Oryzias_latipes Locus LARP1
snOPY snoRNA Orthological Gene Database
Oryzias_latipes LARP1
Oryzias_latipes
LARP1
14
SNORD111, SNORD111
19052..19129, 20191..20271
26824
GAGACCATAAGAGCCGTGATCTCTGGCTTCATGACAAACTCAACAACCTGAGTGCAGCG
TTTAGATTATAGATTTATTGTTTAGATTCATTTCTTTATTATTATTATTAATCGATTGAC
TTTGACAGTGGAAAACCATAAAATGACGTAAAAAAATTGGCTTCTTTGTGACACTGAATA
GGGTTTTATTGGAAAACTATAAGCGAACATGCAGTCAATAATAATTATAACAATAATAAA
GGCACGTTTGTTTACAACAGACTTTATATTTTCTTTTATGGTAGTATCGTAAATTGTCCA
GACCGATGACTATCTGACACGTCTTTGGACCAACGTACAGCCAGTCACATAATGTGACGT
CAGCATTAGTCCCAGGCCCAACGGTTATGGTACCTACAACGTCTTGAACAGAGAGCTCTC
ATCAACGGGGAAGGGAAGGGTGGCGGGATTGCTCTGCAGGAATGGTTCCACCCATGACTC
AGATGAGAATTTCTAAAGAGTCTAAATGCTGAATGCTTTTGATTAAGACAACGAAGACAT
GAAAGATCATTTAAAAGCCTTTAATATTAAGAGCCAGAAGAAGCTCTAATCAATAAAAAA
AATGAATACATTTATTGATTTAGCATTTGTTACAGGCAAATACCAAAAAGTGCTTTACAA
GGTATAATAAAAAGGTAATACAAATTAAATTAAATAATTACAAAAGTCTCTTCTGTGATA
GTCAGGGGACCATCTTACCTTACTTCTACCTTATTTTCCATTTCCGTGTCTGGACTCCAA
ATTGTAGTTTTAGGTCTGCACTCAGAAGTGTAAACACAAACTAAAGTGTGAAAGTTCTTG
TCCTTTAGTGCCACACCTGAACGCAGATCTGAACCAATCTTTTGTTTTCAGTTTCAGGGA
CTCTTTGAATGTTTGTGTGGCGTGTTTGTGCAGAAGTTATTTCAAAAGCCAATGACTGTA
TGTCTATTTCATTTGAGTTTATTGAACCGCTCTTCGTCTGTGTTCCCGCAGAGCCGAGCG
GCCCCGCCAAGGTGGTGCGAGCAGGGAATCCGCCCAAACCCCGGCGTGGAGGAAAGGTAT
CATTTTCTGTTTGTGTGTCTGCTGAGGAGCCTCACAGATCGTCCTCCACGATCATAACAA
CATCCTTTGTGTCGTTTGTTGTTGCTGCCATGCTTTTGGACTTTATAGAAAGAAGCCTGT
TCACAAACAAATACAATAAACGGTCATTTGTAACTCTAAAACAATCTCAGTACTGGATTG
TTCCGCCTGCAGAATGTAAAAGATTGTAAGTTTAAATGTTCTGGGAGCATCTTTCTGTAA
CTTCTGCAGTCGTACATGAGTCGACGCCTCGGTCACATAATTAACGCCTCTCTGGCTGTG
GCGCTCCAAACGCACGCCCACTTTCTCCTGCTGTTTCTACAACTTCAGAAAAGAGGAGCA
GAGCGAGATGATGGAGATAATTTAGGACATAATGAAAGCGGTTGTCTTCCACAGCTTCTC
GTGTTCCCCTGAAAGCATCAGACAGAGAAAATGAAAAGGTCACGGCGCTCAAAGCGTCCG
GTTCATAACATTTGAGTCCCGCTGCAGCTGAATCACCACAAATTTTTTATGGGGGTCTTG
AACTAAGAATTAGCTTCTCCAGTTTAGGGCATTGATGTGTTTTCTGCCCTCAGGCATCTG
AAACCACATCACCAGATCTACTCTGGGGCTTTATGTCGTCACATCTGCTGATGCAATCAT
GACATTTTCAGTTATTTTCTATTGTTATATCATGTTGAAAGGGTGATTGTTAAAAAAATA
GAGCTGAAGTTGTTTAAATGTGTTCTGCTCAATAACAGGTCTCTGCTTTATTTTGAAGTC
AAAGCAAATGTTTGATTCAAAATCAGTTTATTGCCAAATTTGACAAGAGCGTTAAACTGT
CTTTTTTTTTGGAAAAGGAAAAAAAACAAACATATTTGAGCAAAATTGAGTTTTTCTCCA
ATTAATCCAGTTTACAGGTTTCCTCAACGTCCAGAAATGTAAATAATTTTTTGCACCAAA
TAATGTTTTCCAGTTTAAATAGATGGCATTATGTGTTATGTGTATTTATTTTCATAAATA
GAAACATTTAGCGGTGACCCAAAACCCTCAACTGTTCTTTGCAACTGAGATCCTGTTTTC
TGTAAATGTTTGGGATAAAGAGCTGGAGGCTCAGTTTTCCTGCAGATGGTTGTTGGATCT
CAACTTCCATACGGTTCAAGTTTAGAGAAGCTTTACTCTTGACTCTATTTTATCCATAAA
ATACTTTTTTCCCCTTGTTTTTTCTTCTAAGGTTGGAGACTTTGGCGACACAAACAGCTG
GCCGACTCCTGGAGAGATCGCAACTAAAGACATGCAGGTAAGTTTTCCCGTTTGTTGGTT
TTGAGGCTGAGATCGTCTGTTTTTATCGTTCAGTCTCGTCGAGGCTTTTTATCTCTTATT
TAAAGAAACCTGATCAATTTTTTGAAGCATTTAAGTTATATTTAATTTTAAAATAAGCTC
AGTTAAGGTGATCTTTATTTTGAAATTGTACTTAACACAGGTGTTATGTGGAGCAGATGC
ATAGCTCCTAGATGAGGTGATCACACCTTCACAATGAAAAGCAGGAAAGGAAATCCTGCA
GAGGATCCTGGGACCAGCACTAAACATTACAACAAAATGCTCCAAAGAACAAATAACCTT
TTTTTTTCAAGTGGTGGCTAAAGAGTAAAGAGCCAATCAATATTGTCCCAATCAGACACG
CGTTTTTACTGCACATATATGAAAAAGCAGATAGATTCTTCCCACTCATGATGTGACATT
TAATCCACATGGCATTTTTGTCTTTGTGTTTTTATTTACAGATATGTTAAAGTGGAGAAG
CAGACCAGGAATTTACTTATTTGTTTAAATAAATAGGTGTCAGTTAGTTCATACAAAAAA
CATGGTTTCCATGACTTTTATGACTTGTTAGTATTTTCATTATAACCTTTTTTCCTTAGT
TTAAATGTTCCTTCAAATGTTTAAAATTTGAGTTTTTGCCACAATCCTGTGTCGTAAAGC
AAATGTATCTTAATTTATGCTGCTCACACGTTTAAACCCAACCTTGTTTATTGTTTGAGT
TCTGATGCTGTGATGAAACAGGCAGTTTGAAGATAAAACTCTTGATATTTTTGGGAAGCA
GATCATAGTTCTGCTGGTTTTTGCAGAGTTTTCTGTGGTTTTTACAGTGTACAAAGTTTG
AAATATTCACGTGGTTCAACAAAAACATCATCAGAACATCCGGATAGTGATCTTAAAATA
GTTCCATCATTTGTTTTTGGGGCCTTTTATCTATTCAGTCCATTCTCAGAGTCCCTGTTA
GCTCAGCCTGGGATGCTGCCTGGGATACAGTAGCAGCAGCAGCCACTTTCTATTTTTGCC
CTCTACATTGTAACCTGGCATTGAACCAGCAACCCCCCCTCCCCATTTTAGGCAGCCAGG
TCTGCGCGCACCAGAACATTCCTGAGCGTCAGAATATGGGTCACTGCGTGAGCACCAGGA
ATAACCCGCGGTTCTGAGGGTGGAGGCCGAAGGTGGGAGGGGTGTGGGAGTCGTAGCCGA
GGCCTGGGGGAGGACATCCTTTTAGGGACCCCCCTCCGTTTAAAAAAGAAAAGACCTGCT
GGATTCGTGCTGCTATTTTTAGGGCTGCTGGAGAGCGATGTCCGTCACCCAACGTGTAAG
GCCCTAAATCACATTCCTGACTCCAGGAAATGGAAACTGAACCCTGATAATAGAGGTTAA
AAATGCTGTGCTCGGTCTGCTCCAATGTAGACCAAAGAGTTTATGCAACAGCGTCGACTT
TCTGTGAAGTTTACGCTTCTAACTCTAAATTCACACCAAAGAGGCAGCAGCTCGCCACCA
GACATCTTTCTTTCTGTTCAATCACAGCAGCGCCGTCGTACTGTAAAGGTTGGAAGCCTA
ATTTTCCTCTGCGGAAACCTGCTGAGCCACAGCCAGCGAAACACAGGAAACTGGCTCCAA
GTGGCAAAAGGACTTCTGCTTGGCTTTCAAAATAAAAGTACTAAAGCAAACAAACAAACT
GGCATACTTCAGTAGACAGTAACGAAGAGAAGTGAACTCTTGAGGTGGAGACATATCCCT
GGTCCCCAACCTTTTTTATTGGCCACAGTCTGGTCTAATGTCGGGCAATCTTTTCATGGC
CCAGCCTGTACGAGGCCAAGGTTTCCATCTTTGGTTTCCCTTAACTTGTTAGGCAAATGT
TTCAAAGTGTCTGTGACACTAACTTCATCCTTAACCATCAAAGGCGTTGCTATAAAAAAG
AGGCATCAACCTCAGCCATGTCTGAGTTTTAGGGTGTCGGATTATTACAAAAAATCAAAT
GATACAACTGTCAGCAAAATATAATAACAAACCTTATTACCAACGACCTGATGTGTTTGA
ACAGTGGTCACAATCAATGCACATTTTGAGCAAGAACTCCTATGTTGAATGCACTTTTCT
TATCAGTTTTAAACATTTCTTCTGTTTCCAGACAGCTCTTTTTAGTCCAAACAAACTTTC
TAGAGACGTTTGTTTTTTCAATTAAATTTGCCCGTTTGAGGGATTTTAATTTAGTTGTAA
CATTACCGGCCGAAGCAAACGTTTTAAGGTGGTCACAGATTTATTTAAGACTAGTGACCA
AGACGAAAGACTTAGCGGGAAGAGTCAGAGACGGATGGGCTGGACAGAATCCAGGAGTTT
TACAAAATAAAACTTCCTTCAGAAACACATAGGAAATAAAAAGGAAATGTTATTTATGCT
GTGTGGTACCAACCAAACCGGAATTACTGAAATGACCCCCCCCAGTTCGCATCCCAGGGG
TTTGCGATGCAAAACACTCATTTTATAGTTCCAGACTCCGTCTTAGCTTTGACACTTTAT
AAATAGATGTTCCTTCCTTAAACCAACCTCAGCTTCAATTTACACTATCAAACAATCAGA
AAGTAAACTTACATATACACTAACTTATTGCTTTATCTGGAAAAGTGGAGGTTAAATGAA
GACATAAAAACATCAGACTGCACGCACCTCTGGAGATCATTCACAAATTTTCAAAATGTA
CCAACAGCTGGATTTTCCCAACCCTTTTCACATTCCAGTGTAAGGTGATTGATTGTGTAA
ATTAAGAATGTAGTGAATGTTGGTTTAGTTAAATGGTTTTACATGAGTTTGACAGAGCAG
TGTTTTATACTGGGATGTTTGTAGTGAGGATGGAAAACGTGGGATTCTGGGTTTTAATGT
TTCTTTTACAGGTTTTTTTTCATGCTTGTGATCAAAGTAGAAAAGAGGAAACAGCTAGTT
TTAATGCAATCAAACTGGTGTTTATGGAAGATCATGGGATGAGGTCATCAATCCTCCGTC
TGAAAAACATTTTAAGTTGAAGTTCTGTCATGAACATTGTGGAGTTTTTGTCATTGCATA
TCGATAGAACCCGTCAGGACGTGTTCAGATGATGAAGTACTTAATAATTATTTGAAATAA
CACTGTCAGAAACCATCATAGCACGTGCAGATCAAGAATAAAAAGTCAATAATGTGTGTG
GACTATTTATCCATAGAAAAATCACTCATGTAATTTGACATGTTTTAGAAATCATAGCAT
ATGCAGATTCAGTCATCAGATCCTCATCGGCTCTCGCCGGACTCCACGTCGCATACCTGC
TCCCGCACTTTTTGTTTGTTTGTCCAGTTTTGCTGCAGTTACAAAAGCAGCTGTTGTGTT
TTTGTCCAGTCGCTCCGTCTGTCAGCGTGGCAGTCGGTGCTTCTGGGGGTTAAAACACAT
CTAAACAAACTGGATCAATTCTAACCGTCAATCTGATAAATCGATAAAAAGATTTTCACT
TAGAAATGGATCCATTTTGTCATTTATGTGATTTGTACATTTGAGAGTGTGGAGAACAGG
TCTGCGTAGCGAGGAAGCTGCTCATCCTCTCCCTCATACAGTAAGATTGTCTGTTTGTGT
GTGTGTGTGTGTGTGTGTGTGTGCGGTCCACCTCATTGTCGTCTCTAAACTGCTCTTCCC
TCCCTCTGTTCAGATGGAGGCAGAGACACGGACCGTGTCCTGCCCGCCGACTGTCAGGCA
GGTCAGAGACTCATGGAGAATCAGTGTAAGTCCATCCTGATGGGACCTCCAGCCTGCTGA
CATTCAGTCTGTCTCAGACCAAAAACCCAAAAGCTGAACGTTCAGAAACGACGAAACGTC
TCAATCAGTGCTTCAATGACTGTAGGATCAGATTTATCCAGTTCTGATCTGAAATCATTT
TATGAAATTCTAAAAGTTTTAGGTTTAAGGATTAAAATAAAACCTTTTTTTTATACATTT
TAACACGTAGGCAAAGGCGGATCAGCTTTCTCACGTTGCTCTGGTTGTTGGGACAATTCT
CTATGGAGAAGGCTCATGTTATTGTTGTTTTTTTAAGGGAATTCACAGTAAATCTGCAAA
TACACACATATTTTAACTATTGACTGCATTAGAACTGGACTGAGTGACTCCTCCCCCTGG
CGTTCCACAGGAAGTACCTGCTGGCTCCAAGAAGCCAAACTCCCATATTTCTATAGAGAA
ATACGTCAATTATTACTCAGTCATTCTTTTCATCAAAATAGCTCTGCAGCCTTTTTTAAA
AGGTTCTTCCTAATCTTAATAATGTTCATGATATAAGTTATTCAGGTTATAAACGGACCA
ATCAGATGCCTCAATAAAAGTATGTGGTGCCTACTGGCTTCCACGTCGAACCCTTTCAAT
TTGTCAGATTTCCTATAGCCTGCTTTTACATGGAAGGGGGGGGACAACTTCACTACTGAT
CAACAAAAATGGTTGCCATAGAAACAGAGACAACTTTTCCAAGATGGCGGCATCTATATT
GCGAAAAAAAAAATGGCAACTGAATTGACAGAAGTAAACCAGTTTTTATGGATGGTGTAT
CGCTCGCTCCTCTACAGTCAGTGGCTCCAACCATTTAGTCGTTTATTGCCCCGCCAGAGC
ACCTTTAAGTTGCTTTCACACTGAAATATTCCCCCAGATTCCAATGGGTTTGTTTTTAAG
ACGACCAAATACAGCTTTACAAAAAATCCTGACCTGCGGGGAAGGCAAAAGTACAAAGAA
CACCGTTTTCATCTTTCTCATCTCCTGACTTGACTGTTTTCCATAATTTCTTCACCTCCT
TTGCACACTACTTCTTATACCCATAAGGCATTTCTCCTGCCTTTCATTACCTTTTTTTAT
TTTCATTGTTTCCTTTGTAATTCACAGAAAAATCACATTTCTGTGGCTCACCTTCTTTAT
CTGTTCCATTAAAGAGTCCATCTGCATTCACACTGTAGTGAATAACATCAGGGTTCATTT
GCAAGACATTTACTTTTTCAGTGGGACCATAATTACAAGAGAAGTCATGTAGAGAGTTAG
TTCAATGTTAATAAGAGGGATTTGTGATGCAGTTATCTTTTCAGCGTCTGGTGGGATAAA
CTTCCTGCTTTATCTACAGGAAGGGTACCAAGTCACACAAATGTACAAACCCGTGGCGAT
AGCACAGAAAAGTCAGATTTCTCCAGAGATTCTGTTTGTTACAGAAATGTGGAGTCTTTC
TCCAATGGCCCCAAGATAAGAGTATCAAACCAAAAGCTAACATCCTCTGCCGGAAAAAAA
AAGCCCCAACCCGGTCACATGGATCCAGACGTTGGTCTCATCCATTCCTCACAGTGATTT
CAAGAGTGAGGATAGAAAGTGTAATTGCATAGTGATTCCTTCATGCAGCCTTATTTACAT
TTGAGTTGGACATTGTTAAAGGGCAAGCGGTTAAATGGAAAGGCCAGACATGTCATTACA
CATTAGCCTAACTATTGTTAACAAATTAACAAAAAACGCAAACATCGACAGAAGCTACCA
ACGGTCTTGACTGTATACTCGAATACTGTATACTGACCTGTTTGATTTAAAATATTTAGA
AGCTTTATTTCAGCCTGGCTTGTTGATAACTGCTTGTGTAACGTTTTAATTTCTGTTTTA
AGCATTTCGACCGCATGATTGCAGTGGTTCAAAGCTTCTGGGAAGGAACGTTTTGGCGGT
TTTTGTGTGTTTGTTCAGAGTGTTTGAGCGATGAAACCAATTTCCATCGCACTACAATAG
GTTCTCATCGTCTTTAATTAAACCAAATCTTAAAGGAATCAAACTTAATGTGAAGTTTTC
TTTAAAGATTATTGTATGTGGTAATTTTAGAGTGAAGATTGTATCTATTCTGGCTTTTTT
TGGCAAAGTGCTTCACAATTTCCATAGATTCCAATGATGAAAGTTGATTTTTAAACCTAT
TTTTAAAAACTTTCTGCTTGTTTCTAAACATCTATGTTGTACTTGCTGTGAGCCAATCAC
CTGGATCAGTTATCAATTTAAACCTTAAATCACCTGATCCTGCCATCAAGCAGTGATTGA
GGCAGTTAGGATGTCCTACATGTATGTGTTAGATGTTTAAATCCCCTAAACTTTCTATGA
AACATCTGTTGTTCCGTTCCTCAACATTGATCTCAACAAGGTTCCCTCCGATCAATAAAA
CTGTCCCACACTGTTATACTCCCACCACCGTGTTTCACTGTGGGATTTGTTTGGGCATTG
TAGTCTTTCACCAAAACAGACAATGTCTCGCTCAGTGACACCAAGGCTATGACGAATTCC
TTTCTAACCCATAAAGACTATCTATCCAATGCTCTGGACTTTAATGCAGTTGGGACACAA
ACTCACTACTTTTGTCTTTAGTGCCAAATATGACGTCAGCCAAAAGTAAATATGAACATT
TTACAAAGTCTGAGTCCACTGTGTTCTGATGATTAAATTTGAATGGTTTACAAAAAATAC
ATTTACCTCGATTTTTCTTTTTTTCTACAAATGTTTGATTCAAAGGCAATGCATCGTGGT
CCATATTCTCTAATGTAGTGAGCATCAATGCACACTAGTTTTTCCGAGAGACTCCTGGGA
AATTTCCAGGACACTGGGCTTTGGAATTGTAGATTTGGACTCCCCAAGAAAATGGCGAAC
GCCCTTATAGTGCACTAAGTAGTGAAGGACTTTGAACATAGCCCAAAAGTTGAACGCTCA
CTGCCCTTCCCCTATGCTTCATGCTAAAACGGTGTTTGTTCGTTTGTTTGTTTGTTTGTT
TTGGATGCAGCAACCCCCTTTGAAAGATCAGGGGTTTTGAGTTTAAGTTGCACTCTTGAC
CACTCCTATGAGATTTGAATCCTTGGTTCATTGGTTCCTTGCTATATCACGGTTCACCTT
TTGTTGTAGACCACCGTCAGTCAGTCTCCTCTGTGTCCTGAACAGAACGCCATCACGTCA
CTAAATCACGATAAGATCTTTGATTGCTTTCTATAATGCTGAACTTGTTTTCCACAAAGG
TTTGAGCTTTGAGAGTTTAAACAAGTGAAAATGTTCATGTCTGTCTGAGAAAAGTGTATA
AAGTTTGTAGTTAGGGGGTCTCACTGCCCTAAAACAACTAGAATTATGGTCAAGAATGAA
GATGATGTCACCTATTGCTGGTTATTTTAAGAACCTAACTAAACGAGGGACTGCTGTACT
GCAAGCTGTTCTAGAGAGATCTGAGAAGTAGATGTGATCCTTGGATGACGTCACTTTTCC
CTAGAGAATAGTCTCTTATTGGCGCAAAAAGAAAAACCACACTGCTCATCCAGAAGTCCA
TGTTCTAGGTGGGTATGTTCGGGAAGAGCTCCATCGTTTCATGGGAAGCGTTAACTGATG
GTAGGAGCGAGGAGTGCTGCAGATGTGTGTGTGGCTGATAGCTGAGGAGAGGCGGCGCTC
TGTTCCGTTTGAATGAACGTGGGTATCGCCTCTGCGGCCAAAGATAACCGGCAAAGCCGA
CTGCTGTGAGCGCGCTCCTCACCCGCTCCTGAGATGAGGCGGTGTGAGTCTGCAGCCAAA
TGTCATGAGGGGATTTAACACAAGACGCTGTTAACCTCATGCAAAGCTGTCTTGGTGAGA
TAACCAACTAAAACTAACCTTTAACTCGGTGATGCAGTAGATATAACCGGTATTTTAAGA
TATTTAATGCTGGGTTATTATCTGCGCTTTTATTTGTTCAGTCAAGTCTACTCTGGACTT
CTTTAGTCTGAGAGTTTCTGGTTTCTTCTTCCAAACTGGTGTTTTGGTCATATTTTGGTT
TTGTCCTTCACTCAGCCTTGTCAGTCTGGCTGGACCTTCCAGCTGACCGTGTCCATGGCC
CAACCAGCACACCTCCTCACCTCAGGCCGGCTCTAATGGCTGTTTTCAGGCAGGTCGGCC
TTCTGTGTCACTCAGATGAGACGTGGCGGCCTCCCTCCTGCCCTTCAGGTCTCTCAGTCA
GCCGTTCACCGCTGCAGCGACGCCCGTCTCCAGCAAGTTCAAATAAATATTCATAAAGCT
GGGAAAATGATAAAACAGTAGTTCACACGCTAGGATTAAACAGAAGGATGAAATTTTTAA
TATCCTGAAAATGCTGAAATGAAATTTAAAACAGTTTTTCATTTACCGAATTCAAAATAG
AATACAAATTAGAAGAGGACGTGTGGAAATACGTTTAGGTTTGGTGCTGAAACTGCTGAA
AATGTATGTTTTTACAGCCTTTGATGGAATTTGAGCCAATAGTAACATTCAGTTCAGTAA
ACTTTATTAGTCCCAAAAGAGACGTGTATTGTTAGCGAACATTTCAGTAAAACGATCCAT
GCTACTCCTTATAGAGATTATTAAAGTACATTTTTTAATAACATCAGTTTAATAATGTGT
AACTTGAATATCTGAGCCTGGTTCCTGTCAGAGTCCAGCTCGTTGAAGTTTCTGATTGGA
CGACAGCTCAGTTTGGGAGAAAGGAATGCTGCATGTCCTGAGTTGAAGCGTTTTTGTGGA
ATCCTTCTTCTGCTGAACTAACGTCAGAGCATCTGCTTTGTTTACAGAAACTCACCAAAG
CTGTAATGACAAACTTCAGGTGTTTTCTGGTCTGACATGGTCGCTAATAGACGCCTTTCC
TCTGTAGGGTCCTAAAAAGACCAACGCCAAGAAGGACTCCAAGGAGAAGAGGGAGAGCAA
CGAGGAGAGCAAGGAGAACCTGAAGGCCAAGTCGGACGATTCGGGAGAGGAGAAGAACGC
AGACGCGTCTCAGAAAAACGGCCCAAAGAAGAAAGGTTCGGCTTTCAATCGATCTTAACC
GTCATGGGAAACTTTCTGTTCACCTTCCAGGCTACATTTGTAGCTTCACCTACAGCTGTG
TGTTTGAGTGGAGAAGGTCTCTAGGGGTGGAAACACCTTAGGTGTTTAGGGTTCAGTTAA
ATAACTGATTTATCCAATTGGAAAGTGCTAGATCACTTCATTAAATCTATTTCTTTCTTT
CAAAGTTTTTCTTTTATTGTTTATGTTTTCAGATACAACTATTTATCTTTAAGTTTTAAT
GTAAGAATTTATCATTTTATTAGTCAGTGTTCCACCTTCAGTTGAAGTCACTAGCTGTAT
AACAATACGGTTTTGTAACCAGTTTATTAACAAAAACTAAAATTTGAATGATTAATCAGC
AAGTTTCATTTAATCTTGACCTGAATCTAAGCTTGTCCTGTTTTTTTGGTAAGAGTCTAG
GGATGTGATGTGTATCGCGATACATCCATAGACTGTACCGGAACAGTTTCTAAATATTTT
TTTAAAAAAAAGTATGACTACCTGAATATTAACAGGCCTGTCATTGTCATAACGTGGTCA
AATTCATTTTATGTAATGATCAAAACATTAAGCACTGCAACTGTTTCTCCTTTACGAGTT
TCTTTTACCAAAGCCAATTCACAGTGCTTTTATTTTGGTAAATTAAGAAGATATATTTCT
CCTTAAAGGCAACATTCAACACTGTCCGATTGACACGACAAAATATTTTTCAGTGTAAGA
AAAAGTGCCTTAACCGATACGGTTCTGTAGGTAGTACATGTCTCATGACAACAAAGGCTG
ACTGAATGTTTAACACAAGCTGGTTCTGGTTGAGATCTAGTTGCTGTGGTGCGGCGTAGA
GCTGCTCAGAGAGACTCGGTGTCGGGTGACAAGTCAGACACTGAAGGAAGCCTCATAAAT
TAAAATAAACAGTTTCTTAACACCATTTTAAATCCGATATAAGTATCGCCAAATGAAATA
TCGCGATATATCGCCAAATCGATTTTTCCTACACCCCTAGTAAAAACCAATTGCTAATGG
TAAACACACAAAACAGTCAGAAATGCAAACACTTCGGTTCCTCCTCATGAGTCTCATCTC
TTGATGCTGAACCTACGCAGAAAAGTTTAATTCGAAACATTCAAAATGTAAAGTTCATAG
ACTCTTGCTGGTTGTGTCTTGATTCCTTCACTACTTTATAGTGCGTTCACCATTTTGTTC
AAACTTACAATTCCAATAAACAATACCCTAGAAATTTCCCAGAAGTCTCTGCAAAAAGCC
ATTGATCATCAATACTCACCAAATTGGTGAATATAGACCACAATGCATTGCGTTTGAACA
ATTTTTGTGAAGAAAAAAAAAGTATCATTTAGTTTTCATCATCAGAACATGATAGTTTTA
GTAAAGTGTTCACATTTTTTAGGTTTTTGCTTCAGGAAATCGGTGACGTCAAAGTTTGCT
TTAAAAAAAAAAAAAAAAAAAAAAGGGAAAAAGGGGCCAAAAGGGGGGGTTAAAACCCGG
GGCACTNNNNNNNNNNAAAAAAAAAAAAAAAAAGAAGTGAAGAAGGTGTCAAAATGGCTG
GTTAAAATCCAGGGCACTAGATGGTCCCACACTACAGTTTGGAGTAGATGGGACTTCATG
TGAGTGTTGTGGTGCTTGCTGTATGAAATGGCAGGGATTGTCCTGATGGGACAGTCTGAG
AGAAGCTCCAGCTCAACTGAGACACTAAAAGCTTTAATGGTTGGAAAAATGAACTGTGAA
GGATTCATGGATTCAGCAGAGGGAATCGGTTCTCCATTCTGTTGTCGGCGCTCAGACCCG
TTTCTGAGGAAGACGGCGCAGCGGCTCAGACTTTTCCTCAGTTGGAGACAAACGTTCTGA
AAGTTTTGACATATTTGGTGTTCGTGTTATTAGAGAAAAAACATGGACTTTGCGTCCTTG
GAAGTTCAATGTCATTATTGCTCGAAATATTTACATGAACTCCATAAGAGGAGCGTGAAC
TCAGGTTCACGCTCCTCTTCCTCAAACAGATGAGCTGGTAGAAGGTGGTGATTGATCCCT
GATTGCGGATCTGAATGAGCAGACTGGCTTTTCATCTCCAACAGAATACTATGGTGGCCC
AGAAGTGCGAAAAACATTTCAAAGATCAGAACGGCAAAACAAATTTTTAAAAAACAACAA
TACATTTAAAAAGACAAAGCTAAGTTCCAGACACCAAAACGTGAAAAAAAAAAGCAAAAG
TAATTTCCAGAAATCCAAATGAAATGTTAAAAATGAAACAGCATAAGAAACTGGAGAGGG
TAGAGACGATGGGACATCACTGATTGGATGGTGACGTTTGTCCATCATTTAAATTGAAAG
TTAAATGGCATTAACTGATACTGGTATCATCATCCAATCAGCCATGTCTCATACAGTGAT
GAAAGTCTTCCGGGAATTCCCGGAAATCCGGGTTTTTGAGCAAACCGAACGTACTTTCCG
GGAAATAAAGACCTGATCTCTACGGACAAATCGCTTTCCGGATCAAAAAATGGTCTGAAA
TCAGCTAATTTTAGCTTTATTTTCTATATTTCTCCGCAGATCGCTTCCTCTATGGTCGTG
GCCATCTCTCATCTTCCCGGCCTAATTGACCAATGACGGGACGTTTTAGTTGCTTTTGGA
TGCGTCGACGGGTCTGATTGGCTCTGTCTGCACCACGTGGTCAGCGTGACTTGCTTCCCT
AGAGACCAAAACTGGCGGACCCACGCTAAATTTTCACAAACACACCTGAAGAGTTTGCGA
TCAAATTTGTGTTAAAATAATGGCAGGCATCGTCATTATTGAGCGTGGTCACGACCTCAG
TTGTGAGAAGACGATAAAAAACAAATTGAAGTGGTCTTGGCTGGAAAAAAAAGATTTTTA
AGTTAGTGTAGGTCAAATACTTTTTTGTGTAAAATAATCTCAAAACCACATTTTGAAATA
ATTTCAATTTTAGTTTTTGAGTTTCAGTTTTTATTTTGAATACATTTCNNNNNNNNNNGA
TCCCATATTTTGATGTAGTTATACTTTGAGAAAACAGTGCAAGTGGATGTTGTACATCAG
TCATTTCTAAAGCAGAAATAATGTATAAATAACTGAGGTATTTTCATAGAATATAATAGT
TACTGGTGTTCTTTTTGCCATTTGGGGCTTTGATGTTACTATATTTTAGCAATTGTATGT
TTTGCAGCTTTAAGGAAAAGCGTAGATTGTAGGATTGTGTTACTTTGAGCAATTTTCCAA
ATTCTTTTTTGGGACCAGCAAGTCCTTAATGGAGAGTCAAACTAGGGGTTTGAATGACAA
ATCATGATGCTCCAATTAGTCTTAGTTTCTTGATAAAGAAGTGAATAACTAGCCGCCAGA
ATGCACCAGAATGCATCTAAGACCACGTATTTTTCCAAAATTTCGCTCTGTGCCCGCCAT
ATCGCTCAAAGAAAAGTTCAGGGATTTTTTCCTTGCCTGACTTTCATCACTGCTCATAGT
ACCTACCTTTCCAGGTTCTCATTGTGTTTTTTGTTTTTCCACATTTCTTTTTGGTTTTCC
GAAATGTTTCTTCAGTTATTTTATACGATTTTGTTTTCTAAAAAGGTAAAGCTATGTTTT
TTAAATGTGTCTGGCTTTTTAAACTGTCTCTGTGTTCTTTAAACATGTTTCTGCATTGAG
TGGTTTGTAGATGCCACCGCAGAATAGCAACATGAAGCGGCCTTGTTTTTATTTGCATTT
GCACTTTTCTGATTTTCACTTTCTGCTCAGGAACCTGAGTCGGCCTCCTTTTCATTCAGG
GCAATCAAACGGCTCTGACTGTTTGAATGCTTGCCACATAAACTCATTATGCTTGGAATG
ACTCATCATTCAGAGGCACGTGCTCTGTCACTGACTTCAGAAAGCTGGTTCAGGACGCCA
CCTGCTGGCCGGTCATGGACCTGCAGAACATTTTTGTTTTCAATCGGGATAAATTCATTT
ATTTAGGTAGCGATTCCATTCATGACTCAAGACGATTCCCAGATCAAACTACAATTCTTA
CTTTACAATATGTTTTGTTTGAATGGTTGCTATGTGCATGTCTTTTTAAAACTCAAATAT
TAAATCACCGTCATTTTTACCTTTTTTTTGACCAGAAGATCAGAATCAACAAAAAACAAC
AGGAAAAATAAATGGTATTTATCACTTTAAGGAGTGTAACACTCTTTTTTTGGTTAACTT
AAACATTAAACAAAAAATCTTTTTCAAACAAATCCTAAAAATGTTCCAGGTATCCTCAAA
GTTTTACTGACTAACTAGAAAACACCTTTCACCTCATTTTTTTCTAACAGTCATGTTTTA
TGAACCTTAGCTGACGCCTGACTGCAGTTTCATGATTCCACATCACTCATTGATCATGAA
ATCTGTGTAGTTTGCTTTTTTTCTCACATTCATTCAATTTTCATTCTATTTTTTATTGAA
ATTGTCGACTGTATTTAAAAATCCTTTTTTCAGAACTTGTCTCACTTTTTAATTTCTAAT
AACACTTGATAGTCTTACTTTGAAAATAAGGACCTTCACCCATGCTTTACTTTGAATTAT
TTACTTCCTGTGACAGTAGCACATACTTTTAGCTTAGTTAACATACTAAAAATCCAATAT
TATTCTGCAATTTTAGAGCAATAATTACATTACCTAAAGTGTATTTTTACTTTATCAACT
TTGCTAATCAGCGATCTGGGACGTCACAAATATTCATTTCCACATTTTCTAGAACATTTC
CAATATTCAAGTATTCGGATGCTAAATAAGAGTTTTAAGACGTTTCTGCCTAAACCGCAG
CTAAAGCTAATTTCTGAGGTTTATTCAATTAAATGGACTGTATTTATTCATAAACATTTC
ATATTTGTAATTCTTAAATATATCTTAGTGAGTATACTGTATTGTTTGGCTGTTTCATCA
TATTTAAATGACATTGTGTCAAACGCACAGAAACCTGAACCGTGTTTTACATAGAAAGCA
TTAAACATTTTACTGAGCTCTTTGTTATAAAAGATTAGTCTAAACGTTTGACAAAAAATT
CCATTTTCAAAAGGTAATATTATACTAACTAAATATTGGAATACTTGTAAAATTCACCTC
AGGTATTTTTAAATTGATTTGAATCTCCAGGAAAAGGTTTTGCTGTGTTTTTGGATGATT
TCTTTTTCATGTGTTCTTTGTGAAATGTTGTTTTGTTGAGCGTCGCCTCTCATCTCTGTC
AAACAGCAAACAAGCAGAAGTGGGTTCCTCTGATGATCGAGGTGAAGTCCGAGGGTCCCA
GAGAACGCTCCGCCTCCAGGAACAACAGCAGGCAGAACGAGAACCCCCGCCTACCTCCCA
ACGCTCGCAACGACCTCAGAGGTCAGCCCCGCCCGCCCTACGCGTCGCCCTCTGTGCTTT
TGTGCGTCCACATGGAAGTGTGAAGGAGGAAGTGTGTGGTTGTGGGTGTGTTGAAGCGGC
CGCCGGCTTTGTCCGCTTGTTTAAACTATCAGTCAGTAAAATGCTGGATGGATTGTTTCA
AGCTTTTAATTTGAAGGGTTCGCTGTGGCCGATGCTTTCACTGAAGGACGGTTGCTCTCT
TTTACGCAGACTGGCACAGTCAGAAGCACGAACGGGAGTGGCACGACGACCACGATGAGG
TGTCCAGCGTGAAGAGCGAGGGGGCGCCGTTCCGGGGTGGGTTCAGAGGTCGTGGACGCG
GACGGGGAAGAGGCCGGGGCCGAGGAAGAGGAGGAGGCAGAGGTAATCCTTTTCCTCATC
CTCTCTGCTGATCAGACTCAAACATGACGCTGCGGCGCCAGCCTCTCCTCTCCAACAGCT
GACACAAGCGACGTGACTAACACTTACATGTGTTTACGGGGCTTTGCCCTGCTCTTTGAC
TCGCAGGTTCTGCAGTCAGTCTGACCTGTAAAGCCAAAGTCAGTCAGTCAGTGAGCGAGG
CGTCCACGTCTGTTCAAATGCTTTCAATGTTTTAAATGGCAACATGCCCTGAAGGGGTTA
AACCCCAAACATGATTAGTTCAGATGGAGATGCTCCTGATGCTCCTTTGGGAAAGTTGGT
GGTGGTTGGATGGATGCACCAAGCGGCTCCTGGAGCTTCCTGACCTGGAGGCTTGATGCA
GAAATGATGAGCTTCCATGTCTCTTCTCTGATTGAACATCTTGTGGAGAAAAACCCGCAC
AGCTCTGATCTGCGGCTCACCGCTCTGACATTTAGTCTGGACCTAAAGTCAGGCTTAAAG
CTTCTGGTAAAACAGCCATTCTCTGTAGTTTATTTATAGTTCTGTGACATCTGGAAGCCC
AGAAGAGAAACAGAAAGTATGACTGGCTGCTAAAAATGACTCATGGTTGTTTTTCGTCCA
GAACAGCTGAGCAGGAAAAACCTTCATTCCAAAGCTGCTTCTTTTCACGTTCTTTAAAAA
AAAAAAAAGAAACTTTTTTGTTCTCCTCACTTTTTTGCGCTTCTTCCTTAAGCGGCCTGT
TTCCACAGGAGCGTCTCACTTTTGTCCAGACTCTGTGGTTCTTTGTTTGGATTATTTTTT
GTTGACATGGAAGTGAAAGCCGGCTGAACAGGTGACGACAAAAATACTCAGCAGCAACGA
TTTTCCCTTTTAGACGTGTTTATTTCTGATTTTCAATAGAAAAACGCTTCGTATTTTAGC
TTCAGGCTGATCAACTTTGTTGCCAAACTGTCAGATTTGACTGTTAAGTTAGAACCTTTT
TCTCTTTATGGCCTTTAAAGTTCTAAAACTACAGCTGAACAGTTTTTACACCCAGATTTT
TAAAACAAAAACATTTTGTTTTTATTCTGTTCAGTTTCAATTGTTTATTTGCTACTAAAT
ACATTTAATTTCCATTAGGATATTTCCTATAAATGTGGTTTTTTTCTGCTTTTTAATGTT
TTATTGCTTGTTTTTGTTGTTGATAAACCAGAGGATCAATTCTTTTTTTTTTTTTTTTTC
AAAAATGGTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAAGGGTTCCCTTTTTTTTTCTCCCCC
CCCTGGAACCCTGGACCAAAGGGAAAAAAAAAAAAACTCCAAACAGAAAGGCGATACACA
TCCCATCACTACGCCTAATATACACCAAAAACATATAATAATAGTAATGAATCATTAAAA
TTAAGAAAATAAAATGGCAGCACAACATATTTGATATATCAAAAGAAACTCTAGGATCAA
TTCTTTAAAACGAAATATTTTATGTTCACATAAAAAACGTCAGAATTCAGCTTTTAAAAG
ACAAAAATTGTCCCTATCTAAATGTTTATTGTATATTTTATTTTTGTGTCATAAAAAAGA
GTTAAAACCCTAAACCTGATGCCCTTTTTACATTTATAATCTGGATTCGAGAACATCTGA
TGTGCAGAGAAACTAACATTTTTTCCTGTTAACGTGGTTCTCCGTTCTGGAAGGTCACTA
CGACTACCACTGCACCTACAAGTCCTACGACGGGAAGGACGGCTCCTACAGCCAGAAGTT
TGGCAACTCCGTCACGTACTACTACGACAACATGAGCAGCGCTGAGCTGTACTCTGTGGA
CCAGGACCTGCTGAAGGACTACATCAAGAGACAGATGTGAGTCCAGCTCGCTGGGAAGAG
GCGTATACGGACGAGGAGGAGGAGGAGGAGGAGCTGCAGAAGTGATGAGCTCTTCATGTC
TCTTCTCTGATGAATCATGAGCAGAGAATTTTGACTCTGATCTGAGCTGTGAAGCAGGTT
TTGTCCTGAAGCAGAAGCTCAAAGTGAACCTGCTTCTTGTCTATATTTAAACCTTGAACA
ATGTGGTTTCTGTTTCCACAAATACCAGCTTCCCTCCTGGGAACTTGGTTCCTCTCCTTC
TCCACCACGGACGCCACGGCATCAGTTGAAGCATTTGTTTGTGTCGTTTTGTTGGTGACT
TGAGTGGATCTGGTCTTTCCTCTGCAGAGAGTACTACTTCAGCTTGGAGAACCTGGAGCG
GGACTTCTTCTTGAGGAGGAAGATGGATCAGGAGGGCTTCCTGCCCATCAGCCTCATCGC
CAGCTTTCACCGAGTGCAGGCCCTCACCACAGACGTCAGCGTCATCCTGGAGGTGAGCAG
GAGCGGACGAGTCCACCTCTGCCGTCGCTATGGAGACGCATGCTCAGCTAGGACGGGAAA
GCCTTCTGCGGGCTGGTTGTGGCAGGTTTTTGGAGCTCAGGTGTTCAGTTTGTCATCTGC
TTTTTGCAGTCTGCATTGAAGGAGCCTGACGTTAGTGGATTTTGATGATTTGACTGATGC
AAAACGGCGACTGAAACGAGCAAGATTGAGAAATATTGGTGTAAAACCCCAAAAAAGCTT
TGTTTTTTATGAAACATTTTTTTTCAAATAGTTTATATTATAATAAAGAATGAAGAAAAA
AAAAAGGTTCAGAACCATCAGATTCTCCTCCGTGTTGGTTTGGACTCCGCCCAATGATTG
CATCAGTACGTCACAGGCCAAAGCTGAGTCCCTGATTGGTTGACGGTGCGTCTTCTATGC
TAAAGTTCAGATATTTGACCTTGCACCTGTGATCGTGTCTGAAGGTTGAGCTTGAAACTG
GCCGCCCCTAAAGCACGACCGTGGTTCATATTTGACCTCTTTAGTGTTACGTCCCTTTTC
TTTCTTCTAGATGTTTTAGTGATTTTCAGCTTTGTGGTTTTTCATCACAGTTGCATCCGG
GATTGTATTGATGCTTTAGAGTTTCCACGGAAACACAAATGTGCTGGTTAACCAGCTTAT
TGAATGCAGGGAAGCTTCAGACTTGGAGGTTTCTGCAGAAATTATGAGTTTTTCATGTCT
CTTCTCTGATTCAGCATCTGTGGGGAGAACTTTTAGACCTCTGATCTGCAGACTCTGCTT
CTCCAGGGACAACAGAAGCTCTTTCTGGCGAGTCTTTACTTACCATTGCTGTGTCTGTCA
TCAGGCTCTCAAGGACAGTAAGGAGGTGGAGGTGATCGACCTGAAGATCCGCAGGAAGGA
GGACCCAGAGAAGTGGCCTCTGCCCGGCCTGAGTTTACCCAACAACACGCACACAGACTT
CTCCCAGCTCATCAACTGTCCCGAGTTCATCCCGAGGCAGATGACTGGGGATCCGAGAGG
TCGGTCCATTCCCGCCTTCCTGCACCTGCTCCACCAGAGCCTCAACGGCTGTTAACCTGA
GGGTTTCTGCTGCAGGCTCCTCCAGAGGATCCTCTCCAGTGCGGGCCAAGCCTGACCCAG
ACACCTCCAACCTCAAATCCATGCCCAAGGGCCTCTCTGCCAGCCTCCCTGACCTGGACT
CTGAGTCCTGGATCGAGGTGAAGAAGAGGCCCCGACCGTCTCCCGCCAGACCCAAGGTCA
GCTCAGAACGTCACGTCTTCACACGGAGCTCAGAGTTAAAGCTACAGCTCCACAGATTGA
TCTCAGAACCAAACCACATCCATCCATCCAGTCAGGTGTTGACAGAATCTGCTCTCACCA
TTCCTCTTCATCTCCTCTCCCTCCTCTTTTTGTGATGGAAGCAGGCCCCTTCGGTGCAGC
AGCAGAAGGAAAAAGACGAAGTGGTTCGATCCCCGGTTCCCCCGCCCGGCTCCTCGCCGT
CCCGCACTACCTCAGGAAACAAGGTGAGCCGCTCACCTGCACGGATCTGCAGGGGTTTTG
GACCAGTTCTGGTTCTGTTTAGAGCTGTAGGTTTAATGGTCACATGTCCATCAACAGGCC
ACGCCCCTCCGTGGACACGTGTGTTTTTTAAAGGTCAAATTTAAAATAGGGCTTCAAAAC
ATTATTACAGAATAAACTATATTTGTGAAACAAGCCACCTGGTGGTGACTTGATGGAATT
ACCTGATTATAGAGTTTAGTTTTAAAGCTGGGATTTCATCCTGAAGTTAGACAGTTTTTA
GCAGTTTTTAAAATAGTTTACAAAGAGTTTGAAAATCCTGACAGTCTGTTGATGAATGAA
AGTAACTGAGTATCGTGTTTGTTTGTGGGGTCAGGACGGAGCCGAGCAGGACGAACCAGA
GGAGCTGGACTTCATGTTCGACGAAGAGATGGAGCAGATGGACGGACGCCGCAACACCTT
CACCGACTGGTCAGACGAAGAGACGGACGGCGAGCTGGATGACCAGGACGTCAACAAGAT
CCTGATCGTCACGCAGACGCCGCCCTACCTGCGGAAGCACCCAGGCGGCGACCGCACCGG
ACACCACACGTCGCGCGCCAAGCTGACCAACGAGCTGGTCAAGGTCATCAACGACGGGCT
CTTCTACTACGAGCAGGACCTGTGGGACGCCCCCTATGAGCCGGAGTACGCCACCATCAA
GGTGAGGCGGCTTTATGGTGGTGAAAAGGGAAAAAGAGCAGAGTCATGCATGGAGGCCTT
CCAGCGGTGGCTCTCCTTCAGTTGCAGCTTTTTCTGGATCCGGACCCAAAGCAGAGCACA
GAAGCTGCCTTTTTGTCCGCTTTTTTGTTGCCGCTGCCGCCCATTGTTGCATTGTTGGGC
TCTGTGTGGGACCTTCACGCGCTCGCCAACACACATCCAGCAGCCTGTGGAACACACGCC
GCTCGTTTATAAATAGACCCCAAACGGCGGGGTGCCAGGGGGGAGGCAAAGATGGCCGCG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTGAGGTGCAAAGCAGTTA
GAAAAAAATCAAAAAAAAGTGACAAGATTTCGACACAGAAACCTGAAACTACTAACTTTG
TTAATATATTATTATGTAAATATTGCATTTTCTAAAAACAGATTCAAGTCGAACTCAAAA
CTAATCATGTTTTTGTAGTTTTAACATGTTCTGATGGCATCTTTCCGATGATGGAGGACA
AATGTTAATGTCTTTATTTAATCTAAATGTTATGTCTTTATGGGTAAGGAAGTGTTCTCC
CTGAAGCTTAAATTCTGATGCTTCCACTTGTAAACCAATGTAAGTCTTTGTTTTTTCTCG
TCTCCGCTTGAATCTGTTGCTCTGCAGAAACTATGTCCTAGAAAACGTCTTTGCGTATTT
AATTTTGGCTAAAAACAGGTTAATCATAATTATAAAACCACTGGGAACGCTTTGAAAATA
GATCAAATCATGACTGGAGTGGGACTTTGACGGTGTGCAGCCTCTTGTTTTTCAGTCATT
CATTGACATAAACGCTTAAATGACACAAATAAAGTTCATAGTTTCACTTTCTGATTCCCA
GGAACAAAAATTAAAGCTGTCATTTACTCTACTTCAGCTTTCAAAATGATTAAAGAGTAG
TTTTTGAAATGGGGTCACATTTATCAGAGTGCTCCTCCTCATCGGCGGCGTGTCGTTCTT
CTCTCTGCAGTTTAAAGCTCACTTCTTTAGCGTCTCGTCGTGTTTCAGTCCCCACAGATG
CTTTGGCAAACAAACTTTTCGGCGCCCCTGAACCCTCCTCAATGGCCCGCTCGCTACCCA
CAACCGTGCCTGACTCGCCAAACTACCGGACGCCGCGGACTCCTCGCACGCCGCATCGTA
AGGACCCCACCATGACGCCTCGCTTCTACCCGGTGGTGAAGGAGAGCCGGCCTGTCGACG
CCAAGGTGAGACGGCGGGGGCAGGTGGGGTTGATGTGAGGAGGTTTCCCGAGGGGAACTC
CTTCACTCACGCTTCAGAGTCTTCCTCTTCCAGACTCCCAGGAAGAGGAAGACCAGGCAC
AGCTCCAACCCCCCCATGGAGTGCCACGTGGGCTGGGTGATGGACTCCAGAGAGCACCGG
TCCCGCACCGCCTCTGTCAGGTGAGTTGCAGAGGAAGCATCATGGTATGGGACTGCTGAG
TCTTTCTATCCACCAGCAGATCTTTTTTTTCGTTCAATTATGCTGGACTTATTTTTCTAT
AAAGGTTTAAACAAGAGAGAAAATTGTGAAAACGTTTTTCTGTCTGAGAAGAGCCCGTCA
AGCGTGTAGCGGCGGCTTCTACAGCCTTAAAACAGACTAAATGAGGGAACGGTGTGTTCA
CAAAGGATTCTATTCCTGGTTATTCCAGTCACATGACTTGGTCAGGACACTCAACATGTG
GTGGTTTTTGTGTAGAATGTTGTGTTGAAAACGGACCAAAGCTCTGTAGAAGGAAATGGA
TCGTTGAAGAAATGCATCATGGGAAGCTTGGTGTTTCGTCATTCTGGATGAAGAGTCCAC
CTCTCATCTCAGTGGTTGAGCACGGTGGTGGAGGCATGATGATGTGGGCTTGTGTTGTAC
AGAGGTAGAGCATCAACAGACGTATTCAAAACCGTGTCAGACGGATAACCCTTGAGCTGT
CTTGTGGGGAGTGGGGTCATCTGGACCCCACAAGACAGCTCAAGGGATAAGAAAGAGTTT
GGGGAGCTTAGGATGATCATGTTGGATCGTGTTTACTGTCCCTCGCAGCTCCAACGCCAG
CCCGTCAGAGGGCACCCCCGTCATGGGCAACATCGGCTGCACGCCTCAGTCCCTCCCCAA
GTTCCAGCACCCGTCGCACGAGCTCCTGAAGGAGAACGGCTTCACGCAACACGTCTACCA
CAAATACCGCCGGCGCTGCCTGAACGGTAGGTGTCTCCGCTGCGTCCGCGTGCGTCCGCC
TCTTCCTCTGAGGAGCCCTGACCTCGTTCTCCTGCCTCCTCTCCGCCCACCGCAGAGCGG
AAGCGGCTGGGAATCGGCCAGTCGCAGGAAATGAACACGCTCTTCCGCTTCTGGTCGTTC
TTCCTGAGGGATCACTTCAACAGGAAGATGTACGAGGAGTTCCGACAGCTGGCGCTGGAG
GACGGGAAAGAAGGTTACAGGTGAGCATCTGATCTGAAAGGTGGTTCACCTTTCTTTAAA
ATGGAATGGGATCTGCAGACGGACTCTGAGGTTTCTGATGCCGTCTGAGCTGAGCGGCTG
CAACCGTTGATCCCTGGTTGCTGGTTTGAGTCCGTTCCTCAGCTGTGTTTGTGCTGCAGG
TATGGTCTGGAGTGCTTGTTCAGGTACTTCAGCTACGGGCTGGAGAAGAAGTTCAGGCCG
GACATCTTTAAGAACTTCCAGGAGGAGACCATCAGAGACTACGAGGCCGGTGAGGAGGAC
GTCTGCTGCTCAGAGTGGAGCTTCAAGATGGCGGTTGTTCAACCCGCAACCTTCTTCAAC
CTGTCTGCTTTGTCACCTCAGGCCAGCTTTACGGGCTGGAGAAGTTCTGGGCGTTCCTCA
AATACTCCAAAACAAAGACCTTGGAGATTGAGCCCAAACTCCAGGAGCACCTGAAGAAGT
TCAAACGCCTGGAGGATTTTAGGATTGATGTAGGTGGAAGGGAGGCGGGGTTTGTTTGAG
TTGGAGGCGGAGTTTGTTCACCTAAAGCCGTTCTTTTTGGTTCCAGCCCCCGATGGAGGA
CGGAGGCCGCCGGAGACACCCGTCCAGCGGGGAAGGTCGACGCCGAAACCCCTCCCAGTC
TTCCAGCCGGCCCCACAGCCAGGCGGGGGCTCATGGCCCCGCTGCCAAGGAGGATCCAAA
GCCCAGCGGCCAGAAAGCCCCCGCCCCCATCGCCGAGCCAGACGCCAAAACGCTGAAATA
ACCAGCAGAAAGTCACCAGCCTCCATGGATCAGCTCAACCACGGCTGGGAGCCCACGGCT
CTTTGTGCGCCACAGGAGGGGAGGGGGGGCTCCTCACTCACGCATGACACCCCCGCCTGG
CAGCATCGCTGATAGAAATCCTTTTTGTCATGTTTTGCTTTTAGAACTTCCTAAATCAGA
CAAGAGTTAAAGGATCACAGTTTCTCCTCCAGCAGCTCAGCGGCTGCTTCCTTTTTTCCT
TTTACTTTTCTTCTTCAGTCTGAGGCCCCCAGCCCTCGGTCTTTGGGACCCCCTCCTCTT
CTATCATCTGTCCTGCTGGTTGAAACTGTTTGGTTCCCCTACCAGATGTTGGATTACCGA
TTTGCTCATCAGTGTGGGGAGGAGTACTTGAAAGCCCCCCCCCCTCCGCTGGAGGCGCCC
CGCCCTCAGCATCCAACTGGACCAAAGTGGTGTGAAGCCAGGTGCTGTGTGTCAGGGGCC
GAAAAAAAAACGCATTTCATTTACTTTGTGGACGGGGGAAACCAGAAAACAACCAAAATA
GAAAAAAAAGACTTGTTTAAACCCCGCGCCATGATGGACAAGCAGATTTGAGAGTTGCCT
TATTTAATGGTTTTAGTGCTTCTAAGTCTCTGCAGCATCAGTTCCCACAGCTGCCACTAG
ATGGCGCGTTTCTGCCAAACCTCCCTCCTTCCCAAGTCTCCACAGGTCTTCCAAACAGAA
GTCTGTTACGTCCACAAGCTCCCTCTGTGGGGCAGCTTGGGGCTTTTTTTTTTGTTGTTT
TTGAAAACGGATCTTCCCTGTGACCCCCCACCCCCCCACCCCACCCCAGGAGGACACAAG
GCATCCATCCATCATCCATCCATTCATCCATCCATCCATCCGTCAGCAGTGCTTTGGGGA
CTGGAATTTTCAATCTGAAGTACTTGAAGAGTGGATGGTGGCGATCAGCTGCTGTCATTT
ACAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 2311..2376, 11047..11194, 11263..11274, 16446..16580, 16809..16961, 18833..18995, 19347..19491, 20344..20518, 20583..20755, 20939..21014, 21389..21720, 23075..23162, 23670..23884, 23973..24079, 24708..24865, 24955..25099, 25259..25368, 25461..25588, 25666..25824
1001..1075, 2311..2376, 11047..11194, 11263..11274, 16446..16580, 16809..16961, 18833..18995, 19347..19491, 20344..20518, 20583..20755, 20939..21014, 21389..21720, 23075..23162, 23670..23884, 23973..24079, 24708..24865, 24955..25099, 25259..25368, 25461..25588, 25666..25824
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved