Oryzias_latipes Locus NCL
snOPY snoRNA Orthological Gene Database
Oryzias_latipes NCL
Oryzias_latipes
NCL
4
SNORA75
5812..5946
8182
TCCTGGGACATGTGAAATTTCTTTGGTGAAGGCAGAGACTCCTTGACCACACGAAATAT
TGAAATTCATGTAAACAGTTTTACTCGGGTGAAAATGTACCCAGCGATAGTGCTTTAGAT
AACAGCCAATATAAGTAATCATTACAGGATTTTCAATGTGGTGACTAGCACTTGTACATG
TGCGTTAGCGCTGAAATGATTAAGTTAAGTGAAGGTTAAACTTTTAAAAAAAAATGTATA
TTTATGATTGCAAGAACTATTTTGAAACAAACAAACAAAACTTTAGGAAAAAGAGAAAAG
CAAACGAAGAACTAAAACAGAAGGTTCCCATAGCAGTCAAGTGTTGAGAGAAGACAGGTG
GCATAAACCATCTGGTACAATCCATCTGCGCACATGGGATACAAAAGACCTTTTATGTCG
GCTTAGAATTTAGCTTCGTGCGTAAACACAGCTTAATATCTAATACTTGCCTCAACACAC
AATAACAGCACTTTGCAACTGCAATTTATTTTGCAAAATATCGTTTCCCCACTTAAAAAC
AAAGCCAGGTTTCTACATTGCATCATTTTATCACTCTTTTTATCATGGTGTGTGTATGTG
TGTGTGTGTGTGGAGGGGTCGGCATTGTGCGGATTTTAAACCAAACAATTTTTTGTCTTG
TCCCTTTTTTTAATTTGATTATAATTTTATGCATAGCACTTTGAGTGACCTGAGTTGTAA
AAGTGCTATGTAAATAAGTTTGATTTAATTGGATATAGTTACCAGACATCTAAAATGAAT
TATAATATTAACAATAATTAAAGAGAGAATGTTTATTCTTTTACAACTGAAATTTGCACT
TGTACAGCAATCCGTGACGTTTATTATTTTTTTGTCAGCGCGCGGGCACGATGCAAAATT
ACCAACCTTTGATTGGTTAAGCGCCGTCATGTGGGCGGAGCCTCGTTGGAGGGCAGACCT
GACCAAACGCTGTTGCGGATCCTCTGTCTTTCTCGTTTAATGTCCCACTGAGTAGACAGG
GCCACGTGCATACAAGCAGTTTTACAAGTTGCATTCAGAGATCCAGATTCTAGTGTTTCT
TTGAAACACTCTTCAGAAGCAACCATGGTGAAGTTAGCTAAGGTAAGATTCTAAATTGCA
AATTGTGCTGTTGTTCTGTGTTGACGCAAGTATTAGATATTAAGCTGTGTTTACGCACGA
GGCCTAAATTCTAAAAGTTGATGCGTTTGCTAATAATAAAACTGCTATACGTGCCAAATG
TCTAATCGTGATTTCAAAACTAGGTTCGAATTGTTATTTTTGTAAATAAATTAGCTATTT
GGGGAGAAACGTGGGTTCCCTCGTTTTTAGACGTCGCTTTTCTGTCGACAGCACAGCAGC
CATGTTGGTGCCTTGCTGTGGATCGCAGGCCGAGCTGGGCCTGCTAACGCTAGCCCTCTA
CTCAAGATGGCTTTCACGCTCGCCCTCGATTTCAACTTGAAGAAAATACTTCCCCGTCTA
TCGATTTTCGATGAAAATTGTATTTGAAGATCGTTTGTGTTAAGTCAATACAGTCAACGA
TGAGATTAAGTAAACTTAATATCGTATTAAAATATTAGTGTATATTTTGTGACGCCATTC
CCAACTTAGCGTAAATGCATATGTTTAGTCTTGGTTGATGGCTCCAAATTTTACAACATA
ATTTTCTATTTTATGATATGGTAGTTGAGCAAAAATGTTTTAAATTCGCGTTAGTTAGCA
CTAAAGGTGTTTAAAAAAAAAAAAGCTAGCGTGCTGCTACTCTGCCGGCCTCCCCTCCCG
TGGCCCACGTGGGTCGCACGAGCTCTTCTGACTGATGCATGAGGCCAACAACGAAAACCC
AGAAGTATTTTCGATGTGCAGTGTAAACATTTAGTCTTGGTATGTGTGAATCAGCCGAAA
AGGACTTTAATTTTTTTGGCGTTTTTGAATGCTACGATAAGGACTGTCAAACTATTTTTC
CACCTCGTGTTAGTTAGCATGTGGACCATCGTGCGAGCGTGGTATCCGGGATGCCATCAT
TGTCACGTGTTCCTTACAGCCTTTACTTTAAAAATGTGTGTCGTGGCAATTTTTTATTAT
TAAACCCATTTTTAACTATATCTTCCAGCCTGCAAAGCAGCAAATTCAGAAGAAAAAGGC
CCCTCCACCCCCTAAACAGGTAGAAGAAGAATCGAGTGATGAAGACGGCAGTGAGGAGGA
AGAAGAGGTAAACCATTTTCCTCCTTTATTACAAATTTTGGAATAATTTTACCAACACCC
ACTTACCTTTTTCTCACTTTTTTTAAGAGTCCACCACCTAAAGTCACAAAGAAAGCCACC
CCAGCTAAAGCCACACCAGCTGTAAAAAATGGAAGCCAGGCTAAAAAAGCAGAAAGTGAC
GAGGATTCAGGTAAACAAGTTCTGTATATTCTATTTTAGACATATGGGTTAATTTAGGTT
AAGATTATTTTACAACTTCATCTTTTAGTGTTTTTCTTTTATTCAAAGTGATTCATTGGG
TTGATTATTTGAAATAGCATATCTTTTATATGTATAAATCAGTAAGGTAGTTTAACATTC
TATCAAGATTGTGGGTTAAAAACTTTAGAATTTGCCCTGTGTCGTTATGCGGCATCATGC
ACACATGTAGTTTGTAGGTGTTCAATTTGTGAAAAAGTTTTTCATAATGACTCAAAATCA
TTTACAGAGGAAGAGTCTTCTGAAGAAGAGGCTCCACCCCCAAAGAAGGCACCTGCAAAG
GCAAAAGCCCCCGCCAAGGCTGCCCCTGTTAAAGCACAAGAGTCTGAGGAGGATGGTATG
TAGAAGCTACTGTTTTTTAACTATGTATGACCACACCACTTTACGTTACTGGTAGGCTGT
TTTTGAGGAATGTTTTAGAAAAGTTGTTGCATCTCCTCCATTTCTTGGCATACATGTGGT
TGTTTAGTACTCATGTGTGTTATGTACGGAGGAAAATCAAAGGCAGCGCTATGTCTTCGG
TGCCGGTGTGTATTTGAATCATCCGGTTCTATCCTCAAACGCTGTCACATTGGTTTGGTT
GGAGGGGAATTTTCGTGTTTATGCTGGAGACGTTTTCCATTTTCGCTCAATAGTTTTGAT
TTCTTTTTTTAAATTCCAAGATGAGTCTGAAGAGGAGGCCCCACCCCCCAAAAAAGCCAG
CAAGGCTGTTGCAAAGCCTGCTGCCAAGCCCCCAGTAAAGGCTAAGCCTGCAAAGGAGTC
CTCAGAGGAAGAAGATGACGATGAGGACGACGACTCAGAAGAAGAAGCTCCACCTCCAAA
GAAGGCTACTCCTGCAAAACCAGCCCCCAAAGCCAAGGCAGCAGCTAAAGCAGCCCCAGC
TAAAGAGGAATCTGATGATGATGATGACGAGGAGGACGATTCAGAAGAAGAAGCTCCTCC
CCCCAAAAAGGCTACTCCTGCAAAACCAGCCCCCAAAGCAAAGGCAGCAGCTAAAGCAGC
CCCAGCTAAAGAGGAATCTGATGATGATGATGAAGATGATGATGGTAAGTCGGCAAAACA
AGTGTCAATTAACTTCTTTAACAAATATGATCAAACAGGGACTTAATACTGATCATGTAT
GATGTCACCACTTAAAACATCTGACAGACATGAGCTGTGGAGCTCTCAGGGGTTTGTTCA
GGATGGAAAACGCATCTGCCTTCTTTTACTTTTCAGACTCTGAAGAAGAGATGGACACCA
CTCCCGCAGCAGCTGCTACAAAGGGAAAGAAAGCTGGAATGGTGAAGGCCAAAGAAGAAT
CAGAGGAGGAAGATGATGAGGATGAGTCTGAAGAGGATGATGAAGAGGAAGAGGGGGAAG
GTGAGTGTTGATAAATGTTGCATAGTTTTAAAGCATAAACTCACGGTTAAACTAATGCTA
AGACAGCACATCATGAATATAAGTAACAAATATTTTTGGTCTCGATTTTGCATTGAAAAA
AAATTAAACATTTCCTGCATACAACTTTGTACAAAGTCTTTTTTCTGTCTGAACAGAAGC
CCCAGCTAAAGCTGCAAAGAGAAAGGCAGATGGAAAGAAAGAACCAGTTCCTGCTAAGAA
AGCAAAGTCTGATGGAGAAGGCAAGTACAGACATGTTGGTTTATCATTCTGAAGTTTATT
TCTCATGATGATCAACAAGGGACTTAATACTGATGTGTGATGTCACCTTGAATTATTCTG
AATATGCTTGGCCTTATTCTGCATTTATTGCTTTCACCCACATTTGGATTGTAAAAACTG
TTGTTTTGTGTTTTTCCAGGCTTCTGCTTGTTTGTTGGAAACCTCAACTCCAACAAAGAC
TTTGACGAAATCAAAGCCTCGCTCAGAAAATTCTTCTCCAAAAACAGTCTAGAGATTGTT
GATGTCCGGTTAGGAGGTTCCAAGTAAGTTTAAAAAAAAAACACACACGTCTTGCCCGGA
CAAGAATGTGTGTTAAAACCTGAGATGTAGGGGTGTTTTCCCCACAGTCATTTGGGAACC
TTTGTCCTTTTAAAGGTCTTCCTGGTCATTGCTTCCTTTCATGGCTCACTTGTTTTAACT
CAAATAAATATATGGTTACCCCGGTTTCAATTGCATTGCACCACAAGTTTAAGCTTTTTA
AGAGTGTTGTTCAAAATGTTTGTTGCTTGCTTCACAATGTGTGATATAGCGATCCTGCAA
TGATTCATTTTTAGGGGTTGGAGAAGAGCGACTGAATTCAAGACAACTCAAATGTTTTTG
TGATCTTAAATAAAGAAATTCACGAGTTCAGCCAAAAACCTTTGATGTTCATTTAAGGTA
GATTTAATTTGAGGTCTAATTTTCTAATTTTGCATCTTGCTTCAATAGGAAATTTGGCTA
CGTTGACTTTGCCTCAGAGGAAGACATGAACAAGGCAATGGAGCTTAATGGCAAGAAATT
CATGGGTCAAGAACTAAAGCTGGACAAGGCCCGTCAGAAAGATAACTCACAGGAAGGAAA
GAAAGGTAAACATGCACCTTTGCAAAGTTTGTCTGCTAAATGTTTGAAGTCTGTATTATC
AGTGTTTTTCTAAAATTGATATTGGTTCTACAGAGAGAGATGCGCGGACCCTTTTTGTTA
AAAATCTTCCGTTTTCTGCCACGGTTGATGACCTGAAGGAATTGTTTGAAGATGCGGTTG
ATGTCCGGTTACCTCAGGGACAAAACGGTTCAAATAGAGGGTAAGAAAAAACTCAATTAC
AGAAGTCACTTTTATAGTTTGAAATCTTTAAAATAACTTACCAGCCTTATGCCCAATTGT
TTCTAGTTATATCTTACCTTGTCCTCATATCAGCTTTTCTGTTTCTTTAATGCAGCATTG
CCTACATTGAATTCAAATCTGAAGCTGTCGCAGAGAAGATGATGGAGGAGGCCCAGGGAG
CCGATGTGCAAGGGAGGTCCATCATTTTAGACTTTGTTGGAGATAAGAGCCAAAAAGGTG
GCAGAATGTCAGGTACTGAGTCCTGTATTGATGATATGTAACTACCCAGAACTGTTAGTA
AAATCCTTTAAATATATGTACTCAGTAACTGGTTCAAATGCTCAAACCTTAAAACCTGCT
TAGGTGTGATGAAAGTTAATTGGGAATTGAACAATTTCTACCCTTTTTGTTGCCGTTTAG
CATCAGGAGGAGTCAACAAAACGTTGGTTGTAAATAATCTGGCCTTCAGTGCCACAGAAG
ATGTTCTACAGTCTACGTTTGAAAAAGCAGCTTCCATAAGGATTCCTCAAAGGGACGGCA
GACCTAAAGGGTAAGTGCTGGAGAAGACGGTTATTGTTTACAATTCTAGAGCACCTTCTC
ATGAGCTCCTCTCAATCGCATCCATGATTCTGTACGGATTCGCACGAGAAGCAGAGCCAG
TGCACAGATCAAAACAGGCTCGCCCTACATGCTTATGGGTGTTGCCCATGTCTGCTGTGC
AACAAATATTTTGATTTGATGAATATTTGATAAAATGATAATTTAAGAAAGCTGTTTAAA
CAGTTGTAATAAAATTGTACCTGTATAAATTATTGTTTTCAATAAAAAATCTTTCTAGTG
TTCTCAGTATTTTCAGTAGCTAAATACCAATTGTAATAAATTTGAATGTCAATACTTCAT
CAATCAGAAGCAGCATTCTGTGTTGCCTGGTAATAATGTTAGTTTTTTTTTTTTGCTCTA
GTTTTGCTTTTATAGAGTTTGAGAACGCAGAGGATGCCAAAGAAGCATTGGAAAACTTTA
ACAACACAGAGATCGAAGGCCGATCAATCCGTCTGGAGTACAGCCAGAGTGGCGGAGGGA
GAGATGGAGGCAGAGGAAACTCGGGTAAGAGCTTAGTCTTTGGATGTAATCCGGAAAGAT
TTTACCTGATATGATGACAATCTTGATCTCTTGAAACTCTGTGAAGAATCAAAAGATAGT
CAAGTCCTGATCTGGTCAATGTTAGATCTTTAAAGTGGGTCCATTTGTTTTGTTGATTAT
TTTAACAGATTTTGATTTTATCCTCTCCATCAGGTCCAACAAAAACCCTCTTTGTCAAGG
GGCTCTCAGAGGACACCTCAGATCAGACGCTTAGGGATTCCTTTGAGGGAGCTGTTGGAG
CCAGGATAGTTACAGACAGAGAGACGGGGTCCTCCAAAGGGTAAGTTGGGTAGATGCAAT
GATGGGCCTTGATTTCCAATAAAAACCTAAGAAGGAGCTGTTTGGCTCATGTGAAGTTCA
GTTGGATCATCTTTATCTGTTGGATCTGAATAAAACTGTAAGCTCTAAGGTGTGTGTTTC
TTCTCCAGCTTCGGCTTTGTGGATTTTGACAATGAAAATGACTGCAAAGCAGCCAAGGAG
GCCATGGAGGATGGAGAGATCGATGGCAGCAAGGTGACGTTGGACTACGCCAAGCCCAAG
GGTGAAGGCGGCTTCCGCGGAGGAAGAGGCGGCGGTGGCGGCTTTGGGGGCCGCGGTGGC
GGCTTTGGGGGCCGCGGTGGCTTCAGGGGAGGCCGTGGAGGAGGCAGAGGAGGAGGAGGA
AGGGGTTTCAGCCGTGGTGGTGGACGTGGTGGTTTTGGAGGTACGGAGAGAGAAAAAGAC
ATCTGGATCACCCAAAATGTTTTGCTATCAGTTCATTAACCGTTTTTGTTCCTTCTATTT
AGGTGGAAGAGGTGGTGGATTTGGAGCAAAACCTCAGGGGAAGAAAATCAAGTTTGATGA
TTAAAATCTGTGTTTTACATTTGAATGGACTCTGTTTCACCATCTTCTGAACTTTTGGAC
ATTCCAGGAAGTGTCATTGATTATTTAACGGTAAATGGGCTTTTTTGTTTTTTGCCCGTT
TGCATAGACCCCTCACACCTACTGTACCCTGTGCCAGAAGCATACTTTGGACCTTTTTGA
GCTTTTCAGTGTAAAGTGTGAGGACTGAATGTCCCAGAAGAAAGCCTGCACTCGTTTCCT
ACCCAAACAGTCTTTTGCTGAAGGATTGAAGTGGATGGAGTCTGGCAGGAAGGGTTGTGA
GAGAAAAAAAAAGGAAAGATGCTTGTCCAGTCAGATATATGGTGTAAATTTAAGCAGTTT
GTATGATTTAATTTTACCTTTTTTTGTACAAAAAACAAATTAACTCATTTATCCATACAT
TTTTGTTTTTATTTTTGTCATGCTTTCTTTAGATGTTAAGTTTTACTGTTGTTTTCATAG
TCCATGCTCAGAAGTTATTGGATGTTTGTTATGGTTGTTAAACGAGGCTGTGACTGAGTC
ATGGATAAAATCTAATCTATGTAACAAATGTTTGTAGAACATTGAGTATTTTTTTCCTCA
AGATTTTCACGATAAAAATAAACCTCATAAGTTGTGATTTTTAAAGGTTTATTTTTATTT
TACATTTCATTAAATCTAAGTAAAACTTGCAGTTTTGTTCATTTGAACTTAAGTTGCCTG
GTTTGAAAAAAGCTTAAAATGTTAACAAAACCAAACATGTCCTGTTTTCAAACGTCTCAC
TAGGGGGCATACTTGTCATGTTTTAGGATTTGTGCTTTTGTGTAAGATTCAGCCCACAAA
TTTAGTGTGGAATAAGGTAATGGAATGTTACAGATTTAAAAGTAAGATTAAATCTTGTGC
AAATTTAAATTGAACTCTGATAGAATTATTGCTTTTATAGGGCACATACAGCTAGCTTCT
CAATCCACACAAATTCAAATTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 2128..2226, 2307..2409, 2725..2814, 2947..2962, 3132..3496, 3528..3540, 3661..3777, 4011..4072, 4279..4402, 4848..4975, 5073..5199, 5335..5471, 5640..5769, 6181..6323, 6513..6639, 6788..6897, 7142..7182
1104..1121, 2128..2226, 2307..2409, 2725..2814, 2947..2962, 3132..3496, 3528..3540, 3661..3777, 4011..4072, 4279..4402, 4848..4975, 5073..5199, 5335..5471, 5640..5769, 6181..6323, 6513..6639, 6788..6897, 7142..7182
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved