Oryzias_latipes Locus RPS3
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RPS3
Oryzias_latipes
RPS3
13
SNORD15, SNORD15
5388..5537, 6259..6410
7581
TCTTAAGAAAAACTGTACAAAAACTGTGGTGTTATATGTTAAAGACAGGTAATAAAGTA
TTGTTTTATTGGAGAAATGAACCGTGGTTAAGGTTCTCAATCTGAAATGACGTTAAATGT
TTGGCTTTCATAAGATATGAGGTTAAAAGGAAGTCATAGAAGTGGAGCTTTTAGGACCAA
GTTTCAGGAATTTCTCCAAACCTCCACATGTAACAACTTTTAACAACTGAAAGGAAAATT
TTTCAATCTACGTGTTGTCCTTTTTCGTTAGATCAACAGCCTGAATTGTACGAAAAAAAT
GTAGAATAAAAAAATGATCAAAGCACTATTTTTCTTATCAATAAAATATTTTAGTTTTAT
TTTAACCTAAGCAAGGATCAATATTCAGGGGAAAAAATAAGTAGCACTTGTGCAAAAATG
TGTTTGGTTATAAACATATAATCGTAGGTTAGTTGTTGTGCATTGTGTTGTGTGTCGTTA
TTGTAAAGAAGTTATAACAAAAATGTCTAGAAAACTATACAGGCTTCTCTGTTGAGGGCA
GCATATACAACATATCCAACTTTATTTAGAAAGCACCTTTTTATATTAAAGTGGTGCAAA
GTGCTTAAAACATTTTAAGAAAAAACAAGTAAAACTATTTTTGTTTTAATATGTAATTGA
TGTCCACAAAACTGATTTTAAATATCAAAAAGGAATATGCAGACTTTGCGTAGTTTTGCA
TTTTAAATAAATGCAGAAAAAATACAGCAAAAACAACCTTAGGTCAAATATTAATTATTT
GTTAAATGTCAGCGTGTTTAAATAATTTTTCAAAAACATGGAAACAGTAAAAATATTGTT
AATAAGTGCAGCTGAAAGTTATTAAATGCTGATAAAATACAGGATACACTTTAGGATTAT
TTATTTGTTGTCGAAACTACATTTTCCAGAAGAAGCTGGGACATTGCGTCACCGGAAAAC
GACAATTTCCTATAAATTCACTTCCGGTTACTGGCAGAGTCCTTTCCTGTCCACGGCCCG
TTCGAAGATGGCGGTGCAAATCTCTAAGAAGAGGAAGGTTAGCGGGACTATATTTCTCTT
TCATCGCTGAATATCACGAAAATAACATCATTCTATAAAGGATAAGACGTTTAATCCTCA
GTCCCGGTGTTTACCCGGCCCGTTGTGGTTCCTTGCGAGGAGGATTATAGCAGATGCTGG
AGCTGCGGCTTCCCTCATTTCGTTAGCTAGCATGGCTCTGTGAGCCGGGGACTGGACCGG
TGAGCGGTCTGAACAGGTTCTAACCCGCACCGTAAAGTCAGGACGGCTGGTTTCCAGGCG
GATAAACCAGAGTCTGCAAATAAAAAGAAGAATTTGATCTGTTTCGACAATATTTGTTAT
GTTAGCTTTGCTAGCATGCGAGTCAGTTAGCCACATGTACTCATACACTACAAAGATTAG
GGGAATTAAATAACTATTTTTGGAGCCACAAATTCATCATCATGTTTAGGTATACATTAA
AGCCAAGCAGAAATTAGGTAAAACTCATTTTTGTTAATAGTACTACTGACTCTTTAATTA
GCCCATATTTTTTTACTTCAAATGCCTGATTGCTAGAATCAGATTTCATCATTTATATCA
GGCTATTGATGGTAATTTAGGCTTACCTTAGTTTGTCATTTATATATTTTGCCTTTTCTT
TCTCAGATTTATTGGGTTCAGGGTCACAGTTGGTAGTTTCTGTACCTTTTTATATAACAT
GGCAGAGGCACATTTTCTTTAAGATCTCATTTATTTGCACTGTCTACTAATATTCTGGCT
TTGAATGACTTTGATAAACTGATGCTATCTTCTTCATTTCTGAGCACTTCGTGTCTGTCA
AAACTCCCATGAATGAGCAGAACCTCCCTCTGGTGTCTTGAAACAGTTCGTCTCAGACGG
TATTTTCAAAGCCGAGCTGAATGAGTTTCTGACTCGCGAACTGGCTGAAGATGGCTACTC
CGGTGTGGAGGTGCGGGTGACTCCAACCAGGACCGAGATCATCATCCTGGCCACAAGGTG
CGTGTTGGATCAATGTTTAAAACAATTTTGACTTTTACACTCCGAGCCTCTGCGTCAGGT
TCAGAGGCAACTGTCTTAGCTATTAAATAAAGAACGCAGCAGTTTCTCACCCGTGATCTT
AAATGTTTCCGTCTTGTTCAGGACTCAGAATGTTCTCGGAGAGAAGGGTCGTCGGATCAG
AGAGCTGACCGCTGTGGTCCAGAAGAGGTTCGGTTTTCCTGAGGGCAGCGTGGAGGTGAG
ACAACCTACAGGATTTGCTGTTTAGATTCACTTTTGTAATCCCTAATCAGTGGGTTAGAC
AGTGTTATTATTATAGAAAGTCTTTAGCAGAAGTAATCGGCAGATCCTCCGGCTGAAATA
ACTGAGGATCGTTGTTGAAGTCACTCCTGTAGTTTGTTTTCCCACCCGATCCCCTTCAGT
GATGATACGATGACGAGACAGAGCAGGACTTTATCTGGGTCTGTGAGTTCTGCTTCGGGT
CTGCGTTCTGTGGACCCGCTGCCGTTCCTCAGATCAGGAAGTCCTTTAAACAGGAAGACA
AGAGGCATTTGTCTGAGAAGGGTGGACGGACGGACCATCATTGAAGTCGTTTCTGTGCAA
ACCTGAAGATGCAGCGACGTCTTGTTCTGTTTTTTCTAGCTTTATGCTGAGAAAGTTGCC
ACTCGTGGGCTGTGCGCCATCGCTCAGGCTGAGTCTCTGCGCTACAAGCTGCTGGGAGGT
CTGGCTGTGAGGAGGTAAGCAGTGCTGCTGATGACCTTCTCTGAAAGTACAAACCATCAT
AGAGCCTGTTTGAGAATGGAGGGAAAAAAGAACTGCACTAAAAAGTATATTTATAGTAAG
AATAAACAAAACGCTTCCGTGAAAAAAATTAGTGCGGTTCAAATCTTGCCTGCAAACTTC
ATAATTGGATCTTCAAAATAAAAGACACATCTGCTTCTGCTCCAAACATCTGCTTGTGTT
CTCCAAAACTCCATTTGATGGAAGTGGAGTCTTCAGGTTTACATCATCCTGTTACATCAG
ACAGAATTGTAAAAGCGCCCTGTAACCGCACTGCATTATGGGAGTCTGTTAGCAGTCTGA
GGTGTTTCAGACTTCAGGTGTGGTGCTGTTGTGTTCTGGCTTTCTCCTCAAGCTGTCTTT
GAGGTCATGAACAACCTGGAAAGTTTTGGGATTTAAAAAATGTAATTTCTAACCCTTGAA
AGGTCTTTTGTAAGGTTTTGAAAAAGTCATGACATTTTAAAGATTTTGGGTTTATAAACA
TTTTAAAAAACACTTAAAGCTGAAATTCTAGTTGAAATTGTTTAACCTAACCTCAGAAGT
TGAACCTCACATGATCGGTGAGCGACAGCTGCTGAGCGCTGCACAATCCAGTCAGAACTT
TTGGAAAACTGGTCATGATGGCGTTACTATGGAAGCTTATTGCATTCCATAAAATAAAAA
CAGGTGAACTTTGTTCAAATCTTTTCTGTGATCTTTGTTCTAATATTTTTAAGAACTACA
AAAGCAAAAAAACACCAAACAGGCTGGACTCTAACCTCGTCTGCTCGTGAAAACTATAAG
AAAAGCCACAAAGTGTCTGTTTGTGCTCGTCACAATTCTGTTTTGCTCTTCCTACAAACA
TTACAGAGCAAAACGTTGGAAGTCTGAAGGATTGACCTGTATGAATTGGTTAGTTTGTGT
CAATCCCAACAACAAAGCCCTGAATGATGCTCATGTTGTGGGTGTGGCCAACTTAACCTT
TTTTTTTCTAGTTTTTGCTTTCATTTTTTCTGAAATCACTCATTTTTGGAGATAGAGATA
CGTCCACAACCTGCAGGTTCATTCTAAGAGAGTATTGATATTAGGGGTTTCTGTGGAGTT
AATGAGTTCTTGCGATGTTTTTGAGATCATTTGGGGTGAGTCAATGAGAAAAGCAAATGT
TTGTCTGATGCGTTTTCACGTTTTACTCTGTTAGTGGATGAGGAAGGAAGGATTTAAAGG
GGTTAACTTTAATATGTTCAGTAAGAAATGGGTTTCCCTGGACACTGATGTTTACTTTGC
TGTTTGCTCTAAATGCCTGAAGGTTAAATAAAAGACAGGGTTAGATATTTACCAGATATC
TGAAACATTCACACTAAATATAAGATATAACCATGCAGTGAATGAGTAAACCTATTTACA
AATAAGCTGTTGTGCAGATTCAGCTGAGAAAAAAAGCAAAAGATCAAAACGGATTGGTGA
TGACAAACACGTAAACCAATCGGATCATGTCTGTGACACGGACACAATGTGGCTTTTCTA
CTTATTTGCAGCTCATCTTATAGTTTTCATGAGCAGATGTTGGTTATTTGCTTTTGTAGC
TCTTAAAAATATTAGAACGAAAATTAGAACAAAATAAACTTTTTTTCTTTCTTTTTAATG
TGATCCGCTTCCATACGTTCCTGCAGTTTTCTTCCACACCAACACAAACAGTCGCTGATG
CGGCGGCTGCAGTTTTGACAGCGAGGCAGACAAAGGCGGATGGTTCAGTGTGTCTCTGGT
AGTTTTGGAAATCCAGTGAAAGATTATGGAAAACCAACACTAACGAGTGCAGACCATCCT
GTATCTGCTCGCTCTTCTGAGGTAAAGGACCTTCAGGTCGTGGTTTTTTGGAGTGGCGGC
GAACCTCTTTGGTGTTTACAGTGTGGTCTGTGCAGAAACGTGTTAAAAGAGGCAGACGGT
CCATCAGTATTCTGGCCATCCCAGAGTCGGACCTACAGGGTTTCCAGTGGATGTTGCAGA
ACCACGAGACTGTGGTCTGATCTGCATGGTGGTGGTTCAGTAGGTCTGTGGGGGAGTAGA
TGAAAGAGTGGTTGGAGGCGGTAAAGGCTCTGGGCTTTGTTTCGATGATGTCACAGGGGA
CAGCCATAGCATCTGTAGACTCCTTCAGTAAATATGAACAAAGTCCGGTTGGATGTCTGG
ACTGCAGAGAGACTCCAGCAGAGCTGTAGGCGGCGGTGACACCACCTGTTCAGGAGCACA
CGCCTTAAATGGACTCTCCGTCTCCAGTCTGTCCGTTTGTTTTAAGTGACCTCACGTCTC
CCATGGCAACTGCAGGAGCGTTCATCCTGTTTAAAGCTCGCTCTGTAGCTCCTCCAATCA
GGAGACTGATTCTCCCGACCGTAATGCAAAATTAAAGGAAGAAACAACGAAATAAACATA
AAAGATCCAGATGTGCCTTCATTTCTGCAACTGGCTTACAGACGGCGCCGTTTGTGGGCG
GGGTTCTGTGGCTTTACATGACACCTGCTGATGTTTGTGACGGCATCTATGCACCTTTAG
GTCCCACACGCCCTCCTGGTGTTTACTTTGAAGGAGTTCAGCAAATCCCTTCAGTGATGA
GACGATGACGAGTCGGATCAGGGCTCCGTTTGGTTCTGGTTGCTGGTTCAGATCCACGTT
CTGTGGTTCTGCTCAAAAGTTATCAGAACCCGGCGGGTCCTTTTCAGCTGAAGACATCGA
GGCATTTGTCTGAGAAGGGTCGACGTTAAGTTTGTCCTCCACGAATGAGGCTGAAAGGAA
CCAAATATTTTAGAGTAAATTAAAATATTGGATATTCAGTGTGAGGTGACTGTTTGTGGA
TTTATCTATAATGTAGCAATAAATTTTGATTCTATTGTATCTAAGAAAAACTTTATTTCT
CTATCCACTGCAGAAAGATGGACAGATTTGACCGTGTTGTGACTCCTCCCCTCCTGCAGG
GCGTGCTATGGCGTTCTGAGGTTCATCATGGAGAGCGGCGCCAAGGGCTGTGAGGTGGTG
GTGTCCGGCAAGCTGAGGGGTCAGAGGGCCAAGTCCATGAAGTTTGTGGACGGCCTGATG
ATCCACAGCGGAGACCCCGTCAACTACTATGTGGACACAGCGGTCCGCCACGTCCTGCTG
AGGCAGGGTAAGCGAGCTCCGCCCCCCCGTGACATCATCTTCTTTGAGACTCCTTTTTAA
CTGTTGGGGTTTTCAGGTGTGCTGGGCATCAAAGTGAAGATCATGCTGCCCTGGGACCCC
AGTGGGAAGATCGGCCCCAAGAAGCCCCTCCCTGACCACGTCAGCATCGTGGAGCCCAAG
GAGGAGAGCCTCCCCACCGCCCCCATCTCTGAGCAGAAGGGGGCCAAGCCGGAGGTGCCC
GTCATGCCCCAGGGAGCCCCGGTCCCCACCGCATAGGAGGGTAAGACGCCCCCTGAGACG
TGTCCCCGTCAGACCCACCCTTCAGTGATGAGACGATGACGAGTCGGAACACACCCCGGC
CTGGTTCTGGTGGCTCCTGGTCCAGATCCACGTTCTGTGGGTCCGCTTCAGGTCATCAGA
ACACGGCGGGGCCTTTTTGCCTGAAGACACTGAGGCATTTGTCTGAGAAGGGTCCAGATC
AGACGTGTTCTGGTCCCATAAAGCAGCTGATTAGAATCCCTTTTTTCCATCTTTGGTTTT
AACGTTGGATCTTCTGTTCTGCAGGTCGATCACGGTTCTGCTGGATGGAGAAGAGTCTGT
GACTTTTGTGTACAAAACCAATAAAATCTGGAAAATACATTTAATGTTGGTGTTTTTATT
CCATCCCATAATAAACAAAACCATGAAACAAAAGCGCTCAGGTGTTTAAGAAGATCAGTG
CAGGTGTTCACAGGTAAAACAAATTAAGTAAAACTCTGGAAGACCTGCAGCTCTGCATTA
GTGACGTCAGCGCCAGATCCGTGGGTCCGGGTAATGCTGAAGCCACGCCCACTCCTCTCC
ACCTGTGAAAACTTCGGTTCCACCTGCTTTCAGCAAAGAGCCTCCAGCACTTTCATGCAG
TCGCTATGAGTCTACCGGACTATAAGTCAACGGAAAGACCCGCTTCCTCTGCGCTCGCGG
TAAGAAGACGCCGTTAACGGTTCCGTTCAGACTCTGACAGTTTCCGCCGAACAGCGATCG
TATCTCCTCGTTGTATTGACGGTTCTCGCTTCCGTTCTGCGGGTTTTTGGTTCAAAAGTA
GAAATTTAGCCCCGCGTAACTCAAGAAACCTCGAACTAAAGTTCAAGTCCCGACAGATGC
AGAACTGTTGACGAACCGCTCACCGGCAGGTGCAGCTTTGAACCAGCAGGGGGCGCTTCA
GCCCGCGTGACAGTTCCAAACCCGTCCTGGCTGTCGCGTGCCTAACTCATTCTTTCTTTT
GATTTTTTTACATTCATTTCTATTATTTCTCTGTCATTTATCTTTTCCCGTTTTTATTAA
GAAAACAATCAGGATTTACAATTTTTAACAAAGAAAAATAAGATAAAACGTTTCAGGAAT
GTCACTAACGGTCCTCTCAATCAATTTTCAGGTGAAGGTTTTAAACCTTTAGCCTCATTA
GTCTAACTGAAACACTTTATACATGTGATATTATTTATCTATAAATATTTTTATATTTAA
AAAAAAACACTGGTAAAATTAGATCATTTTTATGAAACTCTCATTTGTGCCTGTGTTCAA
AAGTTTGATTAATGAGAATAAAATTTGGTTTAGTTAAGAAATTAAACTAAAAATCTCCCG
TAAGTCAGTTTCAGAAGCACGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1056, 1906..2036, 2181..2274, 2679..2773, 5759..5946, 6016..6219, 6504..6581
1027..1056, 1906..2036, 2181..2274, 2679..2773, 5759..5946, 6016..6212
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved