACTTCAATTTGTTCCATGTTTTTAACTGGTTGATGGCACAAAATAAAACCACTACTCATC
AAAGCAAGTTTTCCTCTCCTTTCAGATTCTGGAGAAAAAGGAGGGCTTGTTCCGGAAGCA
CATGATGGGCAAACGCGTGGACTACGCCGCCCGGTCCGTCATCTGTCCTGACATGTACAT
AGAAACCAACGAGATTGGAATACCAATGGTACCTTTAATCCAAGAAGAAAGTACTCAAAA
TGGGGGCGGGGCCTTAACGGATTCCGTTTTTATAAACTTCCTGCAGGTTTTTGCCACCAA
GCTGACCTACCCTCAGCCCGTCACCCCGTGGAACGTGAAGGAGCTCCGTCAGGCCGTCCT
CAATGGGCCCAACGTCCATCCTGGAGCTTCCATGGTGATAAATGAGGATGGCAGGAAAAC
CATTTTATCGCCCACCAACTTCACGCAAAGGGAGGCGGTTGCTAAGCAGCTGCTGACGCC
CTCTCTGGGTCCTCACAAGATGTCCATGAAAATCGTAAGCGGTACTCAGTGATACGAAGC
ATCTGTTTAAACGCTTTTTTAAAACTCTAATTTTTTGTGTGTCTCAGGTGAATCGCCACA
TAAAGAATGGTGATGTTTTGCTGCTCAACAGACAGCCGACTTTGCACAGACCGTCCATAC
AAGCTCACTGTGCGCGCATCTTACCAGGAGAAAAGGTTCACATCATTTCTCATTTTCACA
TTTCAAGGCTGAAGTCGGCGTCCATTTTTTTTAATGCAGCTGATTTAAACTTTCTGTACG
AGCGTTCATGTAAGAATCATTAAAATGTGACAGAGATTTTCTCTAACTGTCAAATTGGAA
GTTAATAAATATCAGACGCAAGCTTCACCCTCGTCTAACTTTTAAGGTGCAACAAATATA
TTTTAAAAAGTTCACTTTTTCTAAATATATTAGTTAAAACATGAATCCACAGTTTGAACA
ACTTTATTGGCAGCATCCTTGTAGCTGAATATTATACATAATTATTATGGTGTGTGGGAA
CAGCTGACACAATAAATCTACATTTTCTGTTTTGTCTGTTAAATGCAGCTTTCTTCTTTT
AACAGTTACTCCTGTTTTCAAATAGGTTTCCTTTTTGTTTCCTTCGCTAGTGAGCAGTCG
GTGCAGGAGCTTCAACAAAGTAGTGGATGGATTTTTGACACGTTAGCGCCGTGTTAGTCG
GGTGTGGTGGGAAGAATCCAGTCGCTTTAAAAAAAAAAAATAGATTATAAATCAAAACAT
GTTGGGGATCACTGTTCTAGATTGTTACTACTTCTGATTTATTTTTTTGAAGAAAAAGAC
AGTTTTCATTTAATAACAAAAAAAACATTCAGGTTTGACATTTGCAGCCACATTTTTTTA
ACCTAAATTTTTATTTTTTAATACCTTTTGTAAAGTTTTCTTGACATTTTTCTGTTCAGT
TAATAATAGACCTCTAAAAATAAAATATGCACTCAACAGAAATCTACATAAAAGTAGTTA
AAATCAGGTTTTTAAAAAAGTAAATGTTTAAAAAATAACTAAAACATTTTTTAAAGGAAA
ATCTGGATTTTTTTTTTTAACATGATTCTTTTGCTTCACCATAGAATCTGCAAATTCCCT
TCCAGAATGATTGACCAAAGCATTTCCCGTCACAGGTTCTGAGGCTCCATTACGCAAACT
GCAAGGCGTACAACGCAGATTTTGACGGAGATGAAATGAACGCACACTTCCCTCAGAGTG
AGCTGGGCAGAGCAGAGGCCTACACATTAGTCAGCACCAACCAGCAGTACCTCGTTCCTA
AGGTGTGTCGCTCAAAATGAATCCCTATTCTGCTCTTCATCCTTTGGAGGAGTCGGAGTT
GACTGTTTGTTTTTACAAAGAATTATTAGTATTAAAGCCTCGCTCCAATCATCTTTTTAT
CTGATTTAAAACCTCACCAGTGGTCTTTCAATTATGACTGTGCTGTTTTTGTTATTTTCT
AGGACATTGTTTCTGCAGAGTGGCAGCAGTTCATTAGAAATTTGCCTCTGAGTTGTGGGC
GGGACCTCCCTTTCTGCTTTATTTTGGCTAAAAACAGCACAATCAAAAGACCCGTGGGAA
CCTTTTGAAAATAGATTTAAAGATGATCGGAGTGAGACTAAAAAGCTTTATTTGAGAGTG
ACTTGGGTTTTGTTAAATCCACCCATAGAGACGTACAAGTGTCAGAAGAAAATGCGTTTT
CTTTCTTCAGGACGGGAAACCTCTAGCGGGTTTGATCCAGGACCACATGGTTTCGGGGAC
CAGGATGACGATCCGAGGCTGTTTTTTCACCAGAGACCAGTACACAGAGTTGGTGTTCAG
AGGTCTGACTGACAAACGAGGCAGAGTGAAGCTGCTGCCTCCAGCCGTACTCAAACCGCA
GCACCTGTGGACAGGGAAACAGGTACGCAGAACTTTTTTCAGTCTTAAGCAAAACGTACA
TCCGATGCTCGAAAAATGTTTAGGAGAATGTATGTTTTTCAGGTCGTGTCCACTCTCCTG
TTGAATGTAATTCCTGAGAAGGCGGTGCCTCTGAACTTGATTGGCAGGTCAAAAATCCCC
AGTAAGGCGTGGATCAAGCTCCCGCCGCGCGCTGCCCCTGGATACCAACCGGAAAGCATG
TGCGACTCTCAGGTAAGGGCGCTTGAAATGCATCTCCACTGCAATGTGGGCAAACGGCAA
TTAGAGGTCATAATGTAAGGATAAATATCTGTAATCTGTGAGAAACTATAGAGAAACAGA
AACAAAAATTCTTCAATTCTGTTCAACCTTTTTTAAATTTTCTTCATCACAAAAATGTTT
TGAGCGTCAAGTTTATTTACATCAATTAATACAGCTGATTTAAACTTTATTTGTACACTA
GAGTTTGAAATAGGCATCATTATAAGAAATTTATTAATAACTTGTTTATTTTTGGCTTCT
CTCATAAAAAAAAAAGGTGAAGTTAAAAATGGGCTGCACCTGGTTTTTGTCTGAAATCAG
CATTTTTAGGATCTGCCTTCAAGTTTTTAACAATTTAAATGTTGGATTATTAATCAATCA
TCTTTTTTTGATCTATTGCAAAAGTCTTCTCACCTGTCTCTTAATTATTATAACGTTTTT
AGCCCAAAAAAGTTGTTGGTGGGAGTGTTGGCGCAGAGCAACCCCGTCCCCTCTTCCCCT
CCCCGTTGCTGAGATCTCAGAGCAGGCAGCTTGAGCGTATTTCCTACACTCTTTTTCAAA
TGACATTTTTTCTTCTGCTCCTGATTCACAATAAAGACTAAAGAGACATAGTTAGAAAGT
CAGAATTATTTATTTCTTTGAACACATGACCTCCATCATATTTAAACATGTAGTTGTAGA
GTTGGATAAGCTCATTCTTCTCCAAGAGTTCTGGTACATCGTTTGTCGGTCCTGGGGAGA
ATCCCTCCTTCATGTGGACAACTCTGAGGTTATTCCTTTTTTTCCTGGAATCTGTTTTTC
TATGAGTTTTTCCTTACCGAGAAGGAGGGTCTAAGGGCAGCTTAGTCTGTTTTTATTACA
CAGTTAGTCTCTGTAGTTTAGTTAGTTTAGTTTAGCGATTACCTATTGTGTTTTACAACA
GATTTTATGTTTTGTACAATTAGTGAAGCCCGTTGAGACAACTGTGTTGTCATATTGAGC
TATAGAAATAAACATCATCAGACAAACCCCACATGTTAAAAAAACCCCAAAACACATTTT
TCATCTGCGTGAGTCAATAATTAAAGAAACTGTGGTTACTTTTAGAACAAATATGAGATA
AAAGGACCTAAAATTGCTCTAAGATCAACTACCGTAAAAAGCCAGAGATGCTCCCATTCT
CCGTAGGCACTGATTTTATGAGTCAATATTAAAAATGTGTTGAACGTTCTAGAAAAAGGA
AAACCCGAGAATTGACCGCCGTTCTTTTGTCTTGCAGGTGGTGATCCGACAGGGGGAGCT
GTTAGTCGGGGTTCTGGACAAAGCTCACTACGGCTCCTCCGCTTACGGTTTGGTCCACTG
CTGCTACGAGCTGTACGGCGGGGAGACCAGCGGCAAACTGCTGGGCTGTCTGGCTCGACT
CTTCACCGCCTACCTGCAGCTGTACAGAGGCTTCACTCTAGGTGCAACATCCAGATATTT
AAAAAAAAACCTCACTTTTCCCTCCGCCGTCTTCTGGAGTCCCATTTCAAACTTGGCTGT
TTCGTTTTCCCCGTTAGGTGTGGAGGACATCCTGGTGAAGCCGGGCGCCAACAAGAGGAG
GAGAAAAATCATAGAAAGTTCCCGAAACGTTGGCTCCCAGGTGAGTCAAAGCACGAATGA
ACCCCGACCAGAAGTTCAGGTGATGGAAATGGCAGCTTTGTCAAATTCAGTGCCTCCTCC
TTCATGGATGTCACTGGCCAAAAGGGCTGCTACAGTGAAGATGTAGCTTATGGGCCCCAG
CGTGCCTCCACGCAGCAGCTGGGGATAAATAGTGCTACAAACACTTGAATGTTGTTCCTG
AATGCTAACATCATTGCAGTTAAAGGGGATTCAAAAAGGTTCTGTAGGTCTAAAAGATCA
TTTTAGACACAACAGTGGAAGAAAAGGTTACTGCTATCTATTTCCTGGAATGATTAGTGA
GAATAACTGCAGGAAACGAGGAACAAATGTTAGGAAAAGATGTGCCAACAAAGACGCGAA
TGGACGGAAATAGCTTTTTCAGAACCGCCGTTGGAAAAATGTGACATTTCCCCCTAGATT
TTTTATAATTTCTCAAATGCGTTCAATATATTTGTGTAAAAGATGGAAAGAAGTCCTAAC
CTGATCAACCAAGACCTCATAAATCAGTGTTTGTTAAAATGCAAAACACTGAAGCCTTCA
ACCGCCTTTCATGACCTGCTATCGATCAAGTCGGCTCAACCACATCTGATTTGCTTGCAG
TTTTCCTGACTTTTGGCAGAGTGATGCAAAAGCCCTGTCAGGTCGTTAGAAGGTTAAAGA
CTTTGTTGTTGTATTACCTGTGGCAGGTGTGGAAAAATGCTGTAATGATTGTTTATTTTA
TTATTACTAAAATGCAAAGGTAGCAAAAGAAAACATAAATCAAGTCAGCACATGGTGGTT
CTCTATTTCAGCATCAGTTTCTGCACAAAGTCTGTGGGGTTTTTTAAGGATTAAATTCAG
GTGTTTGATCGACCCAATATGCCAAACGGTTGTTGACGAGGAGCCTGAAGGGAAATAGAA
ACAACCATTCAGAAAGATGTCCGCTGACGGGTCTTTATGGGAATTCGGTTTGGAGGTTTT
CAAAGTTTTTGGTCAGAATTACGCAGTTTAGTCACAATTATTACGTAAATCTTACACAAT
TGGTTGTGATTTATTATTTTTTATTTTTTTTAATGTGATGCATACGCAGATTTGTGTCTT
TTCAAGACCGTTTCACGCAAAGTCAAAACCATAAATATTTGGACAGAGACACATTCTTTC
ACATTTTTATGCAATCTTTTTGTTCAACCCATGGAATGAAAGCTGAAAGTCTGCTCTTCA
ATGGCATCTGAGTTGTTTTATTTAATATTCACTTTGGTAATGTACAGAAACACAATTAGA
AAGAATGTGTCTCTGTCCAAATATTTATGGTCCTGTCTGTATGTCTAACAGGCTTTTCAC
GCAGCGATGTATAACATCCAGTTAAAATGACATAACTGACAAATTCACTAATGTTTTATT
TATAAACCGTGCAATAATCACGTATGGTTCATGTGGATTTACGCGTTCTTTGCGTGGTTT
ATCTGCGATCTGTGAAAATTTCAGGTAAAGACAACACATTTTCTCACCGTTTCCACGTAT
ATTCACCTATGGCCGCTTATAATCCATGCAACATGCACAAAATGTACGTAGTGGCTGTAT
GACACGGCCTTAAGACAGTTTTCTGAGGGAGTTCTGCTGCATTAAGGGGGTCTTTCCCAG
ACAAAGATTGTTCTTCTTCTTGAACGTCAGCCAAAATTGAAAAAACTTGTAGTTTTCTAG
GACACAGTTTCTGCAGAGCAGCAGGATTTCATTAGAAATTCACCTCTGAGTTGTGAGCGG
GGCCGTTGGAGCGGAGCCCCCCTTCCCGTCACCCATAACTGAGACCTGTTTGCATAGACG
TCCGTTAGCTGACAGCCCCTCACACCTCCAACGTAACATTTATTGATATTTAGTTATTTG
TACACATTCGCTAAAATCCTAGAATTTTCATATTAAATTTAACCAAATAAATGAGATACA
TTGAAATTAAACAGACAAACAACAACTTATTCAGTTGTCTGAATAAGTACATGAATCAAG
GTGAGGACAGGAAGAGGTAAGATGTTGGCAAAATACAAATTCCACAAAATGTGGCAAATA
TTACTGAGCATTCTTTGACATCAGCGGTGCAACAAAAACTTTTGTTGGAGCTTTTCTGCT
GTACAGTTCTGAGCCGGATGCCAGTTCAGATGAGACGAACGATGAATATAGATCTGCATC
CACTTGCACATCTATTAGTCTGCATTCTGTGTCTCAGAATGGAGCTGAACAGGGAGCAAA
GGTTCCTTTTTTCTTCTTTTCGTTTTTTTACAAGCAGCATTTTTTTTTTATCTGCTCCTT
ATTCCGACAATTTAGATAAAGAAAAATAGGCAGAATGGCAATTTTTGCCTCAGTATATAT
ATGTCTTTATACATGTCCTCCATCGTCATAAAATGTCACAAGAACATATTAAAAACACCA
TTGTCATTGGAATATGTCTTTAAGCCGTTGATCTTCATATTTATAAACAGATATTTTTCC
ATTAACTGTTTTTTAAGAAATATTAATATTAATAATTAGTGAGAATAATAATTTAAACAC
ACTTTTAAGACTCAGTTGTTGGTGGTCTCTAATTTTCTTTTTGTATTACATTTGTTTTGT
CTGCCTTTCATGTATGAACGTTTTTTCAGATGTTCTTTTTCATCTTTTCTAATTGCGAAG
CACGTTGTAAAGTGCTCTAGAAATAAAGATTCATTCATTCAAACTCACATCTACGCTGTG
TTCAAGTGACGGAACTGCCATTCTCCGCATCACTCAGGCCCTACAGGCGGCGTTCAACCT
GCCGCCCGGCGTGGATCCAGCGGACGCCCGCAGCCGATGGCAGGACGCCCACCTCAACCC
CGACCAGAGGGACTTCAGCACGGCCGACCACAAATTCAAGGAAGTCGCAAACCAAGTGAA
CAACGACATCAACAAGGTAGATTCTACCTGCTGACGCCGAGCTGCATAAACACGACTTTT
GCCGGCAGTCGGCTGATTCTCCTGCTTCTTATTTGAAGGTGTGCATGCCGGTGGGACTCC
ACACCTCCTTCCCGGACAACAACCTGCAGCTGATGGTCCAGTCTGGAGCCAAGGGTTCTA
CAGTCAACACCATGCAGGTTACTCCCACCCTCCTTTACAAACACAGCTGGAAGGGGTGTT
TGTATACAAAAATACAAGTAAAATATAATACAGCCTTTCTTTTCGTCCTCAGATCTCCTG
TCTGCTCGGTCAGATTGAGTTGGAAGGCCGCAGACCTCCTCTGATGCCCTCAGGGAAGTT
TCTACCGTGCTTCCAGCCGTACGACCCCTCGCCCGGCGCCGGGGGGTTCGTTTCCGGAAG
ATTTCTCACAGGCATCAAGCCTCAGGTACAGGAATGCCTGAAAGTTCTGTCATTTTTGAG
TCACAAACTGAGCAATTGAGGGTTTTATAGCAAAAGCCAGTCTGTCCGTCATGCTTTTGT
TATCCAAAACAAGCGTGAGGCTCAGTTTGAACCATGAATATTTAAACCTTTGAGGCTTTT
GTTGAAGTTTGTGTAGAAGTTTGTGTTGTGTGTGTTGGACATGTTCGTGTGGCTTTTTCT
TGTGAAAGAGAACAAATGTAATAAAAATCATTTTCTTTTAGCATTTCTACATATTTCTCC
TTTTAAATCGCTGTCAGTCAAACTGTCGTCTTGTCTGAATTCCTGAGCACATTGCTGTAT
AAATAACATTTTCATAGGTCACAGAAGGTGACCTTGCGTTTTATGACTTAGGTTTATGGA
CCAATTCTCAGCACGAGTTATCAGACCATTAAAAAGTACACAAAAAGTTAAAAAGTTACC
ATGAAAAACGGAATAGCAACTTGTTAAACAGATTTATTTCCACGTTCTACTTATGTCAGC
ACCAACGGCCACGCCCATCTACAGTTGATTGACAGAGTGACATGAGAGATGGCTTTTTAA
GACATTTAGGTTGTGGGATTTGGGTTAAGCATCAAATTTATAAATAAAACACCACTGGGA
ATGTTTTTTTGTTCTTGTTTTTAATTGTCATGGGGACTTTAAACTCCAAAGTTGCTCAGT
TGGATTTGAGTGAGTTTTTCACTTTTTGCAAAGCGTAAATGCTAAAATGAGTGACTAAGC
ACAGTTGAAGTCCATCTGACTGACAGCAACTATAAATGAAGTAAAAAATAAAAGAACACT
TTTTTTTTTCTAAATCTGGTTCATAAATGGCCAAATACTTCACCTAAAATACCTAAAACC
CAAATATCGTTGTCATATTAATTTATATTGAAGTATATTCCAAGTAGGAAAAAACCACTC
TAGTAAATTAACAAATAAAGTGAATACTTTTATTTTGTAAATTACAAAATAAAAGTTTTT
TATTGTATGTCTCAGCTGGGTGTAAAATTGTTTTTCCAATAAGTTTTCTGTTTTAATTTT
AAAGCATCAAACCCAATAATCTATTTCCCTTTTTATTCATTCTTGGTGGGTTTTTCTTGT
TAATTTACATGAAAATTCCAAATCATTCCACCTTAATGTTGTTTATATCACTATTAAAAA
AATAGGGTTTGTTGTTTTGAATATATCTGAAATACTAATTAAATTAGAGGCAGTTTTGTA
CATTGATAGGAATATTTAGGGCTAATCAGCAGGAAAATGTTTATTTATTTCTACATTTAT
CTCCACATTTTTCTGGTATTTAAATGTTGTCAGAGGTGATGTGCATTCATTTTTCCTGGA
AAACAAAACATTCTTTCATTGTAGATCATCGTTGTAAATAAAAATTAGTTCTCAATTGAT
CTTTCTGGTAAAATAAAGGTTAATTCAAAGACATAACTAAAATAAGCTAACTGTGTGCAG
TTCCAGGCACTATTGGAGGCATCTCAGGGTTTACACGGGTTTGAAACCTTTTTAGATTTT
ACTTTAAAGTGCTTGACAATGGACTTGGTTAAAGTTATCCAATAGTATTGTGAGTGGCTT
ACATTTACCTGTCAGAAAAAGAAAACAAAGAATTTTTGGAATTTATGTTTTTCTTTTGTT
TTTTCCTTTTTCTTTGTCTCTTTGTCATCAGGAGTTTTTCTTCCACTGCATGGCGGGCAG
AGAAGGCCTCGTTGACACGGCTGTCAAAACCTCGAGGTCTGGATATTTGCAAAGGTAACA
CGACACCTTTTTTGTTTTTTTGTAATATGCATAGTGCAGAAAAGTTTGAGTTAAGCAGAA
ATAGAAGAATTAAATCCTTAAAGAGGTGCAGATAAAAAGCCTTTAATTCTCAAATTCGTG
CTGGTTCCAACAATCAACCTGCCAATTACTGGCTGTGGTCTGTGCTTTTAATGACTTCCC
CTTTCGGGGTTGCTTTACCCAGCTACTGTTGGGTAAAGTCGGGGCACAATCTGGGCAGGT
TGCCAGTCTGCCGCACCTGAGGAACTATTTTAGAATCCCCAATTAACCTATAAACCTTGT
TTTTTGGACTGTGGGAGGAAACTGGAGTGTCTGAAAAACCCCACGGGAGACCATGCAAAC
TCCACACAGAGAGGGATTTGAACAAGGACCTTCTTGATGTGAGGCGAGAGCGCCACAGTG
GCATTCCAGCCAGTCGCCATCGAAGGAGCACCTCTAAGTCAAGGCAGGGTGGATAGCACT
ATATTTTCTTCTCCAATCCGTCACGTTTTGTTTGCAGATGTATCATAAAGCATCTGGAGG
GTCTGGTGGTGCAGTACGATCTGACTGTGCGGGACAGCGATGGGTCTGTGGTTCAGTTCC
TGTACGGTGAAGATGGCCTGGACATTCCCAAAACTCCCTTTCTGCAGCCGAAACAGTTTC
CCTTCATAGAGGACAACTTTGAGGTATTGTAAAAGTTGGCGTCGAGCTCCTGACCAACCG
GCGTTTCACTGCAGCCTCGTCAAATTCAGTGCATCCTCCTGTGTGGGTGTCACTGGCCCA
AAGGGCTGCCACAGCCACTGTGTAGCTCATGGGCCCCACGGAGCCGGTTAGTGGCCCCTG
GGCATAAATTGCGCTACGTACAAACATAAAATCCTTGTGTTGCTTAGTGAGTGAGGAAAG
GTTCAGATACGTTTTTTTGTGCCTCTTTTAACGAAACGCGTCCATCCGTCAGGTCATCAG
GAGGACCCAGAGTTTGGACAGCGTTCTGGCGCGGCTTGACCTTCAGACGGCCAATCAACA
CTTTGCCGCCATCCGGCGCTGGAAAGCGAAGAGAGAGATGCCGAGTCCTCGCAGAGGTAT
GCAAACTTTAGCCAATTATCTGTTTTTCAGGTTTACTGTGGTCATCGCGTTCTGTGGGCA
TCAGTTTCACTGATTTGTTAAAAATTAAAAAAATCTTGTAGTTCAAAAGTAGAACAAACA
AAGTGAAGCTGAATTAATTTAGTCACAAATAAATAGCATTTGATTTAGGGAATGTTTTAG
AGATTATTGTAACATTGGGATCAAAATTTAGAATAAACAATGAACAAAGAATCCCCCACA
ATTTTCCATTTTGGGATTTACGTCGTCTTGCGTGTCTGCGTGTGAATTTCGGTGTTGTGA
TATTGTTTCCTCTCCGTGTGTCGGATGCAAACCAATTTTGTTCTTCTTCTTTGTTTTTGT
TTTTTTTAATTAAAGTTGTTGTTTTTGTGTTTTTGTTTGTGTCAGGAGCGTTCCTGCTGT
TTTCCAAGAAAAAGTTGGCAAAGCTAAAGGATTCCACAGCAGGAGCAGATCTTGTTTCCA
CCAGAAGTCCTGCTGTTCTGCAGGTAATGATTCACAAAAGAAAGTCTTATTACCCCAGAG
ATCGCCTCATCTGATCCAAGCTGACATTAAATCTCCTCCCTTTATTCAGCTTGTAGGGCA
GTGGCATTCTCTGGATGAAGCAGGCAGAGCAAAATACTTGAAAAAGGCCTCCCGTTGCCC
GGAGCCCTCCCTGAACCTGTTCAGGCCCGATGTGTGCTTGGGATCGGTGTCTGAAAGCTT
TCACAGCATCACAGAGAAATACCTGCAGGACAGGAGCAGCGCACAATCTGTGGACACCAA
CAGGTTGTTTTTCCTTCGAACATCAGCTAAAGCCATTACAGTTTATCGTCTGAGTTACGT
TCCATTAACAACCGGCAGTAGGTGAAAACTGTCAAGTAGGATTACAGAGGATTAAAGGCT
GTAAAACCCCACACTTAACACTTCTTAGACATGCAAATTCATCAAACCAAACTCAGATTG
GTTGTCAAGGTCAACAGTCAGGATGCAGAACCAAAAAAAAGTTAGAAAAATTGCACTGAC
AACAATCTGCAAAAGGCTGCGTAAGGCTCACCATAATATACCGAGGAAACGTTGAGTGCC
ATATCCTTAAAGAGGCTGTGTTGTGGGATTTTTTGTACTATTCTGCTCTCTCTATGTATG
GATCACATGAAACAAGATTCTTTGCAGAGAAGTAGTACAGGCAAGAACTCCAATGTTGGA
TTTAAAAGCTGCTGTTTATGTTCCCTTTTCATTTGGCATGTAGAAAAGTCAAAGTTGTTT
TTGGACTGTAGTTCTTGTTTTTTGGGGGGATGCTGTCATGCTGAAGCAACTTCTGCTGTG
AATGACGTACACAAAAAAAACAACATGCAGCTGCTGAGATGCACCAGAGCAGAACACAAC
ACTTCTTTCTGGTGCCGTGGAGAAGTAATCCGAGCGTGAAAGTTTTGACAGTGGCGTTTG
TTTGACTGTGTGCCCTCTCCTCTGTCAGTCTCAGGCAGCTGCTGCATTATAAGTGGCAGC
GATCGCTGTGCGATCCAGGGGAAGCTGTGGGGCTGCTGGCAGCTCAGTCCATAGGCGAAC
CCTCCACACAGATGACCCTCAACACCTTCCACTTTGCTGGCAGAGGAGAGATGAACGTCA
CCTTGGGGATTCCCCGGTAACGCCGCCCCAGCAGCAACTTTCACCCAAAACCTTCTGGGC
ACAAAATGTGAATGACATATACAGTCGGTCAAACTTGATCAAATAGTTTTACACTATTTG
GATTAACAGATACTAAAAGCATAGTTTTAATAAATGTGCAATTAAAATATACCATAAACA
TATTAGATTCTGTCCAATAGTTCTTTTGTTTGTTTGTATTTTACTTCCAAACTGTGTTTT
TCAGCTTGTAAATTTGCCTTTAAAGTAGATTCTTAGTGAGATTAATATCTTAAAAGCTTA
TTGTTCAGTTCTTTCACATTCCTGCTTCTCTGACAGAAAAGTTCACTGAACTGAACTTCT
GTTCCAAAAGAAGATCAATATTCATTTGTTTTTATGCTCGCTCTAGCTTAAAAGAGAGCA
CTGTAACTGTAGAGGGAGGAGATGAATTTTTTATTTGACAGGCAGAAGTTTGGCAGATTT
CTCTGAAAAGGCAGGGAGCTCAGATTACTGTCCCAGTTTCCATTATTACCCAAGGATGAA
ATGAAAGATCTACTGGCTCAACCAGGCTGTGTTTACATTCCCCGAGGGGCTGCAGAATGT
TATCAGATATTGAGACCTGCAGCTTCATCTTCAGATAGAAGTGCAGACAAAACACTTTTA
TCCCCTAAATAAAAGAAAACTTATCCACAATTTCATCATCTTTACCGGCCAGTGTGTGGG
AATGAGGGTTCAAGGCTCCGTTCGTCTGATGCATGTTCATTCCTGACAGACTGAGAGAGA
TCCTGATGGTTGCCAGTTCCAACATTAAAACCCCCATGATGAGCATACCAGTCCAGCACA
CCAAGAAAGCCCTGAAGAAGGCCAAAATGCTGCGCAGGAAGCTGGCGCGCGTCTGCCTGT
CTGAGGTGAGGAAGACCTCTTCAAGTTTTTTTTTGTCGTCAACTCTTAAACACAGTTGTG
TGTGTGTTTGCGTGTGTAGGTCTTGCAGAAGGTGGATGTAGTTGAGACTCTGCAAGTTAA
ACATTTTCAAAAGTTTCGAGCGTTCAAAGTGACCTTCCATCTCCTGCCTCCTGACCGCTA
CAACGAGGATAAACTGTTGACCCCCAGCCAGATCCTTCACTATATGGAAACCAGGTGGCT
TTCTGGATTTTTTTTTAGTTTCCTGACCTGCAATTCCCATTTGGATTTACATTTTTCCAC
CCGTCCTCCCAGATTTTTCCACCTCCTCCTTGATGCCGTCAAGAAGCGAACCGCCAGGCT
GTCCTCCATTGCCGTGGAAACAAGAAAAGCCACCTCCAGGGATAAAGACACTGATGGAGA
TGGAGCAGCTGGAACCTCAAAGGTCTGTTTTTTTCCCTGCTTCTTATATGATTTAGACTT
AATTTTGAAGCGATGAATAAAAACAACATTTGAAATGTATTGAATTTTATTTTAAATGCT
TTGTGTAGGAACAATTTCATGGAAAAGTCTCAGAAAATCTTCATCCTTGTAAAAATTTGG
TTTAATTGTAGAATAACGTCAAGAGTAGTGACATCTACTGGCGAATTGAGTCCATAGCAG
CCTTTATAGATCGCAAATTACCGCGATTTTTGACACCAATAAAGTAATAAAAGGAAGAAA
AAATGTGTCTTCCTTTTAACCTGTTGATCTTTTCTTTTAAATCTTCTACTTAATCACATT
TTCTTTCTCCGTTCATCACGGAGGTCACGTTCTATAAAAGGATAATAAATGAGGAAACCG
AAGATCTACTCGCAATCCAAGATTTATGTAGGAGACACTGACTGAAAAGGCTCTATAGCC
AATCAGGACGAAGAACACAATATGCTGGAAATAAATAGGCATGCAAAACTTGAACTGCAA
AAATTAACCCTTGTGCTATCTTAGATGACCCCACCCTTACATTGACGTGTTATTCCTACC
ATGACAAAGGTGGATAAAGGTGGAAAGATTTCATGTAATCCATGGACACCAGTGAAGATC
ACAAATCATTGAACAAAAAAGGTTCAGAGCACTGTCTAGTGGGTCTAGATGACCCAACTC
CCAATGTTAAAGTGCCTAGGATAGCTCAAGGGTTACATAAACTACAATGTTAAAAAAATT
GTAACCTGAAACCTGAAAAACGATGCAATATGCTTTGTTAAATGAAGTAGAATATGTATT
AAAACGTGTGTTGATTTAAATGTTTCTTTAACTTCATTCAGAAAACTTCACTGCATGAAA
AAACTGAAGCTCCGCATCTAAAAATTCACTTAGACAAAGTAAACAATCTTTAAAAAAAAA
GTATATTTTAAATCAGAACAAAAAGTTCAAACCATTTTAGTTTGAATCGTTTTTCAGGTG
CTTGCTGGTGTTGAACCTAAACTGCTTTTTTGTTGATGGAAAAATAACGTTTAGTTGGAT
GACGGAGAAGCAGAAGAAGACGAGAAGATTGTTGATGACCAAGAGAATGAAGGAGATGCG
GATGCGTCGGATGCCAAGAGAAAAGGCAAACAAGAGGAAGAGGTAGGAACGAGAGAACGC
GTTTTTTGGTGCTTTTCTCTTCCTCCTGTGTTCATGTTCCAGTTGAGACGCTTTGATCCA
ACCCTGAACTCGCTTATATGCCTATAAAGTCGATGTCGTTCCCATATTTTGGAAGGTGTC
TAAATGTCTCTTTCATTACCAGGTGGACTATGAAAGTGAGGATGAACAAGGGGATAATGA
AGCAGAAGAAAACGATGACGAGGGAGAGGCAGAGGTGGAGGAGAACGCAGAAGCACATTC
CACAGAGGAATCTCACCCGGAGTCTTCTGGAATGAGATTGGAGGCCAGGAAGAAGCAAAA
GAAAAAAGTGACGAAAGAGTCGGAGCTCCAGATGAGAGTCAACTCAGTTCTGGATTTGAA
CTCAGCGATAGAAGGCTATCGCTTCGACCAGCAGGATGAGCTCTGGTGTGAGGTGAGTCT
GAAGCTACGTTCACGTTGAATGCGATTCGCGCGTCCGGTTTCATCGTTAAGTCAATGTAC
CGACTCAGTCACATGTCCTATGTGTGCGTTTTCAACGGCAGGACGCAATGTTTCCACAGT
TCAAATCTCTGAACTTTGGCGAGGAAGACATGTCGCATTGACCGACTTTATGATATATTT
TTTCCTATTTGTATGGAGACAATAAGAAAAAGTTCATCTAATTTTATTCTTAGTTTTATT
TTGACTACTTTTGAAGACTGTGACCCAGTTTGAAGATTGAAAAAGACAAAAAGAGACAGA
AGTACCGCTGAAAGCCTCCGTTTCTAAATACATTTTTGTGCATGTTGTGCACACAGACGG
AAAGTGTGTGTGTGTGGGTGTGTGTGTGCGTGTTTTAACTTTGGGGTGCCACAATGTGAG
AACCCGCAGGTTTTTGTGGGTTGGGAGGGGCTGACTGAGCACAGGTTTTTAGAGGAATAC
TCAGAAATGCATGAACAGATCGACACACAGCGTTGGTGTTGTTTTGTTTTTATGAGGAAT
TCACATTATAATACACTTAAAAGTTCTAAAAAGTTTTTTTTAATGATATAAACCCTTTAA
TTCATTTTGTCCATGAAGGCTGTGGTGCAGAGGTAGATTTGGTTCCTGCCCCTCCCCACA
CGTGTCGAAGGGCTAAACACGGAAAGCCACATTGCTGCTAATGGTTATATGTCGCCGCCA
GTGTGTGAATGTGTGTGCGCATGGGTAATTGGGACTGTGAGTTTATACACTTTATAAGCA
TACACCATTTACCATTTAATGTTAAGAGTTCATTCTGCAAAAAAAGCTGCTGTAAAAGTC
TGGTTTCCTTTTTAAACATCCCTTCTAAAAACACGTTCTCTTTTTTTCACTACAGTTGAC
GACGTTTTCCAGAAATAAAGCTTTTAAAAAGTTTTAAGGGTTTCCAGACAAATACAAAAC
ACAGGGAAGCATGAGCCAAATTTATAAATTTGCAATGAATTCTTCATCAAGCTGTGAAGC
TTTTTTACATTGTGGTTACTTCAAACACACACTCTGATGAAAGTTGTAGTTTTGGCGGTA
TTATCATGCACTAACATCCTGCTCCTGTGGCATTTTCCTGTCTAAAGATCTACTAAACCA
CTAACCAGGTATATTTACTTTGTATCTGTTCTGCGGTATTGGCGGCAGCAAACTGCTTTA
TTTGTTGCTTATTTTTATCTGTATTAATACATTTTAAATGATGTTATTTATTAGATTAGA
TAAGTGGGATAAGTTTTTGTCTTTGTTGTAACACAGCACTGCANNNNNNNNNNAGCTTTT
GCATTAACCCCCCCCCCCTTTTTTTTTTTTTCACAGGTTGATCTGGCGTTTCCGGTGAAC
AAGGTCCACTTTGACCTGACTGCCATCGTGTCGACTGTGGCCCAGAACGCTGTCGTCATG
GAAACCAGGGGCCTGACACGCTGCCTGCTGAGCGAAACCACGTCCAAATCTGGGGAGAAG
GAAACGGTCCTCAACACAGAGGGCATCAACATGCACGAAATGTTCAAGTACGGCGAGGTG
CGTATGCGGCGCTGCACCGTTCCCCTTCGGCGCTTGGACGTTTCCAGAATCATGCGCGCA
CGTGACATGGTCTTTAGTCAAAACAGCGGTGCTATTTTGAAGACTTCCGTCACAGTTCTT
CTTGGTTCTGTGTTCTCTAAAGTTCCCTTTTGGAAAAGGACTACCAGCAAATCCTTTTTT
AGAATCTCTATAAATGTCATATTCTAATGAAAAATTAGAATATTTTAAAATTAAATTCTT
GTGTACCTTTTTTCCATCTTCTTCAAATAAAAGATACGATGGCCCTTTTCAGCCACAATT
ATTAACAAAATGTCAGCATTCAGACCAATTTGCTGCTTTGTGGTAGTAAATTTAAATGAT
TTCAGATGAGACTTTAAGTCTCAAAAGCAGTTGAAGAAAAAGTGGGATTACTTTCATTGT
TCAATCAACCAAACTTTGGTGCTTGTTTTTCCAGATCTTGGATCTCAACAGACTGTACTC
CAATGAAGTCCACGCCATGGCCAACACGTACGGGATCGAAGTGGCCCTGAAGGTCATTGA
GAAGGAGATCAAAGATGTCTTTGCAGTTTATGGTACATGCGTGCGCAAAAACACAAAGGG
GCTTTCAAATGGGGGCCAGAGTGTGACGTGGTGTGTTTCTGCATCCAGGTATTGAGGTGG
ATCCCCGACATTTGTCTCTGGTGGCAGACTACATGTGTTTCGAAGGTGTTTATAAGCCTC
TGAATCGCCATGCCATCAGATCCAACTCGTCTCCTCTGCAGCAGATGACGTTTGAGACCA
GCTACAAGTTCCTCAAGCAGGCCACCATGCTGGGTGAGAAACCATAAGGACTCTAGTGTC
TCTGCTACTATGGAGGCATGTCAGTTTGTCTATCTGTTACAAATATTGTCGAAGTTGAAC
GACCCATTTTTTTTTCAAAAGTGTTCTCAGTGGTGTTTTAATCATGATTATGCTCATTTA
GCCAAAATAAGAGCCTACGTTTTTTGGAACATAGTTTCTGCAGAGCAGCAGTAGTTCACT
AGAAATTTGCATTCTGAGTTTTGGGCGGGATCGTTGGTGAGGAACAACCCTGCCACCACT
TCCCCTTCCACGTTGCTGAGAGCTCTCTGTTTCCACTCTAGCTTACAGCTCCTCACACCA
GCAACGTAACATTAGCGGTGCAACAAAAATGGCGAACAACATCAGAGCTATCCAGCCCTA
CAGTTTAGACCCAGATAGCGGCTCAGAAGAGGGAAGACGTTCATGGATGTAGTCGCCTGC
AAATGCATGCATCGTAATGGAGCAGAGCAGGGAGCTTGTGGCCCCGCCCATTATAGTTTT
TGCGTCACAAATACGATCTTTTTCAAACTGCACTGTTTTCATCTGCTCCTGATTCACTGC
GATTTGAATATAGAAGTACTCAGAAATGCAAATGTAAGCTTAATTTCCTTGTCAAATGTT
CTCTATCATCACAACAACATGTTCCAAACACCAGAAAGAAAAGTTTCATCGGAGTGAGTC
TTTAAAAGACGGTGGTGGTTTGAGGTTCTCACAATGACTGTTTGTGATCCTCAGGGTCAC
ATGATCAGCTGGAGTCACCCTCCGCCTGCCTGGTGGTCGGAAAAGTGGTCAAAGGAGGAA
CAGGACTGTTTGAACTGAAGCAACCCCTGCAGCACATTAAGAGTCATTCTTAGATGTCAG
ATCATAGAAAATCATTTTCTTTTTATGTTGCTTGTGAATAAAACAATGACTTCAAGATCG
CCTTTAAAGGTCTTCTGACATAAGAGGCTGATCGGGTTTTTGTCTGTATTTATAGATTAA
TGTGTAAAACAGTAAAAAATATATTTGATTATTTGTTGCCTTTGTTGTTGTTTTTTTAAC
TATTGAGTGTTCGTGACTATATGGTGACTCTATATGTTTTAGCAATTCAGATTTAGTCCA
GTTTTTTTTTTGCAATCTTTCAGCAACAATGACAGAAACAGCTATCTGCCTTCAAAACAA
AATAAATGGGGGAAGTGAGAAACTCCAGCTGCACCATGAAGATGACTAAAGCAGCAGAGT
ATTAAATGCAGAACAATAAAAAACTAATTTATTATGCACTCTTGGTGTCTTAAGCTTTTT
TTATTTTGTCGTCACCAAATCCTGGCAAGATATTAATTTTCCTAATCTGGTTGTAAACAA
ACGTATTCGTTAAACATTGCTGCAGAGTTTGTACTCTGTACACTTCCTGTGTTGTCTATT
CTGCAAAGCTTTACCTTAAACACATATGCACATACTTGATTAGTGTACTTCCCCCTGGGG
TAGGAAACGGAAATTCCTAAATAGAAAAAGAAATGCAAAATTAAAAATGAGAGAAAAATG
TAAAGAAAAGTAAAAAGACCTTTTTTGTCATGTGTCTTATGTTCTGCCTTGCAAGAAAAA
AAACCTTATCAAGAATGCTTTTGAGTAACAAAATACTATTAAAAAACAGATGCAAATAAC
CAGAAACTAAGAACTATTGATAAGACCATTTTTCTTTCCCCATTGACAGATTTTTTGTTG
TTATTCTAGGAAAATATTTAAAATTTTAAGAATTTTCGATTTCTTTCCGGGTGGCCCACT
TTTGCAATGCAAGAGTCAATTATTGCATGAAACATAAAAGAAGAGTAGCTTGAATTAAAA
TGGTTTGGTTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1153, 1315..1426, 1566..1661, 1744..1893, 1989..2099, 2173..2270, 2370..2458, 3008..3130, 3411..3528, 3612..3753, 3894..4091, 5065..5187, 5266..5493, 5567..5674, 6635..6781, 7210..7401, 7482..7631, 8917..9100, 9197..9279, 12037..12195, 12278..12376, 12472..12624, 14311..14393, 14917..15082, 15352..15475, 15885..15982, 16069..16262, 16948..17115, 17869..18004, 18079..18233, 18312..18441, 19301..19357, 19494..19601, 19762..20031, 21396..21596, 22054..22171, 22248..22412, 23154..23251
1077..1153, 1315..1426, 1566..1661, 1744..1893, 1989..2099, 2173..2270, 2370..2458, 3008..3130, 3411..3528, 3612..3753, 3894..4091, 5065..5187, 5266..5493, 5567..5674, 6635..6781, 7210..7401, 7482..7631, 8917..9100, 9197..9279, 12037..12195, 12278..12376, 12472..12624, 14311..14393, 14917..15082, 15352..15475, 15885..15982, 16069..16262, 16948..17115, 17869..18004, 18079..18233, 18312..18441, 19301..19357, 19494..19601, 19762..20031, 21396..21596, 22054..22171, 22248..22412, 23154..23251
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved