Oryzias_latipes Locus SF3B3
snOPY snoRNA Orthological Gene Database
Oryzias_latipes SF3B3
Oryzias_latipes
SF3B3
6
SNORD111
5129..5198
44786
TGCTGCTGATGCTGCTCTTCGGGCGTCTAACGGCGCGCTCCCAGCGTGCAGTCACGCCG
TCTGAATCTAAATGGCTGAATGTTTCCGGGGAAAAACAAGCTGAGGAATTTCAATAACCC
TTGGGTGAAGGAGACAAGGGCTGCTAAACCCGCAACAACTAATGTTTCATGAGGCTAAAG
CCTGCTAAGAAAGACACGGGGAAACGGAGGCATTACGGAATGGGTGGGAGGGTGGGAGGG
AGGGAGGCAACTGGAGACTGTTCGTTCGTCGGGACGACCCTTTGCTACAAACCGAGAGGC
GGCGCGGCTCGGTTTCTTTAAGGGAGAGCAGATTCACACTGAGCCCGGCGGCTGCCACTT
TCATCTGCGCGAGCCAAAACTACAACTTCCTGTCTGAGCTTTTCATAATTTAATGTTTGT
ATTGTCAACAAATTATGCAAAATATCCCTCTGTAGGTTCCCTGAATGCCCGTAATTATAA
TTAATATTGATATTATTCTTATTATAATAATTTTCATTATGAATGACGGTCATAGTATGA
TTGGTAGTGGAATAAAAACTCTCAAAAATGAAATACTTAAAAACAACATGACCAAAATAA
ATACGTTTCACACTTATTCAAATAAACAAAATGTTGGTCAAATCAAAAAAATACATTTAG
GAATCACAGCCATGTATCTATCACTGCAACATGCACACGTAGCAACATAGACAATAAAAA
CAGCTAAAATAAATAATTGTAACATTGGTTTCAAATGCGCTGCTCAACAAATGTCCATTC
GTTTCTAAATATTGCATTTGTCCTATTTCCACCCTTTTAAATTTAACATTTGTACGTTTT
TTTCACGCTTCACCATACTTGAGTTTTAAGCTATTCGTGGTATTTTAGACTCACTGGTCT
TTGTCGACACCTCGTGGACGTTTAACTCATCAACAGCTCTTGATTCTTGTCAGGCATCGG
GCGGGCCACCTATATCCATTACGTATCGCAAAGCGAAGGACCCTCCAACGGCTTCTTGTC
GTCGGAGCTAAAGAAAAACGTTCTATTTCATGAAGTTAAATCTCTTTGGAATCTGAATCA
TCTCTTTGAGCCCACTGGTAAAAGTTTCAATTTACAAATCTGCATCACCGTTCAACTTGT
TGAGCTTTATATTTTTTTTAATGTGTAAAAAATATCGGTGAAAAAGCTGCACAGCTGTAG
ATTCATCGGTAAAAGTGGCGCCTTGAATGAATAGGCTCCCCCAAGCTAGCAGACTGAATA
ATGACTCCTTTCATATTAATTTTTTTCCCTTTAAACCTTTTTTGGGATATCGCAACAGCA
ATGCTCGAGTTGTATACGCCACAGTCTCGTGGTCGTTAAATAACATATTGTGTAAAATGC
TAAAAAGGTAAAGCCTAATGCTATTACAAAATAGCTAGCTAATGTTGGCAGTTGCTGTGA
AGTGTGTAAACAAAATATAACCCCTTCCCGTCCTCAAATCCCATACTTCAGTGTTTATTT
CTTGTTGTATTTAGACAATTGTTTAAGTTTGATCTGTTTCACCAAGTTCAACGTGCGTCT
TTTCCCTGACATTTTACGTGCCTGATACTAAAAGTTGCTTAGTTTGCGTGTCACTTGTCA
CATCTTTGTGCAGAGTTGGTAAATATACTTTTTAATTTTTTTCCTGTAGCTTTCACCCGG
GCTAAGGTTCAGTTAGCCGCTCCAGAAGGTCGTTGTGTAGAAACAACTGACCAGCAATCA
TGTTTCTGTACAACATCACCCTGCAGCGCGCTACCGGCATCAGCCATGCCATCCATGGAA
ACTTCTCAGGTGAGCTTCTAGCGGTACTATGACGGCCTTCCACTGCTTTTGTCACTCAAG
ACCCACACCAATGAAAGCTGTGTTTTAATACGTTCTTTCCATGCTGGACTTACACTAAGA
AAATTAAGCTTTAAATTGCATTTCTGAGTATTTCTTTATTCAAATAATTGGGAATTGGTA
GCAGACAAAAATGCTACTGGGAAAAGCTTGTAGTAGTATGTAGGTACTATAGTTGCAGAC
CATAAACTCCTTTCTTCACTCCAAAATGTGCCATTCTCCCCTTAATCCTTTGATGCCTAT
TGATGCAAATATCCATTAAACCATTTCTTCTCCAAATCTACCTTAAGTAGACCTTAACTT
GGCATCTACATGAAAACAAAGACATAAGTTATTTTTTTTCCTTCATTGTCCTAAATAAAT
TCATTTGTCAAATTATAGTAGTAGGTTTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTTTACAGCCAATTCAGAATTGACAATGCCTCTTGGATAAGAGGTGAAACATCT
TCTAACTTTAAAGTACAAATGACGGCCTCTAAACCTACTCCTATTATGGAATCGACCTGG
ATGAATGAGAGTCTTCATAGACACATTTGTCAAATGGTTCAACACAAAGCTGATTGTTTT
TTCTTCACAAACGTCTTATCTAATGTCAATACATTTTGTTTTTCATTATTTAGGAACCAA
AATGCAGGAGATTGTAGTTTCCAGAGGAAAGATCCTGGAGTTACTGCGCCCAGACGCCAA
CACGGGGAAAGTGCACACACTCCTCACAATGGAAGTGTTTGGTATTGTGAGATCGCTGAT
GGCCTTCAGACTCACAGGAGGAACTAAAGGTATGTAACCATCATTATTTAACAATATGTT
ACAGGTGAAAGATTTGCTGATTTTGCTTTTCCTAAAAGAATGGTCAGAGTTTATTCTAAA
AAGGCTTTGGTACTGATTTACAGATTTTTGTATGTGATTCTTTCGCTTAATTTTAATGAT
GAGGAATAAAATAAGCTTCACTCTCCTCATTGAACTTTATCCTGTAAAATTAGGTGTTTA
GGTACCAAAGGATTAGAAAGAAATGTTGCTGCTTATTGAATCACTTGATTTGGTTTGCTT
TTGATATTTGTGCTGCTGAAAATGATTTGAAAACTGTTTCTTCTTGTCATTAATTGTGAT
GTTTCTCAGTAATCTGTCAGTTAACTGTTACTGTTGAAGCTTTGTGTGTGTTTTGCTCTG
GTTTGGTTTACTCTGGACAGAGATCTTCCCCCAAATATAAGCTGTCAGTTTTCAGTGACT
GTGTTTGATGAAGGTCAAAACTCTTAAGCTAGCAGGAAGCCCTTTTTTCACGTTTACTTT
ATCCTCATTTTCAAAACAAATTCTCAAAGCGTGTGTTTGGTTAATTTGTTTGTTTGTAGA
TTATATTGTTGTTGGAAGTGACAGCGGACGCATCGTCATCCTGGAGTATCATCCATCTAA
AAACATGTTTGAGAAGATCCACCAGGAAACCTTTGGGAAGAGCGGCTGCAGACGGATCGT
CCCGGGACAATACCTGGCTGTAGACCCTAAAGGCAGAGCTGTCATGATAGGTGAGAGTTC
TTAGCGTGTCCTTTAAATGCGCATTCTTTCAGTATTCTCTTCTTCACAATTTCAAATGGT
TCCATGTGTAATTTTCAAAGAGTAGCAAACACACAGAGTGCAAAAGATCAATTAAAGTGA
AGATTTCATACATTTGAAGTAATGAGAGATATTGAAATGAGAGATATTTTTGGTTTTCTC
TCTGCTGTTTAATTAATTTAAAATGAATTTGTGCAACTTTTTCAATGAAGCAGGTTCTCT
GTAATGATCGATTGAAACTGAACAGAAGGTTGCAAACATAGTTGAAAAACACATTCCTCT
AGAAATTTGCTTTGTTACCCGCGGCCGTGGTGCAGCGGTAGGGCGGTCGACCCATGATCG
TATGATTGCGGGTTCGATTCCCGCCTTGCACGGCCATGTGTCGAAGTGTCCTTGGGCAAG
ACACTGAACCCCGCCTGGGTTGGGAGGTGGGAGGTTCGCGCCAGTGTTCGGCAGCAGAGC
CGCCATCAGTGTGTGAATGCGTGTGTGCATGGGTGAATGGGACTGAGACTGTAAAGCGCT
TTGGGCCTTCGAAAGAGGGTAGAAACTGCTATATAATTATACGCCATTTACCATTTGTTT
TTACTGCTAAATAATTAAAACCCCTTCTAGTGTTTTTTTTTTTAATTCTGACTAAAAAAC
CTTGAGCAGGACATTTTTCTTCTCTGTATATTTTGATAAATTTTGTCTTAAATTTCAATT
ATTTTAGAATGTTTTTAAAGAAATTTCAATTTATCTTTTTTTAATAGGGAAAATTTACCA
ATTTATGAAAAAGTCACAATAAGGAGGCTAATATGTTTACATTTTGAATCTTCTAAGAGT
TAAATGTCCGTTTTTTTAACATGCAGGGGATGAAACGGAAAAATCTGTATCTCATCTGTA
TCTTTTAGGTGACTTGGTTTAATATCAGATGTTTGTGTGAAATCCTGAGTTAACCGGCAC
TCTTGATCCTTATGGAGCAGTTACTACCTGGTTGTCAGATTGCATGAACTGCAGTTGTGA
AGGATCCTAGCAATGGTTTTTTTAACTCAATGTGTCACAACTGTTAGCATCAGTCCAAGT
GTCAGAATCCCCCAAGGGAAAGAGGGAATTCTTGCTAACTTTATTCTAACATTGTAAATC
TGTTTCTGGATGTGTTTTGCTCTGCTCCTCAGGGGCCATAGAGAAACAGAAGCTGGTTTA
TATTCTGAACAGAGACGCTGCAGCCAGACTCACCATCTCCTCTCCTCTGGAAGCTCATAA
AGCCAACACTCTGGTCTACCATGTTGTTGGAGTCGACGTTGGCTTTGAAAATCCCATGTT
TGCTTGCTTAGAAATGGATTATGAGGTGAGTAAGTGTAAAAATCAAATAGTTTTTTTCTT
TCTTTTATATAACTAAGGCTTGGGCTGTTTTGAGTGTGATGAATTTTCCATGTCTCTTCT
CTGACTGTTACTGGAGAAAGATTTGATTTCTGATCTCAGTTTGTCCAAAAGGTTGATCAT
AACAAACAGGTTTTAAAATGTAATAACGGGCTCTAAATAACCTTGCGTTCTTTGCAGGAG
GCGGACAACGACCCAACAGGAGAAGCTGCTGCAAACACCCAGCAGACTCTCACCTTCTAT
GAGCTGGACCTCGGCCTTAACCACGTGGTGCGAAAATACAGCGAGGCTTTGGAGGAACAC
GGAAATTTCCTCATCACTGGTAATTATTCAAATCCATATGAAGTTTTTCATTAAGACGCA
GTTTGTTTTTCGTTTATGAGTAAAGTTGAACCATTTTGAAAAAAAAAAAAAGTTCTGTCA
CAACGCTGATAGGTAAGGTGGTAAGAAAGACTGTTTCTGTTGAGCTTCTTTGGGAGATGC
TGTCATCACATCCGAAACCGTAACTTCACCCTGGCAGCTCAGAGGTGAATTTTCTCTTGA
AGTCCCAGTTCTCGTGGTAATCCATCATCTGCACTTGGTTTTGTGCGTGCTTGGCTGGTA
AACCAGACTTGTCTTCCCATAAAATGTTGGCAAAAGAATAACATTTCTTGACTATATGAA
TCTTATCGGCACAAAAATAATCAGTCTTGGATCAATAATCCTTCCTGTTTCCTATCATGA
CTGAAGAAGAAACTTCTTCTCTGTAGTTCCGGGGGGTTCAGATGGACCTAGTGGAGTTCT
GATCTGCTCTGAAAACTACATCACCTACAAGAACTTTGGAGACCAGCCAGACATCCGCTG
TCCCATTCCCCGCCGCAGGGTGAGTCCAAGCAAAAAACCAACAACATTTTTCAAAGACAA
AAAAAAGGACATATTTCAGTCTGAGAGCGACTTCACATAGCTACAAATAGAAGCAGATTT
TTTTGTTTATGTGGAAACCTTTTGCAAGTCACTCACTCTATTTTCTATCTGCCATTTCAG
TTCAGCCTGCATGTTTATTTTCATTTTGCTGTCTGTCGTCCCTCATGCTCTCTTCTGTCC
GTCCCACAGAACGACCTGGATGACCCAGAGCGCGGCATGATCTTTGTGTGCTCAGCCACC
CACAAGACCAAGTCTATGTTCTTTTTCCTGGCTCAGACGGAGCAGGGAGACATCTTCAAG
GTCACACTGGAAACGGACGAAGAAATGGTGCGTGCATGCAGAAACTAGCTGATTGGCTGT
TAAATGTAGCCTGATCTTTATTAAAATTGGGAAAAGAAAAATGTTGCAGACATAAGGGCT
GATATTCTTTTAATTTTTTAGAGGGTGGCAAACAATATCAACCACCAGTTTTGTAAAATG
TATCGCCTGACTTTTGTGAAGGCGTGTTTTTCAGATGCGTTTATTGATGAGAGTGAAGTT
CTTCATGAGGGCACATAGGCACGGCATCACTCTGAAGTCGTTTTTCTTATTAGTTCGTGA
TCTATGGAGAACATGCAGGAAGGACAGGCTGCATCTCTGAATGATGAAAATGTCCTATAC
AGTGGTTCATAACTACAAAGTGGTTCATTTTTCATGGCCTTGCAGTTTTGCAACTTTTAT
TTTTACAGCCCATGGTGTTCTGCATCCTGATTGGCTGTAGACAGTTATCAATCAAGTGTT
TTCTGTACAGAATACATTCAGTTTTTCAAAGTACATAAACCCTCAGTTGCGCTTAAATCT
TTGTTTTTAATCTATAATACTGGACTTATTTTTCTTTTCTGTCTGTAAAAAGTGGATAAA
GTGTGTATTGAGGAGTTTTACAGCTTCAAAACTAAATTATTCTAGATTCTAAAAAAAACA
CCTTTTTGTGGATTTCAACTATTGCAAGTTATTTACTTTGAATATAACTCCTGCAGTAAA
CGAGGGAACACTATTAGTACGGTATATATAAGCTTTCTGCCTTTATTAAGTCCCAAAACG
TTTTACAGTCCCAGTCCCATCATCCATGCACACACACATTCACACACTCCCATTCATCCA
TGCACACACACACATTCACACACTGATTGATGGCAGCTCTCCTGCCGTACAAGACCCTTG
TAACCACCAATGTGGGGCTCACCGTCTTGCTCAAGGACAGTTCGACACATGGGCAGTCAA
TCAGCGGTTGATTGCTCTCGTCTGTACCACAGCCATCATGAAGGCAATTTAACAATGCAA
TGCAGTTTTAAAATTTTGTTTTAAGACGTTTGGCTTTTTTGTGTTATTTTCAGTAGCCAA
TGACTGTCATCAGTTCCCACTTACACGTCTGCTTTACAGAGGAAGCTTTCTAGTTTAGAA
CACAATCACACATGAGTGATGACTGTTGTTTCAGGTCACAGAAATCAGGCTAAAGTATTT
CGACACGATTCCTGTAGCAACAGCCATGTGTGTCCTGAAGACTGGCTTCCTGTTTGTGGC
ATCAGAGTTTGGAAACCAGTAAGTTTCGCTCACCACTCTTCCTTTAGGCTGGTCTAGGTT
AGCTTGTTCTGTGTACTGAGCGCTCGTCACTCTGCTGCCTTTTCCTGCAGTTACCTTTAT
CAGATCGCTCACTTGGGTGACGACGATGAAGAGCCCGAGTTTTCCTCTGCCATGCCGTTG
GAGGAGGGAGACACTTTCTTCTTCCAGCCTCGGCCGCTCAAAAACCTGGTGCTGGTGGAT
GAACAAGAGAACATGTCACCCATCATGTCCTGTCAAGTGAGTTCTTGCACTTTCAAAGCT
GATTTGGGGTAAATGGAGTTTAAAAGAGAACAATAGAAACTTTTCTTTTCTTTATGCTGC
TCGTTAGATTGCTGATTTGGCAAATGAAGACACTCCTCAGCTGTATGTCGCCTGCGGACG
AGGTCCCAAGTCAACTCTGAGAGTTCTTCGGCATGGACTGGAGGTATTTCTTTTTGTATA
TATAATATTTATGTAGAATTAGAAAATTCACACAGTCTTCCTGCTGATCAAGTGATGACA
TTGTCATGTCTCTTCTCTGAGTAAAATCTGAAGAGTCTGTCAATAATTCTGACACAGCAG
AGGTTGAGTACATTTAATGACGGACGTGATTTTGCACCCCCCCCCCCACTAATTTACTGC
TTGTAAATAAAATTCAGAAAGAAAAGTTTATGCCGTGAAATTCAGTAGAAGTGGTGTTTT
TATAGAGTGTTTTGTTTTCCAAACTACCTAAATGCTTACTACCCATTTAAGTGTCGGACA
CATAGCTACAGTACAGTTTATGGCTGCACGATAGGAGGAAAACTTGTGATTTGCGATATT
AGTGGTCAATATTGCAATGACGATATAACATGCAATACATTAACAAATAAAACATAGTTT
GCATTTATTTCCATGCAACAGTCGAAGGGGGGTCTAAGGGCAGGGAGGCCAGTATAGCAT
AGTCAGTTTGTTAGTTCATTTTAGTATTTTCCTATTGAACTCTTTGTATTCGTGATCCTT
TTAAGTTCATGTTTTACTTCGAAGCCCATCGAGACGACTGTTGTTGTGATTTTGGGCTAT
ACAAATAAAATTGAATTGAATTGAATTGAATTGAACAGTTTAATTTAAATAAGTCAACAT
AACTTAACTGAAAATATACTCCAAATGATCCTCATCTACATAGGAGGGGATCAAAGGGAC
ATCAAAGGGGTCCATCCGATTGGTCAACAACGTGAAGGGGTCCATCTGATTAGACCGCAC
CTGATTACAAGCCGCACTTACTCAATTTAAGGAGGTTAAGTCACAATTTTCATACACAAG
CCGCACCTGTATTCGAGTCGCATGTTGTTACCAACAATATTGGCCCGTCACTGCTTATCC
TGCCCTATAGACTATGCGACTGCCTTCAGTCTCTTTGAGGGAGGAGTTAACAGTGCGTCA
GCTCATGGATTTGAACACACCCACGTTTACCAAACAACATGCACCTCACTTCTGCTCACA
GCTCCCTCAGTTATGGTCAGGAAATTTACACCCACGTTTCCCCACTTCCCATGAATCTTA
GGGGTTTAAGACGGGGCTAACCCCAGTGTTGCCACACTGTGTTGTAGATTGAGGATGTAT
ATAAGCTGAAACCGCGTGCGTGTTTTGATTTGATTTTTTGATTTGAAATGATTTATTTCA
AGCAATTAAGTACAAATAATACACAACAGAAATATAATCATCAGTTATACATTGCTTGAA
AGGGAGTGGAAGGAAGCGAACTTATATAATCCCACCCCGTTATACTGTAACCATTTTATT
ACATGATTTATCAATATCCGGTTCCCAGTTTTTATCAGACAGAATTAAAAATCATAAGAT
ATCGATAAAGCACATGACAAAGATGAATTACTTAAGTATTACGTCAAAAATAACTATTTT
AGAAATCAACATGGCAAATGCAGATCAGTCATATGAAATATATGCAGATTATGTTACTTG
TAAAAGCCATTCATATGTATAAAACATAATACTATATCAGTAAAGTAGACACAACACTGT
TTCAGGAATTTTCATAGCAAAATTTCATCAAGTATCAAAAGTTAAAAACATGTGCAAAAT
TATGCTACATTAGGAAAGATTTTTGAATCAATTTATCAATTTTGGAGAAAGTGAAGTAAT
ATCATTAAAAGTCAATCAAATTAACAATTTTAAATAAGTGATTAATCATTTGTTTTACTT
TTTTTATTTTTTTTTTATTTTTTTATAATAAAGTAATGCTGTAGGGGAAAAGTAAAAAGG
GTCCATAACTGTCGATTGTCCAAGGTTGGCNNNNNNNNNNTACCTTTGGTTTGTCTGTAG
ATAATAACCCCTCTTGTTAAAGTAAAATATGTCCAACACAAGAGGCCCTCAGCTCTCATC
TGTTTGTCCAGCTGTTGGACAGGTCAAGTTAAAAAGGAGAAAAAAATGAAAAATAAAAAA
AAATAAAAGGGAGGTTTGATATCGATCTATAGTTGGCCATGTTGCTAGGATCCAATCTGG
GCTTTTTCAGAAGAGGTTTAACAACTGCATATTTAAAAGACTGTGGCACGTAACCTGTTT
CTAGAGAGGTATTTATCATTGTTAATATTTTGATTTTTTTTTTTATTTGAAATGGTTTAT
TTCAAGCAATTAAGTACAAATAATACACAACAGCAATATAATCATCAGTTATACATTGCT
TGAAAGGGAGTGGAAGGAAGCGAACTTACATAATCCCACCCCGTTATACTATAACCATTT
TATTACATGATTTATCAATATCCGGTTCCCAGTTTTTATCAGACAGAATTAAAAATCATA
AGATATCGATAAAGCACATGACAAAGATGAATTACTTAAGTATTACGTCAAAAATAACTA
TTTTAGAAATCAACATGGCAAATGCAGATTAGTCATATGAAATATATGCAGATTATGTTA
CTTATAAAAGCCATTCATATGAATAAAACATAATACTATATCAGTAAAGTAGACACAACA
CTGTTTCAGGAATTTTCATAGCAAAATTTCATCAAGTATCAAAAGTTAAAAACATGTGCA
AAATTATGCTACATTAGGAAAGATTTTTGAATCAATTTATCAATTTTTGGAGAAAGTGAA
GTAATATCATTAAAAGTCAATCAAATTAACAATTTTAAATAAGTGATTAATCATTTGTTT
TACTTTTTTTTTTTTTTTTATTTTTTTATAATAAAGTAATGCTGTAGGGGAAAAGTAAAA
AGGGTCCATAACTGTCGATTGTCCAAGGTTGGCATTTCTTCTTTTACTGATAACAGCCGT
ACTTCTGGGTTTAAACAGAGTTTATAGTTCTCTTCGATGTTATGTCTGCAGACATTAGAT
TCAGGTCCATATCCTTCTTCAGCTGATATCAGCGACGGTGAAAGTTGAGGTCAAGTTGTC
TGCAGGTCAGAACTCTCTGCTGTTATTCAGGTTACGTCAGACATACAGAGAAAGTGAGGA
ATCCAGGCGTCATATTTCTTGAAATTATTTGGCTCTTTGGTTTATTACTCCATGTTGTTT
CAGACGACCGTGATTAAACACTTCTCAAAGTCCTTCATGGTGCTCACAACCAGAACCTTG
GACCGGTCCTCTGGACCGAGCGGTTTGACGTAAATCCTGCAGCCTTTAACCCAAGTGTTC
TCAATCTGCTTACGCTTCCTGAGAAGCCTGGCATTGTTTGGGGATTTCAGCATTCCTTCT
GGTCAGATGGTCGTTCAGATGAGCAGCAGATCCCATCAGATTCTTCCTTTGATTCATCAA
AGCTAGCTTGTGTTTGTGANNNNNNNNNNGCTGGTTTATCCGTCTCCTTTCTCCTGGGGA
GCAGATGGCAGGTCTCGATGGTATTGAGATCCAGGGAAATCCCTTTAGATGTGAGAAATG
AATGTATTTGCTGCTCCAAAGACTCTGCCCCGATCACCGTATTAGCACTGCTAACTATGC
TAGCGCTAGCATTAGCAGTGCTTGCTCCTGCTGTCAGTTTCGCTCGAGGCTTGATTGGTA
CTCCAGTGAGAATGACATTATTCATCCTTACTTGCTGTTCCACATCGTCCAGTCTTTTCT
CCAGAATCTCAACCCGGTTTTCTCGCTGCTCGTTTTGAGCCCGAAATCTTTGGAACTCTT
CCATCATCTCCCAAAGTGGCGTTAGCTTAGCCGACACTTGTTCCATAAAACTTTTCAGCG
TTTCTTGAATAATGTCAAGAGTCTTTTTGAGGTCTTCGTATTCCTGGGGTTTCTTCGGGG
GCATGGTCAGCTCTCTTTTTTTGGGGAAAATCAACCTTTAAAGTAATTTGAAGATAGTTG
TATTCGCAGAGAGGCACGCCACGCGCCCTGCCCGTAACCCGGAACCGGAAGCTCATATAT
GGGATCATTAATTAGGGGAAAGGTTTCTTTAAAAGGTCTAGTTGGAATTGGGTCTAACAG
ACAGGTTGAGGATTTGGAGGACATAATAACTGATGTTATTTCCGCTTGATCCACAGCAGT
GAAGCAGTCTGATATTACAGAGGTTTCTATGGATGCCTTCACTTCTACCGCTTCAGCCTG
CTCTGGGCTGATAGTAGGAACAACTTGATTCAACTTCTGTCTAATATTTGAGATTTTATT
ATCGAAAAATGTAAGAAAATCATCAGAGCTGAGAGAAACAGGAACATGTGGTTCTACTGA
GCTCTGACTGCGAGTTAATCTAGCAATAGTACTAAAAAGAAATCTTGGATTATTTGATTA
TTTCCATTTTCCAATATTAAGGTTGAATAGTACTGGCTTCTAGCTCTATGCAGAGCTTTT
TTATAATTTAATAGGCTATGTTTCCAGGTATTCAGAGACGGCTCTCAACCGGAGCGGCGC
CATTTTCTTTCCAATTTACGGATTACTTGTTTAAGAAAACGTGTTTCAGCATAAAATCAC
GGTGCTACTCGGTTTTGTCTAACAAATTTAGTTTTCAGGGGCGCAACAACATCGAGTGTA
TTCTCAAGGGCTTGTAAGGCATCATTAACAAATTGGTCATTTATCCCTTGTGCTATCTTA
GATGACCCCACCCTTACATTGACGTGTTCTCCCTACCATGACAAAGGTGGAAAGATTTCA
TGTAATCCATAGACACCAGTGAGGTTCACAAATTATTGAAGAAAAAAGGTTCAGCGCACT
GTCTAGTGGGTCTAGATGACCCAACTCCCAACGTTAAAGTGCCTAGGATTATTCACTGGG
GCAGTAGCATGTTTCAATCTAAACTGGAAGGTAATCAGAAATGATGGGGTTAAGAGGAAG
GACACTCAGCTGGCTGATCTCTATACCATGGGTTAAAACAAGGTCCAGGGTGTGCTTGTG
ACAGTGAGTGGGTTCATTTACATTTTGGGTAAAACCGACATCATCTAATAAAGCTGCAAA
AGCATTTCCTAGACAGTCACTGGGGTCATCAACATGAATATTAAAATCCCCTAATATTAT
AATTTGATTAGAATCTAAAATAGTAGTTGATAGGAAGTCGGAGAACTCAGTTAAAAATTC
TAAATACGGGCCTGGGGGGCAATAAATAATTACAAATAAAACAGTTTTTTTAGTCTTTCC
GTTTGGGTGATTTATAGACAATATGATGCTTTCAAATGATTTATAAACATGCTTTACTTT
AAGGCTGAGAAGTAATCTAGACTTTGATATTACTGCCAAACCACCTCTTTTCCCTGAAAT
CCTGGATTTCTGATATTTAGCATAAGTGTGTGTGTGTGTGTGTGGGGGGGGTGCTTCATT
CAGTCTAACATAGTCATCCTGTTGGAGCCAAGTTTCTGTTAAGGCTAATAGACTAAGGTT
GTTGTCATTGATTAACTCATTGACTAAGAGGGACTTGGAGGAAATGGATCGAATGTTTAA
TAAACCACATTTAACGACATCATAATTCTGCTTGTGAGTACTGCTGTCTGTCACTTTAAG
GTTTCTGTGACGCACTCCTTTCACTTGTCTTTCAGCACATAAGCTAAGCTAGGAACTGCT
TGACTTTCCCTGCATGGGGATTGCACCAGCACCAAGGGAGGCATAGAGGAGCGTTTTACA
CTGCTCGTCTCTGGGTTGTCAGGTTGTCAGATTAAGGCTAGTAGAAATGTTTTCTAAAAA
GAAGAGCGGCACCTTACCGAGTAGGATGGACGCCATCTCTCCGCATGAGACCAGGCTTCC
CCCAAAACGCGCTCCAATTGTCAGCAAAACCAACGCGGTTTTCTTGGCACCATCTAGAAA
GCCAGCGGTTAAATGATGAAAAGCGGCTGTACATTTCATCACTGACTAGTATGACACATA
TGGACTGGATGAGCGAACTCCCACAAACCCTCCGGCACCCTAAAGATGGTGTAGAGCTGG
TCCACTGTTCCATGACCAGGACGGGAACCGCACTGTTGTTCCTGAATCTAACGTTCGACT
ATCGGACGGACTCTCCTCTCCAGTACCCTGCCATGGACTTTCCCAGGGAGGCTGAGGAGT
GTGATTCCCCGCTAGCTGGAACACACCCTCCGTTCCCTTCTAAAAGAAGGGAACCACCAC
CCCTGTCTGCCAGTCCAGTGGTACAGTTCCTGACTGCCACGCAATGTTGCAAAGACGTGC
CAGCCAAGACACTCCCACAGCATCCAGAGACTTGAGGTACTCTGGTCGGACTTCATCCAC
TCCCTGAGGCTTGCCACTGAAGAGCTCATTGACTACCTCAGTGACTTCAGCCCGGGTGAT
GTACAGCCTCACCCCAAAGTCCTCATTCTCTACTCCCTCAAAAGACGGTATGTCAGTGGG
ATTGAGGAGATCCTTGAACTATTCCTTCCACCGTCAGAAAGCCAGAAGACAGCACTTTCA
AAACATTCGTGTTCTTCGTGTGGCCTTTACCCAGACACCAAAGAACACAGTCAATGTCCA
GCAAATAAACACACAGATGGCAGCTGAGTGCCTCTTGTGATGGACAGGTTTTGCTTTTAC
AACCGGGGTTGCTTAAGCATCCTTGGATTGTGTTCATGTAAACCCTGTTTTGTAATTAAA
GCTGAACTTTATTTAAAGAGTTTTAGTCGCTCAGACAGGACGAGAGGTGGTGGTGGGGTG
TGTGTAATGAAACAAAATCATGGGATTAGATAGGTGCCATTAGGAAATGACATGCGTTGG
TGTTCATATACACGCTTAGACACCCACAGTATCAACACAACTACTTGCAAGTATCAAGTA
TGTCGATACAAATTGACAGCATTTATAAAGGACTTATATCACGAATCACTTTGACTGGTA
TTTTCTTGTGCACAAAGACAGACATCCATAGGATTTGCATTAGCAAAGAAAAAAAACAGG
TTAGTTAGATGACTGTGTGTTTCCTAGTGTAGCAGGATGATGCTGCACAGATGCAAGCAA
TGCCCTGACTACCGGTACCAGGGAGCAGTATAGAAATGGTTTGGCCCAACACTTAGGCAC
TTGGTGTATGGTGCCAACAAATGAATATCTTTATACTTTAATTTATTGCAGAATCCAAGA
AAAAAAATGCTGCTGTACTTTTAACAATGGGATGTACAATACCATAACTCTTGTCTTTTA
GATTCTGGAGCCATCAGTGAAGATGCTGATGGACAAAACTGAAACGCATCCAAAGGACAG
AAGAGGTGGTGATTTATAAGAGATGTTTTGGAATGTGGAGACACAATTTAAAGGAAGTGG
ATGTTCATTGGCTGGAACACACCAACTGATGTGCTCCTGGACCAAAGCAGTGAGGAAAAT
GATAAATGAATGGGAGGGAAAATGGAAGTGAAAGCTCCACAAACGACATGGTGTCACCCA
TAGGACTGTGAAACAGCTTAAGGTGCTGATGACAAACGAAAAACTGAGCCTTCATGCTGA
CCTCTGAAGCTGGATCTGACTGAAAATCAGATCGTGGTCTAAAACTGAAACTATCCTGCG
TTCAGTTGTTACCTTCAGGTTGGGAGGGGCTGATGAGCGTGAAGGACCCAAAATGCATAG
ACGGGAGGCACACGGTTCCAGGGCAAGGGGTTTATTTGTAAAAAAAAGGCACTGCAGAGT
AGGGTAAGAAAACCAAAACTTACTGTGGGCATAGCATAAACACATGGCAGAAGGGAGTTA
GGGAAGAGACATTAATGGACCAGACCAAAAGGAAGGCAGAGACAAGACTTATATACAGAC
TGACAAGACACAGGTGAACATGATCAGAGGAGATTGGGACCAGGGAAGTAAAACTCAAAA
GCATGACAAAACAGGAAACCTTTCAAAATAAAACAGGAAACAGAACTCAAACATGACAGA
AACAAGATGGAAAGCAAAAACCAATAGAAAGAAACCCGAACCATGACAGTTACAGACAAA
CCATGAAAAAAGAAAGAACTTTCACGATCCTTGTGATGGCAGCATGCACATCCAGTTTAG
AAAATGATGCACATTTTCTTCCGCTGTTTTCAGATTTGTTTACTTTACTTTTTCAGACTT
TTTGTGTGAAAATCTAAAGTTTTGTCACATTTTCAAAGTATGTGTGTGTTCATTTGCAGC
GGAAACTTAAGACATTTTGGTACATTTATTCAAAGTATTGAAGTTTATTATCAGTTGAAT
TAATGCCATAGGCTTTGAGGTTACCAGTTGTCATGGTGTCCCACATTTTTATTCCTGTTC
GGGGTCATGGGGATGCTGAGGCCAACGGCTGCTGTGAGGGGAAGCTGCTGGACCATTCTT
AAGGCCATCAGAGGGAAGATCTCTGCAGCATCAGCATCAACTCCATCACTGAACGCACAG
AAACAATATGATCATGGACCTTTCCATAACTAGCATTTGGGATCTAAATTTTACTAGATA
GGAGGGTTCATCTGCTGGCCTGGTTGAAATATATGAGAATGTGAGCAAACTGGAATAGTC
CAGTCAACACTTCAGACAAATTCGAGCTTTTTGTTGATTTTGGCTTAAAGAATGCCCTGC
AGCAAACTGGCGACCTGTTCAGGATGTTACCCGCCTTCACCCAATAATAGCCAGGATAGG
CTCCAGCAACCCCATGACCCAAAAGGGACTCGGCTGGTTCTGAAGATGGATGGATGGCTT
ACAGAATTAGAAAGGAAAGTCTTGGGATGACATGATCTTTGTTTCTAACTTTTTGCTTAA
ATGACAGGACTAAGACTGCAGTTTGTCTTCGTAAATATCTCCATACAGAACTCAGTAGAA
GGTGACACAGCCTGACAGTCTGACAGTGACTGGAACAAGTTAGAATCCCTGATTTCATGG
CTGCAGAAGAAGACTGGAGTCCTCCACATTAAGTTCACCACAACAATTTCTCATTAAATC
TTCAAATCCCTTTATAATTTTCTTATATCCTGCAGAGTTCAGAATGACTTCACAAAACCT
CAAACTTCAGAGCCATGAAAAATGCTGCTAAAAGTAAACGGAGAACTTCTCCAACTTTCT
GTTTTGTTTGTCACACAGCAGATGGATGGTCTGAAACACAAAAATGCTGATCAGGTTGTG
TTTGTTGAGGAAATGTACACACCAGATCCTATCAAACCCCTGTTTTCAGAAGGAATCTCC
AAACACATTAAAAATACAGAGTTCCAGACCGTTAAAGATAAATGGATGGACACAAATAAT
TAGGGGGGTAACGATTCATTTTAACAATGATTCCATTCGGTTCAGTTTTTGTGGTTGCAG
ATTCGATTCACTTTTGATTTTGCTTCATTTTAAACAACCCGATTTGATCCGATTTACTGA
CCTATGATTGGTTCTGGAACGAGTCCCAGTTTCCTATGTCTCAGAGTCCTGTGCGCATCT
GTTTTTGTTTTCTGGTGGCAATTTGGGGAAACCATAATGCCACACTACCATGTCTCAATC
CAGATGCTATTTTCCAATATCGATTCAATGATTGATTTCTCATTTTGAAATAATTTTTTA
AATCGCATAGTTCGATTCAGTTTTGCCTCAGACAGACTGATCTGGTTCGATCCAAGGAAT
AGAAATGGTTTAATTGTTACACCCCTACAAGTAATCCAATTTTCATATTTTAAAAGTCAG
TCAGAGACATTTTGGCTGTTTTGGTGAAACCCTTTGGTGTTACGTAGAGTTTTCCGTCTT
TGCATCTGCTAGAATTCAGCAGTTAGCGTCACTCTGTTCTGTTATGTATGGGTCTATAAT
CCATTCAGTAGGGCGGTTGCCCGGGGCGCTGGCTCAGTGCTTGGAGAAAAAAATCTGTGA
TTTAAAAAAAGTTTAAAAAAAGCTGAGAAGGCACCGGAAAGGTGTGTAAAGAAAAAGGCT
ACTACTTGCTGCTACTACTACTGCTGCTACTGAAGCTACTACTACTACTGCTGCTGCTAC
TGAAGCTACTACTACTACTGCTGCTGCTACTACTACTACTACTGCTACTGCAGCTACTAC
TACTACTGCTGTTGCTGCTACTACTACTACNNNNNNNNNNCTACTACTATTGAAGCTAAT
CCTACTACTACTGCTACTGAAGCTACTACTACTACTGCTGCTGCTACTACTACTACTATT
GAAGCTAATCCTACTACTACTGCTACTGCAGCTACTACTACTACTGCTGTTGCTGCTACT
ACTACTACTATTGAAGCTAATCCTACTACTACTGCTACTGAAGCTACTACTACTACTGCT
GCTGCTGCTACTACTACTACTACTGAAGCTACTACTACTACTACTGCTACTGAAGCTACT
ACTACTACTACTGCTACTGAAGCTACTACGACTACTGCTACTGAAGCTACTACTACTACT
GCTGTTGCTGCTACTACTACTGCTGCTACTGCTGCTACTACTCCTTCTGTTGCTGCTACT
ACTACTGCTGCTGCTACTACTACTGTTGCTGCTACTACTACTGCTGCTGCTGCTACTACT
ACTACTGCTGTTGCTGCTACTACTACTACTGAAGCTACTACTACTACTGCTGTTGCTGCT
ACTACTACTACTGAAGCTACTACTACTACTGCTGTTGCTGCTACTACTACTGCTGCTACT
ACTACTTCTGTTGCTGCTACTACTACTGCTGCTGCTACTACTACTGTTGCTGCTACTACT
ACTGCTGCTGCTGCTACTACTACTACTGCTGTTGCTGCTACTACTACTACTGAAGCTACT
ACTACTACTACTGCTGTTGCTGCTACTACTACTGCTGCTACTGAAGCTACTACNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGA
AGCTACTACTACTACTGCTGTTGCTGCTACTACTACTACTACTGCTGTTGCTGCTACTAC
TACTACTACTACTACTGCTGTTGCTGCTACTACTACTACATAAGCTACTACTACTACTAC
TGAAGCTACTACTACTACTACAGCTACTACTACTACTACTACTGCTGTTGCTGCTACTAC
TACTGCTGCTACTGAAGCTACTACTACTACTGCTGTTGCTGCTACTACTACTACTACTGA
AGCTACTACTACTACTACTGCAGCTACTACTACTATTGCTGTTGCTGCTACTACTAATGC
TGCTACTGAAGCTACTACTACTACTGCTGCTGCTACTACTGAAGCTACTACTACTACTGC
TACTGAAGCTACTACTACTACTGCTGCTGCTACTACTACTACTACTGAAGCTACTACTAC
TACTACTGCTACTGAAGCTACTACGACTACTGCTACTGAAGCTACTACTACTACTGCTGT
TGCTGCTACTACTACTGCTACTACTGCTGCTACTACTACTATTACTACTACTGCTACTAA
TACTGCTGCTGCTACTACTACTGCTGCTGCTACTACTACTACTGCTACTACTACTACTAC
TACTGCTACTATTATTACTACTGCTACAAACATGTTCACATTGAACTGGATTAACACCTG
CCCTTCTTCCTCCCCTCTATCACCTTTGTGTCTTTTATACTAGTTTTTTATGTTTTCACT
ATGTGGATGTTTTTTTAGTATATGTATTTTAGATGATAATTTAATTGTAAATGTATATTT
TAATTAATGTACTTAATAAATGTTTTTAGGTTAATATCTGTCCGGGGACTACGAATGAAA
AATAGCCTTTGGGCTAATTCTGGCGCATTGCAGTGATGCTTTTATGTGCACTGTCCCTGT
TAAATAAACAAATAAATAAATAAATACTGAAGCTACTACTACTACTGCTACCACTACTAC
TGCTACTATTACTGCTGCTACTACTACTAGTGCTACTGAAGCTACTACTTCTACTGCTAC
CACTACTACTGCTACTATTACTACTATTACTGCTACTTCAACTACTACTGCTGCTACTAC
TACTACTGCTACTTCAACTACTACTGCTGCTACTACTACTACTGCTACTTCAACTACTAC
TGCTGCTACTACTACTACTGCTACTTCAACTACTACTGCTGCTACTACTACTACTGCTAC
TTCAACTACTACTGCTGCTACTGCAGGTTCTGCTGCTGCTAAAAAAAAGATTAAAATCAC
GAGATTTAAAATCGTAAATTTACTAGATTAAAGTGGAGGTGAGCATTCAGAGCAGCAGCA
AGTGAACACCACGCAGCAGCAGAGCAGACCCACTAAACTTAGTTAAACAGGTGAACTGAA
TGTTTATTGATAACATTCCAAATGTTTGGAAGCTCACTTGTTTGATTTAGATTTATGTGT
TTTATTGGATCTCTGCAGCCGTTGATGAAGACATCAGTGCCCCTGTCCACTGCAATCCTT
TCTTCTTCTATGAAAGACAAGATCTCTAAGTCTGTGTGAGGCTTCTGTCCAAGGTGGAGC
ACATTTTGGCATTTTCATAAAACTTCTGCTAGTGTAACAGACTATTTTCATTCATCTTTG
TTGTTTTATGTTGAAACGGGACGTTTCATCTGGAGGAGAGGGCTAACTGTTTACACATGG
GTGTTCTGCTCATGACAGCTTCATGACGTAATGAGAAAAATGGGCTTCTGGGTATTTGAA
TGAAAAGGACAATAAAGTATTGGTCGTCCACACCTAATCATGTCTCTGAGCTACTTACTT
TAATGATGAAGCTCTGCTTCACCGACACAGAACCAAAAGGTTCAGGACTTCTTTGTTTCT
GAAACCTATCTGGAAATAAAGCTTCACAAAATGCTCCACATCTTTCATCTTCAAGCTAGG
CTCCGATAAACGGACAACGTTGTTTTTTTTCCCTTGTTAATCCACGCCTTTCTACCTGGT
AAATTTGCGGGATATTAAGTCGTCAATTTGCGACTTAATATCTCGTAATTTAACAGTTAT
GACTTTTTTTTCGTAAATTTACGACTTAAAAGTCATAATAAAAAAAGTCTGTAAACTGGC
CCTAAAACTCCATCGTAGGATTGAAACCAACAACCATGAGCTGATTTTTCTTTTCTGAGG
TACAGATCAATATATTTATATATTATACAGTGTTAGACGTCTTTTGTATACAGCTGACAT
GAGCGAACAAAATTCAGTTGTGACTCTAATGGGGTTGGGGGGCAGGGGGCCCCGGGAGGA
ATTCAGTGTAGAACCGCCACTGTTGTTTGCATTAAACAGACCGTCTCTTCGACCCACAGA
CTGTGTTTCCCAAACAACAAGCACACGTTCCGCTGTTGGGTGGGTGGGTCGTTTGGGCTG
CATTCTCAGCCGAACCGAACCGAACCGGGCTGCAGCGCTACATGTTGCGCAGCGGCAGGA
GAACCTGTTGCGCGTTCCCCTCATGCTCTCGCGCGCCGCCCTGCTGCGCGCTGGGGGGGC
TCGGAGGGTCTGAGCTTTTTTCCCCAACACCTGCTTCGAGCTGAACCCGCAGCGGACACG
TCCCGGCTCGGTTCGGCCCGGCTCCAGGCGCGGTGCGTGTGGAGGCAGGCGCAGCATCTC
CCGGAATCACACAGGTGTGTCCCATCAGGAGTCGGCTCTGAGGATCTCCTCTGTATGAAC
CCTGGAGGGGGGGAGGGGGCAGACGTCCTGACAGCGGGATCCGGCCCCGCAGAGCAGAAT
CTCTCCCGCATGAAGCCGAAGAACTGCGGGTCCTCCACAGGGGGAGCATGAACGGTTTGG
ACGGTTTCCTTCAGTTCCCCCCCCGCAGAACCGGAGCGGGTGACAGGAGGAGGGGGGAGA
GCGACTTCCCCCGCGGGACAGGTGTGTCTGAGCACGCGGGACGGCCCTTCCCTCCCCATC
CACAGCTGTGGGGGGAACCGTTTTTTGGCCGTTTTCCTTTTCCTCTTTTTGCAGGTTTCT
GTTCCACCACAGACGGAGAATCCCGGCACGTGCGTGGACGCCGCGTGACTGACTGCACAG
CCCCGCACACTNNNNNNNNNNCTTGTGTTTGTGATTCACAAACCTGATGAGGATCGCTGG
TTTATCCGTCTCCTTTCTCCTGGGGAGCAGTTGGCAGGTCTCGATGGTATTGAGATCCAG
GGTAATCCCTTTAGATGTGAGAAATGAATGTATTTGCTGCTCCAAAGACTCTGCCCCGAT
CTCCGTATTGGCACTGCTAGCTACGCTAGCGCTAGCATTAGCAGTGCTTGCTCCTGCTGT
CAGTTTCGCTCGAGGCTTGATTGGTACTCCAGTGAGAATGACATTATTCATCCTTACTTG
CTGTTCCACATCGTCCAGTCTTTTCTCCAGAATCTCGACCCGGTTTTCTCGCTGCTCGTT
TTGAGCCCAAAATCTTCGGAACTCTTCCATCATCTCCCAAAGTGGCGTTAGCTTAGCCGA
CACTTGTTCCATAAAACTTTTCAGCGTTTCTTGAATAATGTCAAGAGTCTTTTTGAGGTC
TTCGTATTCCTGGTGTTTCTTCGGGGGCATGGTCAGCTCTCTTTTTTGGGGAAAATCAAC
CTTTTAAGTAATTTGAAGATAGTTGTATTCGCAGAGAGGCACGCCACACTGTTGCTCCCC
GGACGCCCGGTGCAAAGCGTGTGGCTGCCGGAGCGAACCGTGTCTCTGAGCAGAGCAGCC
GGACTTAGTTTTTGTGTTTGAGGGGCGGGGAGGATGCTTTGTTACGGGAGGGAGGCTTTG
GTCTGCCATCTGTCCCGCAGCTCTATGTGAACGAGCAGCCGAATTCAGGAAAACCGTGTC
TCCATCTCACACAGCGGCTTTGGGGCGGTGTGAGCTTTTCAAAGCAAAATGCCGCTCAGT
CCTTAGAAACTGTTCAAACAATCACGTGGATTTGTGTTTCCAGTCGTGTCCCGACAAAAT
AAAGGCCGATGTTATTCCCACATATTTATGTGCAGCCAAGCTGCAGATTGCGGCATTTCC
CGCGTCGATTCATGTTCATCCAGGCTAAATGTTGTTGTTAGCGCATGTTAGCCTTCACCT
AACCGTTCTTCCGGCTTCGTTCTGCCACAAAAAAGCACTGACCACTAGGGTTGGGCGATG
TCCCCTAAATTGGCCGTTGACGATGTTTGCTGTCAACCATCGGGAGGGACGATGACATCG
TCGGGNNNNNNNNNNTACTGCGCATGTGCGAATGATTTATTCCGACCGAAATTGTGACCT
TAGTGAACGTTTTTATATTCTGAAAACATTTTTCTGGGCCCATCTACACGGTTGGATTCT
AATCCGACCATTGATCCCATCAGGATATTTTGTACATGTAACCGCGGCTTATGGTGTCGA
CGCGCAACGTGGCGGGGGCGTGGCATCACGATGGTGTCTCTCCATCGGGATGTCAGTCAC
CCATCACGATGGACGATGATATCGTCCATCGGCACAACCCTACTGACCACACAGATTAAA
AATAAAATTATGAACGAACAGGTGCTTCATAATAAACATAACGATAATAAAAGCACGTTT
AAAAGATCATCTCGTATATTACGGAGCTGCTAAATAGCTGGGCTAGTGTCACTCTGACTC
AGAGGTAAACTCACTCCTGAACTTGTGCTGTCCTCTCCGTCACGCAACAGACCAGCTTTT
CCAAACCCGTTGGTGATGGTTGATTTTTTCACACTGCTTTTAACAATTGCTTTTAACTTG
AAAGCTGCGTCATATTGTAATGGCGGTCACGTGCACGTCATTGAATAAGCCGCAGGGTCG
AAAGCGTATGACAAAAATAGCGGCTTATAGTGGGGAAATTACGGTACATGGATTTATTTG
ATTCGTTAAATACCTCAAGCTGCCATAAGATTGTTTTAGCACATTTAAGGTTAACATTTA
TGGCTATTTTTGCTGACTTTTCCGATATGCGTATTGCACAGCTTGATATTGCGCTAACGA
TAAATTTGTGATTTATTCTGCAGCCCTAGTACAGTCACAGTTGCGCAGATACAGTAGTCT
GAGCTACATATCTAGAAACGAGAATCATTAACCAGAGGGCAGAGGAGAGGGAACTGTAAG
CCAGAGCTTTACATGCAATGACAGAGGAGTTGATATATCATGCTAAAACTAAAATGTAGC
TACACACTTTATCATTAAAACACTTTTAATTGGGTTCGATTTGGAAAAATTTAATGTTCT
TTGTCATTCTGATCCTGTAGAATAGTAGAACTCAAAAAAAAACAAAAAAAGCAAATTAGT
GTAAATATCCAAAAGTAATAGTGTGCTTATTTTAAACGGTCATCTCTCCGACGTGTTTGT
ATGTAGGATATTCAACCCAGGAAGGTGGAAAAAGCCTTACATATATGATGACGGTTTTGG
GCATGTTTGTAAGAATAACTCAGATTTCTTCTGACGCACCTTGATTTGAGTTGACGTTTG
ATCAGCTCAGAATCCAACCGCAAAGTTGACGCACTTGTTCACAAGAAGATGAAGCAAAAC
TCTGCGGACGTCTTCCTGTGTGCTGGGACACGGTCTTGTTTCTGTCTCATAAGAATGGAG
AAAATCATAGCAATGGTTGAGCTGCTGGTCTTCTTTTTTTAGATATTGATAAACAAGACA
GACATGTTTTTGATGTTCCTCTCTGGCACATCAAGAATCTGGTTACGCTACAATCCATCG
TTGGTTAGCACGGTTAGACCCACAGCCTCGAGTGCTCTAAAAAAGTTTGACACCGCACAT
GAAATTAGAAAATTATGAATCAGCATAGAGGACAGGGTAGGGCTTATGGAGAGGTGGCTT
TATCGGTTTAACCTGCTTTTAGTCACCTGCTTACAGTCTCTTTAGAAAATCCATGAGCTT
CTTTGGTCAGTGTTTTTTTTCTTCTTCCTGTTCATTCTTTGCTGTGTTGATTGACACAAA
AGAAACTCAACTCGTCTCGGCGTGAAAAGAAGCAGCTGTTCAGCACTAAATTTGAAACTA
ATGTGTCGATGGCCTCTTGATACTTAACCGAAGAGATGCTCATCTTTCTGTGATCACATT
ATTTGTTTTAGAGGTGAATCTAGACGTTTCATGTTTTTTTTTTTTTTTAATTACTGGGAA
AAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTAATTACATGTA
GAAAATGTAGTTACCAATAAGGATGCAACAATTAACTTTTGCCTTAAAACCTGAACTTTT
GGGTCATATTTTTGTTTCAGTTTGATATATGATTTGTGTTTTACAAAACAACAACTAAAA
CTAAAAATTTCGATAATTTCCTAACATTTTCTAATAGGCAAAAAACAATGAGGAAAAACC
ATTCAGTTGGCTTATAGTAGGCCTGATGTAATGTAATAAAACAATAAATCCTTAAATTTA
GTACCATTCTTCTTTGACACTTTCATCATAAACATACTTGTATGCAGTAGTGATGCAACA
CTACGATACTGAGTTTTAAACTGCCAAAATGTTATGTAGATGTGATGCTTTATTGTTTAA
TGCAAGCAGAAGAACATTATAAAATAAAATAAAAAGTGAGAAAGCAGAATCTATCTTTTG
TACTTTTTTTGTTGGTCCTCTTTTTCTGAGTTGTGTCCTTGTTCTCAGGTGTCAGAGATG
GCTGTTTCTGAGCTGCCTGGTAACCCCAATGCTGTGTGGACGGTACGCAGACATGTGGAA
GGTAACCCTACATTTAATATTTCACATTTATATTTACACAAAAGAGTCTAATACTGTAGT
TATACTATATCTCAAATATAAGACAGAGAACTTTTATTTTTAGGGTAATTATGTTTTAGT
TGAGTTTAGATGACGCAAAGTATTTGATGAATTATTTTTTCTTGTCAAATTGTAAAATAC
AACTACATCTGCCTTGTCCTATTGAAAATGCCATATAGGTTTTTCATTTTGAATTAAACA
TAAAACACCAGCGAGTGAATTTCAGGAAATGTAAAGCATCTGCATCGTCGTCTGCCCCGA
CTGTTGATTGAAAGCAGATTGACTCTGAAATCACTAAGTAACAATAGTTTTAATGTAATT
TATTCATTCATCTGTTGATCTTGATACCGACGGTCTACATCTGCCCCTGGGGGTGTGAGC
AGCTGCTCCATCAGTACAATGAGTGCAATAAAAGTTGCCCCTCGCTCAATCTATAGATTA
GATATAGTTAAATAATGAAAAATCTGCCGCGTGTCAGCTCAGCTTCTTTTCATTAACCTT
TTTATATATGTGTGTGCTTCAATTGTAAGACTGCAGAGGTTTTTTTGTTTTTCACACACA
TCACTTTGTTTCTCTGTATGGCTATATAATATATATGTTATAATTGTTATAAAGGGTTTA
CTTCAAGCAGTTGTCTTCCTCTAAATCAGTGTTTCAGACTGCTGCCATGCACGTTTGACT
TTTTTTTTCTTTATAAAACACACCTGATCCACCTCTGACCTAAACATGGTGGGACTGGAG
AAAAGGGGTTCAGAAACACGGCACTAAAATAAAAGCTAAGCCCCTTTTCTTACACTTCTG
TTTTTGTAGACGAGTTTGATGCCTACATCATCGTGTCTTTCGTCAACGCCACTTTGGTTT
TGTCCATCGGAGAGACCGTGGAGGAAGTGACAGATTCAGGGTTTCTGGGAACAACACCCA
CTCTCTCCTGCTCTTTGCTGGGAGAAGATGCCCTGGTTCAGGTGGGTCAAAAGTCACCTG
TAGGCCATTCTTCACAGAAATGTTTTGGTCTAGCATTTAATTTTTATTTTTTTTTGGTAG
TCTACCTTGTGTGCCTCTTTTGCTAAATGTATTTTCTCTTTTTTACCGTTTTGGGGACAG
GTGTACCCAGATGGCATTCGCCACATCAGAGCAGACAAGCGAGTGAACGAGTGGAAAACT
CCTGGTAAAAAAACCATTGTCCGCTGCGCCGTCAACCAGAGGCAGGTGGTTATCGCCCTG
ACAGGAGGGGAGCTAGTCTACTTCGAGATGGACCCGGTAAGGCTTTTATTAGTGCTCCCT
AAGTGCAACATCGAAAGGACAAGTTACCTGCAACATATCAATACTTTGCAGCAACTCTGT
GGAATTGGTCAATAGACTTGATCCAAATGACTCGAGCAATGACCAATAGGCCGGATTTAT
ACAAGTTTGAATGTGGTGTGGACGCGGGCAGCCAACGCTGATCCGTTTTTTGAAACATAC
GGTCTGCTGTGTTCAAAAATAAAAACCTAAATAAAATGAGTTTATGGTTGTAATTTCACC
GTAACTCTGTAAATGAAATGATCAGATGGGTCATTTTGTCTATCAAAAAAAAAAAAATTT
TTTTTTATGTCCTAAATACGAATCGGTTTTATAAGATGTGTTTTTATTTTACATTAGATC
AGCTCTGTGTTGGATAGATTTATCCTCTTTGAATGAACATTATAGGTGGATTTTGGCATC
ATCTCAGGTTAACTGGCACTAGAGCATTAGAGGGGACTGTTTACCGCCACTGTTCTAGAT
TACATTCCAGTAGATCATCTTTGGGTTCTTGTAGTTTTTTTTGGGATCAATCCAAGAGGA
ATCAGAACTGTGCGGTTGCTGTTTGCAGGAAGCATTAGAACACTTCTAAAAGTTCTACTA
GATGGAACAGTGTTTTGTGATATCAGTGCTTCATAAAGAGGACAATTGTGTATGTGTTCC
TCTCATACTTGTGTCTTCTGTAGTCTGGCCAGCTGAACGAGTACACGGAGCGGAAGGAGA
TGTCTGCAGACGTGGTTTGCATGAGCCTGGCAAACGTCCCGCCGGGTGAGCAGCGCTCCC
GCTTCCTGGCTGTCGGACTGGTCGACAACACCGTTCGAATCATCTCCTTGGACCCTTCGG
TACAAATGCAAATCTGAATGGCAGTTTATCTTGACAACTGCTGTGTAGGTGGGGTTCTGT
AAAGGGAAAAATGTTTTTTATTGGTAACCTGAGGTATGGATGTAGACTTGGCCATTCACA
CTACAGAGAGAAGGAAAGCTATTAATCATTCTCTTCTGCTGCCAAACACCTGTAAAAAGT
GCTCCTAACATCAGGAACCGGTTTGAATGTGTAATTTTTTTTCCTTTTGTTGGGATGTTC
ACTGAATCCTTTTCAAACACTTTCCAGTGTGAGCTGGTGTTGGTGCGTTTTATAAAATTG
CTACACCCTTTTCTGTGTGGAGGCTGCTCAGATCTCTGACTGACTTCCAGGAACATCAGA
ACCCAGACACTCAAATGGAAAATACTTCAGAGTGAATCTGCAGAGTTTTATTGGACTTTA
ATCACAACTGCAGAATGTAGAAGAGTTTCTTTTTTCACGTTGATCCAAAGAAGTGGTGAC
AAGGATCAGACAAGCTTCTTTATGCTTCACGTAATGCCTTTCTGGATATCTGGAGATCAG
GAATTCCCAGGTTGTGACATTTAACATCTGGATAAAGGTGAAATGACTCAAATCAATCTA
CTTTTAATCACATGTCAATAGTTAAATTTCAAATTGTTTACACATTTAAAGCTGTCTATT
AATATAATTGCAAAAGCTTCTTAAGTGATAATTTCCATAATTAGACAAAAATAGTTGAAA
ACACTATTTTCTACACAGCACATTTGTTTATTGTTAGAGTTCAGCAATCTGAACAAAAAA
AGTATTGGTTTAGCTCTGGTTTCAATGAATTGAAGGCAACTTGACAGTAAAATGAACACA
ATCCAGTGTCAAAACTTCCAAATGGAAAGATTAAACGTCTCAAAACAACAAACCAGAACT
TTGACCATTTAAAGTCCACTTATTAATAAGCTTAAATGATTTCTTTGTTTAAACCCGCAT
TAAAGGAAAAAAAAGTTCTCGTACTGCACTTTAAAAAATAAAACAAAATATCCGATCTTT
AAAATAGGGCGCAGTTTGTCGTTAAGCCCTTCCCAGTTGCCAGAGAGTAACCTACCATGT
GGCGACACTCATATTTATGGTTTAAGTTGGTTTATTACTAAAGTGGAGCAGGTCTGTCTG
TCCTGAGAAACATCAAGTTACAATTAGTAAAAGAGGTGCCTTTGAAAGGGTTTTTAGTGG
CTGCATTACATTAATCTGGGGGGGAAAAGTTATTTTGTACTTAACATGTTTATCATTTTA
AAGTCAGACTTTATAATGCTTGTACGTGCAGAGATTTGTTTAAAGCCTTTCCATTTTTAT
CCCCTCTAGGATTGTCTTCAGCCGTTGAGTATGCAGGCCCTCCCTGCTCAGCCAGAGAGT
CTGTGCATCGTGGAGATGGGAGGTGTGGAGAAACAGGACGAACTTGGAGAAAAAGGCACT
ATGGGCTTCCTCTACCTCAACATCGGGCTGCAGGTGTTTTAAAAAACTGTTTGTGGCAAA
TTATTGACGTCTTTTCTGTACAATTTTATTATAGGATGCAAAAGAAGACCACATTGGGTT
TTTTTTTTTTTCTTGTTAGTTTTTCAGAGCTGTTCCCTCCTCTGGACTTTAATTCATAAT
TATTCAGGCACTATTATTAAGAGCATTTCTATCAATGTAGTTTAGACATGTATTTGTTTT
TCCTATCTATCAGAACGGTGTGCTGCTGCGGACCGTCTTAGACCCTGTGACTGGAGACCT
GTCCGACACCAGAACCCGGTACCTCGGATCCCGACCCGTCAAGCTCTTCAGAGTCAGGAT
GCAGGGACAGGAAGCCGTATGTGAAACAAATAATGTCTTGTTTATTGGTCCATAGACAGA
ATTTTCAATTACAGTAAAACATTTAATTTAAGTTTTTTTTAAATAAAATTTATTATGAAA
AAATGTGAGAATGCAGCTGATCATTTCTCCTTTTCCTCTATAAGTTGTTGTGTGTTCACT
GCAGCTATGAATTTTCTTTGCTTTTAGGTGCTGGCCATGTCCAGCCGCTCCTGGCTCAGC
TATTCATACCAGTCCCGCTTCCATCTGACCCCCCTGTCCTATGAGACGCTGGAGTACGCC
TCTGGCTTTGCTTCTGAACAATGCCCAGAAGGCATTGTGGCCATCTCCACCAACACACTG
AGGTACGGCTGCACGAAATACATGCAGCATTGTAACCAGGCTGGGAGACTTTAGAGCAGA
AGTCATGGACAGGCGGACCAGGTCCAGACCCTGTCCCATATGAACCCCCAACAAACATCT
TAATCAGAATAAGTATAAGCGCACTGTGATGCTGCTGTTTTAACTCATGCAGCTTCTGCA
GACTTTACAATAGTGGTTTAGCGGAAATACTCAGACCGTGTACATGTGACTGTGTGCTAA
CAGGCTGTAAAGTTTAAGTAGCCAAAAAGATCAAGAAGATTGTGAAAAATCTTTAGAAAC
AAAGGGGGAAACCAGGGAACGAAGAGAAGCTTAACTCTGTTCAGACTTCACTCTGGGAGA
GACCCCAACCAACCTGTCTCACATCAGAAACATCCCCGCTTCTTAAAAAGACCAATGTTA
TGTCCTAGAAAACGACAGTTTAAAAAAAAAAATGTTTTGACTAAAAACTGCAAAATCATA
TCTAAAAGACCACTGGGAAGTCTTTGAAAGTAGATCAAAAGATTTAATCGGAGTGGATCT
GATGGAACATTCATTTGGTGTGACAGTCGGGTAACAGTAAATGTAATTAAAAAAAAGTGT
CTCAAACTTAATGTCATCTAATTACACTTTAACCATAGACATTTGAATTTTCCAGATGCT
TTCTTTTGGAGCTTTTCTTTCATAAAACCTTTTAAGTTTTATTTAAATACCCCTGCGTCA
ACGTTTAGGCAAAGAGAAGAGTTTATAGGTGAACCTCCTAAGTAAACTCAGTGTTTGGTC
TCTCCTGTCAGAATCTTGGCTCTGGAGAAACTGGGAGCTGTCTTCAACCAGGTGGCCTTT
CCTCTGCAGTACACTCCCAGAAAGTTTGTGATTCACCCGGAAACGAACAACCTCGTTTTG
ATCGAGACGGACCACAACGCCTACACCGAAGCCACCAAAGCTCAGAGGAAGCAGCAAATG
GCAGAGGTATAAAACACATTTTTAGGATTTTTAAAGGTAAATGACACATTTACAGCAGCT
TATGGCTTCAGAGGATTTTTCATGTTTTTTTTTNNNNNNNNNNTTTTTTTTTTAATATGT
TAAACTTGTCTGTCGGTTAAGTTGGTGTCTAAAACTGGAAAAAATGATATTGTTGAAATA
TCTTCTGAATTTGTGTAAAACATTTTTACATTTGGAAACAATTTTTAAAATGAAACAGCA
AAGCGGTTACTGACTAAATGGGCAGCAGTTCTCAAACTCTCTGTGCTCTGACAGTTCAGG
CAAAACATTTCATCAATGACTTAACAGGAGGTCAAAGGAAGGGTTTGATCTTTATGCAGT
GAAGATCAAGTTCCAATAGAACAAAATGTTTTTTGTTTGTGGACAAGGTGAAGGAGCTGA
AATTGACTTACCGGTACATTAAATTGCAGCTGTCGACATCAACTTGTTTTCATCAACCTG
TAGGCTATTTGAGGGTAGTTTCAAAAATTTTCCAAAGACATAAGATGTTGTCATAACTAT
GACGACTTCACTTCACCACTTTTACACAATCGGGGATTTTTTCATTCTGTAGCTGTTTAT
ATGCTTTATTAAAAAATGTTTTTTTTTAAACAGGAAAACACTCAGATTTTATCCTATATA
ACTTTTCTAAATCCCATCTTTTTACTTGATGTTTTATTTGCCATAAAGCAAAAGGTTTAA
GTAGATTCAGGTTTCTGTCTCCATTCTCAGAGCAGCAAAGATCTTATAGTAATAGAAGCT
GAAGCTGATCTTTCAGAGTTCAAATTAGTTGAAAGTCTTCTCCCACCAGACTTAAGACTT
AAAAAAACTGTCAACATCATACATCTTTCAGCTGAATCCCTTTAATGATCTGTAAAAATA
CTAACAGAATTCCTTTGATTTTTTTTTTTTTTTTTTTGGCCCCCCGGGGGAAATTGGCTC
CCCCGGGCCCCTTTNNNNNNNNNNTTTTTTTTTGTTCCTCTGCTGAGATTTGCTTCCTCT
GGTCTCTTTTACTCAAAACAAAATTCTAGGAATGAAATTACAAGACCATAAAAAGAAAAA
AAACTCACCACTTCCACCGAACATGCAAAAAATTACAAAAGAGGAAAAAAAAAGTTTCAT
TTCTAAAGTTTTATTTCTTCAGTTTTTGTTTTCCTCCTTCCTGTCATTTGTTCACACAGC
CAGCATTTCTTTTACATTTATGAACTTTTATGTATGTAAAACATGTTTTTCATTTAGAGT
TCACATTTTGCAAAAACAAATGTCTGTCAGAATTGGAGAAATCAACAGCTGTTTGTGTGG
TGCCCCCTGCAGGAGATGGTGGAAGCTGCAGGTGAGGACGAGCGGGAGCTGGCAGCTGAG
ATGGCTGCAGCATTCCTCAACGAGAACCTCCCAGAGTCCATCTTCGGAGCTCCTAAAGCC
GGAGCCGGGCAGTGGGCCTCTCTGGTGCGGCTGGTTAACCCCATCCAGGGTACCACTCTG
GACCAGGTTCAGCTGGAGCAGAACGAGGCCGCTTTCAGGTAAGTGCGGGGGAATTTAAGA
TGAAGTGCAGGGAATTTAAGCTTTGGCTCAAGTTCCTGAAGACCGTTCGACGTTGTTGTG
TTGGTTAGGAAAAAATGTACCTGCAAATGTTAAATGCAGCTTTTCTGAGCTTTTAATGAA
GTACTCGTGGCTCATAACATTAAAGTTGTGAAGTACAATGAAGTTCAGTTGTAAAAACTT
TGCTGCTTTGTATTTCAGCAGTTTATGGGGTTGTTTCAACAAACATTAGACATGTAAAAA
TGGCTTTTCTTAACCTTTTGTGGAATCATGATGCAGTCAGCTCCTCTTTACTCCTTTTGT
CTTTTTCTTCTCTGCGTTTCTGAAAGACATGGGCTGTGTCAGAATTCCCGCCCTAATCCC
CACCCCAACTACTAAAAACGATGTAGTGCGAGACTATGTAGTGCAATTCAGACACCATTC
TCACTACTTTACTATATTTGCCGATTTAGTGAGCATCGATGTACACAGGTTTTTTGCAGA
GACTTCTGGAAAATTTCTAGATTTCTAGATTTTGGAATTATAGATTCAGACAGCAATACA
AAATGAACGCACTATATAGTGCACTATGTAGTGAGTAGTGAACGAATTCAGACACAACCA
TAGACTCAGATGTTTAGTTTCCTTATATTTAAAATATATTTATTTAAAATACAAGCAGCA
TTTTTACTGCAAAACAAAAATTGATTAAAAAACTAAAAAAATTCACTTTTTTACATATGT
AAAAAAAAAAAGCCTCCTTGGTGCACATTTTTTTGTTCCTACGGATGTGGTCACATGACC
AACGGCTTGTATTTATTTCCTTTATATTATCAACAATAAATATAAATGTTGATTCTCTGT
GACAGCTCTACATGCTCTCATGTATCTTTCCCTTTGTTTCAGTGTGGCAGTGTGCCGCTT
CTTAAACACAGGAGACGACTGGTATGTTCTAGTGGGAGTTGCCAGAGACATGATACTCAA
CCCCAGGTCCGTGTCTGGAGGTTTCATCTACACCTACCGACTCACAGGTGGAGGAGAGAA
GCTGGAGTTTGTGCACAAGGTGAGGTTGAGTTTCTCTGCTCTGCTGAGTTGAAAGTTTCC
CCGTGTGTTGAGACCACAGCTGAGCATCCCATGTTCACCGCTCTGTTGGCGTCACACTTT
TAAAACTCGACAGCTTTGTAACAACACCATGGCAGGATGTTTCTGCCCCAGTTTCTGGGG
CGATTCCCAAGAAACAGGAGCAGGGTGGAGACGAGCCAAGTGAATCAGCTTTCAGCTGTT
TGTTACCTGATGTAGAAGAAGAGGCAGTCTGTTTCCCAGCGGTCTCGGACACTCCACACT
GACTCAGAGGGATTTCCCCACCACTTAACCACACGTGATGTTTTTAGGTGATTCTGTCTG
GGCACAACACTAACGTCTTAAGCACGCGCTCACATTCAGCTTCAGACACTTTTAATATGA
AACAAAAGTCTTCCTCATCCGCTCGTTTTGTATTTTGGGATATCTAAAAAAATGTTGACA
TAATTTGTCTCAAATATTTGTTTTTTTAAGTATCTTAGACTTTTATGGACAGTATGCTTT
TATGACATGTTGTGCAGCAGTTTTAGTCAAGTCTGAGTGATGTTTGTGATGCATGAACCG
CAACGGCAGCTAAAGAAAAACTGTCATCGTGGGTAAACTCTTCATCCTGTCTGCCTTGTC
TACATACAGTCCTTTCCTGATTAACTTTGGGATTAGCTTTACATGATTAACACGACCCAC
AAAGACAACCAAACATCTATCTGTAAAGCTGCTCCTTTCTCTATGTTCATTGTATTTATA
AAAAAGCCTAGATCCATTTATTTTGTGTGTTGAATTTGTTTTATTTATTTTTTTAGTTTG
TTGCTCTGAAGAGAAATTTGAGATATTTCCAAGTTTGTTTCTTTTTTTTAAGATGAGCTA
TTTGTAATCAATAACTGTAACTGGCACGGTCACTCATGGAGTTGTTTAGAATTGATCACA
TAAATCAAAACTGCAGGAATGTCCATAATCACAAATCAAACCCAGCAGATGAGTAAATCA
GCGTTCTTTCAATGAATTTGTGTAACCCTCAAAAGAAAAGGAGGTAGTTTTTATAGAAAG
TAAAATGTATCTCATAAATGAAGCACTTTCCTTTTTTAGCTTCTGTCTTGAACACAAATG
CCAAAATTCTAATTCTTTTTGAAAAGCGACAAAATTCAAGCTTTTTCCTGCAAATTTTAG
TTGAACACAGGACGATGATTCGCATCATAATGTGTTTGATAAGGACACACATTTTCTGCC
TCTTTTGAAATTTTCAAACATGCCAGATCAAACTTTACAACCATGTTGTGATGGTCTGAA
ACAGGCCTTCTCAATAAATCACAAATTCATCGTTATCGCAATATCAAGCTGTGCAATGCG
CATTTTACTAAAGACGACAGAAATTGCAATAAACGGTAACCTTAAATTTGCTAAAACAAT
CTTATGGCAGCTTGAAGTATTTAACGAATCAAATAAATCCCTTCATGCATTTGACCAATC
AGATGCCTTCACGTTGTTGACCAATCAGGTGGAGCTCTTTGATGTAAGATATAATTAAAG
TTATGTTGACTTTTATTTAAATTAAACTTGCTGTGAAATGAAAATGATTTTCAATTTGTT
CATGTATCTCAAGTTATGTCATTGCAATACTGAACACTAGTGTCTCAAATCCAGAGTTTT
CCTTAAATCGTGAAGCCCTAGTCTGAAATCTAAATTGTGTATCGTTTGCTGATTTGTGTC
TCGCCATGGGTCAGTTGTGTTAACAGCTGCTGCTTCACAAAAAATTACTCAATTTTCAAC
CGTCTAGTTATATAAAACTAGACAGTTTCCTGGGTTGTCTTCACCCTGAATGCCATTTTC
TGTTTGTTGTACCACAGCTGAAGAACTGTATCTTCTCTGCATTGTTCATAACAGACTCCA
GTAGAGGACGTTCCTCTGGCCATCGCTCCGTTCCAAGGACGGGTTCTAATCGGAGTTGGA
AAACTTCTTAGAATTTATGACCTGGGGAAGAAGAAACTTCTTCGTAAATGTGAGAACAAG
GTAAGAGCAGGTCTTGAGTCATTTGATTGAAGAGTTTATCACTGAGACCCCTTTGTAGAC
CCACTCCAGTCATCTTTATATTTTCAAAGCATTCCCAGTGCTCTTTTAATTATGATGATG
TCGTTTTAAGGCAAAAATACCTGTTTTTTTCTGGGACATAGTTTCTGCAGAACAGCAGGA
GTTCATTAGAAACTAGCAACTGAGTTGTGGGCAAGGGTTATTGGCGCGGAGCAACCCCGC
CCCCTTTCCCCTCCCTGCTGCTGAGAGCATGAAGCAGGGAGCTTGTTGCCTGCCTTGTAT
ATTTTTTACAACATAAATCAGCTCTTTTTCAAACTGCATTTTCTTTTAACTGTTCCTGAT
TCACAACAATTTGAATAACAAAACACTCAAATAAAAAACTAAGCTTGTCTTTCTTTAAAT
ATGTCCATCTGAGCATAAATACTCAGAGCAGCACAGGTTGATTTAGGTTTGATTTGGAAT
GATTTCAGGCTTTGTTAGCAGCTGCAGTTTTACGGTTTCTATTTAAAGGTATCAGATCTG
TGTGATTGTCTTATAGTATTGGTTTAGTTCTATTTTTAATGGTACTGACGGTAATACCGT
TGTTTCTTAACAAAAGGGTATGTCTTCCCATTTTCTAAAAGGAGCGTCTCGGCTGGCTTC
ATTGTCATCAATGCTTTTGTAAAACTTGTCACTTCGAGTCACTTCACTTTCCTTTTACAT
CTGTGGAACAAACTGTGGGATGTCACTCTTAAGTTTCTCTTATGTAAACATCTTCTTCTT
ATTATCATGGCATTACTGTGGTGGAAATAAGCTGCTCTTTATGGAGAAGCTTGTAAGCTG
CTTTTGCTGCCTGGTGAACAGTTTGTGTGGAAAGGCTTTGCAGATGTTGTTTGAGGTGGG
AATTGCACTTGACATGTTTGTGGGGCTGTACTCACAACAGTGGGCTAATCAAAGCAACAT
GCGTCTTGTTTCAGTTAGGATGCAAAAGCAACTGGAAAACATAGGAAGGCCTGGCTGTTG
GGATGCCTCACATATTTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCCCAACAACCCGACATGGTAATGGGACTTAATATGTA
GCGGTATCCTTTTTTTTTTTTTTAAATGTGTAACTGAAAACTTTGGAATTAGTGTTGTTA
CTGTGACGTTTGTTTTAGCAGTACCAGGCTGTTTTTCTTACGAAAAAGGTTGTGGGTTAC
AGGTATCGTGAATATACGGTTTCAACCAATGCTTCTAACGCGTCTAATGTTTAGCGTGTT
ACAAACAAGTTTTTTGGGTTACTGTAAACACAGTTAAGTCCGACTGACGGATTTATCTGT
CTCATTTAATGCGTTTAGTTTTGTGTAACATAATTTTGAAAGTAGTTAATTCATTAATGA
TGTGCCTTATAATCCGGTGCGCCCTGTGGTGTGGAAAATATGGTACAGCCTGTTATGAAT
AAAAACAAAAAAAAAACAAATATACTTTGTTTTGAATCTGGGTTTTTTTGGTTTGAGGAA
ATGAGGCAAATAATTCATTTAAGCATATGTATTTTGATCACAGGTGCGTCTTCCTCCCAA
CACCAGTGATGACGTGGATGAAGATCCTACAGGAAACAAAGCTTTGTGGGACAGAGGGCT
CCTTAATGGAGCATCACAGAAGGTAAAACAGCCAATCGCTAGTTTGTTCTTGTCTAGAGG
CATTTTTTCATTTGGCATTTCATTTTTTTTTAAGTAGCAGTATGAACTTACTCACCAGAC
AGTCAAATGAGTTTCTACTGGTTTGATGTAATGCCATTACAGTGGTCCTTCACCGTGTCA
CAGCTCATTTTTCACGGTCTCGCTGTTTCACGAGTGGCATGCTTTTATTTAGTTTTCTCT
TTTACAGTACATTTTGTTCTGCATCCTGCTGTACAGAATGCGTTCATCTTGCCACATGTA
CAGAGTTATTCAACGGCCGCCACCTCTTTGGTTTCATTCTATAAATCTGGACCTTTTTTC
CGGGAGGGTTTGAACTTTGAAAGTTTAAACTTTAAGGGGAAAGGGTATAAAGTTTTCAAA
ACGTCTTTAATTATACTATACTATATCATTATATTTAGATTTCACCCGTGGCAGATTATT
GTAGAACGTAAACCAAGCGATCAACGACGGAACACTGTATTTTGATGGTCTTACAGTTTC
GGCGGTCTAACGAAGCTTCGTGAAGTTGACAAAAGCTAAACATTCAAAATCATTTTGGGA
CTATAACAAATTTGAAAAAATAGGTGTTTTTTCCAATTAAATCTAGTCTTCTTCTTGTCA
TAGTGTTTGTGTGTCGCGGCGTATGTTGATAAATCATTGCTTAGAAATGTTCCATGTTTA
TTTATAGACGTGCCAACGATGTCTGTCGAACTCAATTATGTAGCGTAAATTAGTTTTTGG
ATTAGATTAGATGCATTCCCCCTAGATTTGATTAATATATCCTCAAATATCAGGTCAGGC
TCAAACCATCGTCAAAGTTGAAAGGATTGACTGTTTTTCCTCACATGTCATATTTTGTGT
AGATCATGTCATGCAGAGTTTATTAGTGTGAAGATGAAGGAAAATGTGCCGCCTGTAATG
GGAGGAAAACCCTTGTGAGAGAAGAGGAAAAGCTAACATTTGCAGCTGGACACACAATAA
CTGTTGCTGTTAATCACTCTTTTTTTTTTCTTTTTGCTTACAAACTGTCTGGCCTCCTAA
AAGAAACCAGCTCCCCTGGTATAAACACTGAGGAAGAGTATGACCTGCTGTCATGAGACA
ACAGTTGGGCCTCTGTTATTGTTGAATTCTTTGCTTTAATCTCCTAAATATAAAAAATGA
TTTTCCTGCAGGTCATTCATCTGCCAGCTTCAGGTCTTCACAAGTGTCATACCTTCAAAA
TAGGCGACCCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAACAACCCNNNNNNNNNNCACA
CACACAGACCACAGCCCCATTCCAAACATTTTAAGCTACTGCTGTTAGATCTAGTGCTAG
TGTAGCCTGCAGCTGATTGTTTCTAAAAATTGGTGTTCATTTAACTTTTTTTTTTAACAT
TAAAGTAAAAATGTAAAGCCTGCAGTCTTTAGTTTAAAAAAGAACAAAGAGGAGAGCCAT
GTGGGGAGTAACTGCAGTTAGAGTTACCTAAGCAACCAGAGACCAAAAAATTCCTGTAAG
CAAAAAAATAAATAGAAGTCATTTATATGATTCCATTTTCTATAATTTCAGGACTTATTT
ACAAATCTGACACCAAACTAACTGGTACAGATCTTTTGAAACTATTAATTGAGAATAAAT
TAGACCTCAAAGGTGATGCAGAAACTCCATGTTTTATTTGTAGCAGCAAAAAAGAAATCT
TTTCCACCATTTGAAAACTAAATGACAGCGTAACTTTTTACTTCAGTGACAGAATGACTA
CATTTTTTTGGAGCTTTTTTCACCTCAGTGTCACTTGCTGCAAGCCCCCGGAAATTCCAA
ATTCACGTGTATCATCAACTCGTCGTTGTTCTATACAGTTTTATCGTCTTTAGCAGTCGG
CAAGGAAGCCAATGGGCCGGCGTGCTCGCCATCTCCACTCCCTCCTCCCCGCAGCACCTC
ATTCGGATGCAAATGTCTCATACAAGCTTCTTGAGTTGTCTGTGAAGGATCAGGGGAGGC
ATGTGACCAAAGAAAAAAAAATGAATACATGAAACCGCGAATATTGAAATGTGGTTGAAC
ACTGTACCCCAATGAATGGATATACTGCAATAAATTGATGATGGGCATTAGTTTTGGGTA
GAAGAACCAACAATAAACCAGAAAGAGACCTTTGCCAATGAGTCTTTGTTGGGTCAAACG
ATTTTATAAAACCATTTAATCTAAAGGGCCACAAAAGAAAACTTGTATCTTTGCATCCTT
CAATGACAATATGTCCACAGTCCTTTCCGCATGCCTTTAATGTGGCCCGTGGCTACTTTC
CAAGAAAGATTTATGGCTCAACAGCCATGTGGACGCCAGAAGATGGCAGCAACAGTGCGG
CCGTGCTCCTAATACCGGATCCCACCGAAAACCGTCTTAGCGTGCCTGTAATATCGTTGA
AATGCTGTGAGCAAAGTGGGGATCGTGAAGTCGTGCAGGTTGGCGACCCAACATAGGTTC
ACACAGCTAACGTTTTTCTTTGACACTCGTGTTCGGCTGTTGTCAGTTCAAGTTTTTAGA
GACATTTATGACTTTTAATCCATTGCAGTCATATTTTTCTACTAACCAGCATACTTTCAT
GTGTCATTTGACTGGAACCCGTGTGCAGCTTTGCCATTATATTCTGTTTTATCATGGCAC
CATGATGCTGACAATCTGTTTGGTCTTTCAAGTCTAGACCTCAGGGTGAAATCAAAAAAG
GAGAAAAAACATCCAAATTAGAAGAATCTTTAATAGATCCTGAAATATTTCATCATGAAT
ACCTGCGTTTTTTAGAAGCTGTTGGTCATTATGTCATCGTAGATGCTAAACGATATATTC
TGGTTTGACAAAAATGTAGCTTTTATTAAAAGCTCCTCGTATGGAGGTGAAAGTTTTGAA
CCATATCAAAACTAAAGGAGAAGATGAGTGCTTTCTTGCACATTTTCACTTTGATTTCAA
AAATATTTCTATAAATTTAAACTTTTAGCTTGGGGGAGTTTGGTGCTGATCACGCAAACG
CTGAGCTTTTTCGCGTGATGTTTGCTTTGCACACAGAGCTGCTGTTGTTTCCTGTCAGAC
GGTTGCGGAGTCCTCTGCAAGCACGGCTCTCCTCTGTCTGCTTTAAAAGTTTGTCTCATG
GTGTCATGCATGTCCCTTCATTAGGACTGATCATCCTAACGCTGGCCGTGTGTCTCAGCC
ACATCCCAATATTAATGTGGCATGATTGGCATCAGAGTTTTTGGAATTAAAGCATCCAGA
GCAGCGAGCTCCAAGTAGGGGAATGTCTCCTCCCTGACCCTGACTGAGTTATCACTGTTG
ATTTGCACAAACCAGAACACTCCAATTTTTATTGGGCTTAAGACCTCAAGTGACTTTGAG
ACATATCTGACGAGTTGTGATGTGATTCATTTTTTTATGTCCTAACCAAATTTCTTGCAG
TTTTCCATTTGATTTCAGACGCAGACAGTTGTGACAACAAAAAACTGTACTTTTCATGCT
TTTTTATCCTGCGTCTCTTCAGGCTGAAGTAGTCGTGAACTATCATGTTGGAGAGACGGT
GTTATCTCTTCAGAAAACCACTCTGATCCCCGGAGGTTCAGAGTCGCTGGTCTACACCAC
ACTGTCTGGAGGCATTGGAATCCTGGTCCCCTTCACTTCACATGAGGTACAAATCCTTCC
CCCTGCACTGCACTTATTAGTTTTTACGCTAGTCGAGCTGGTCACAGCCCAACAAAACAG
TTTAATGGCGCTGTGGTAAATCTGTAAAATGTAAATCTGTTTTCTAACATTAGAACTCGA
CCCAGACCTAATTAATACTAACACAATAAGACAAATCACTGTAGTCTCCTATGTGGAGTT
TATGTTTTTCAAAGATGTTTGTTTTCCCAATAAAATCCTCCTCTTATTTTCTGCTCTGTT
TTTTTAAGCTTTGAAGCAACATCTTTTTGTTTTTATGCATTTAATATATTATTAGTATTG
TGTTAAATTGTCCTAACAAAAAAGTCTTTTTTAATTGGTGGTCTCTATATTTTGATAGAC
TCAGCCAACATAAAACCGATAGTTTATCCCTTCATCTTCTTCTCCACTGTTCCTTTAATT
TCATATCTTAAGCATGCTTTGTAATTACATTTTAAGAGCTTCTTTGAGATAGTTACACAT
TTAAATTATTTAGCTTTATTTACTGCGTTTTTGTATGTTTTTTCTTAAACCCCCCCCCCC
ATGTTGCATTTTTACCTTCTTAATTTTTATATATTTTTTAGATTCCTTACCATTATTTAC
CTATCTTAGAGAGCTTCCACTAACTTCAGCTAATAACATAAACTGTTTACCAGCTCAGTG
GCCTTGTGGTTAACCACCAAATGGTTCCTGAGCGCGGCTGTGTCTGCATTTCACCGAAGA
ACAAATTCTGCACACCTAGGTGTGTGACAGAAAGTGGGACTTTGATTTTAACTTTTAAGC
TTTTCTTTTGAGCTATTATTCAACAATTTCTAACTTTGTTAAATCAATCTAGCATTTAGC
ATGTGATTTAGTCTTTTAGCACTATTTTATGTAGCAAAAATGCAAACGTAAAGCAGCTTT
TATCATTTTAAACTCATTTTTCACCTTTATTGCTGCCTTTCTCTACCTTCAGTCCATATA
GTATGTTCCACATGGATTCACCTTTCTTAGCAAAGAAAGAATACATTTGTGGTTTTTGTT
TTTTAAAGCAAATTCGTCATGCAGCTATTTTCATGAAATAATTCTGAAATTGTCTTTTCA
GGACCATGACTTTTTCCAGCATTTAGAGATGCACATGCGCTCTGAGTTCCCCCCCATCTG
TGGCAGAGACCATCTCAGCTTCAGGTCCTACTACTTCCCAGTGAAGGTTGGTGTTTCATT
TATCAGGGATGGCAGACTGTAGATGATTACCGTCTAATGGCCTGCTTGTGGGGTAAAAGT
TCCTTTACCTTCATGGAAATTCAGGTTGCTTTCAGTGGGAAGAATGCAGTGTGACGTGAG
AAGGCTCCAGGAGTCATTCATTAAAAGCTATTTGTCACATTCAGAGTAGAACCACAGTGA
GACTGAAAAATGACTACGTTCAGCAGCGGTTACAGGTTTGTTAGCTGGAAGTGCTTAGTC
ATGGGAATCTCTGGTTTGCTGCATTTGGTAAACAGATCTTCTGTGATGTGAAGCGAGGAC
ACAAAATGAACACATTATTTCAATGGGGAATGAAAGGTCCTACATTTACAAGTCAACAAA
TAATAGCTTTAAAAGGCTTTGAAAAAGTTTACATTTCATGGTAACGGGGCTTAAATATCA
TTATTATGAATAGGTTTATTGTTTACTGTTTGCAAAATGCCCAAATTAAAGTAATGTCAG
TCATCTTTGTTTCATCCGCTTCATCATCCCAATGTACGTTTACAACGGGTAACATCAGGA
AATAATTATCCTAAACTTTAAAGCAGAACAATAACAGACAGAATGTAGTATGGAAAGAGA
ATTTAAACTTTACACTTAGCTTTTAAAATGACTTGTACTTGGGTGCAAAATAAATATAAT
ATTTGTTTTGTTACATTAAAAAATGTTTTCAGAAGATTATATTCTCTGTAGATTTCATTA
TGGTCTGATATTTTTGTCATTTCTAGCATCAAAGCAATGTATCTAAGTAAAGATCCTCCG
TCCTCCGGAAGTCTGCCAGTTACGTTTTAAGGCTCACATTCTTCTTNNNNNNNNNNTTTT
TTTTTTTTATCATTTACTTCTGAAATGTTTTTTTTTCTTCTTCGTTTAGCAGACCTGTTT
ATCACAATGTTGTCTTTTGTGATGTCAGTAGCTTGTTACAGCAGTTACAGCAAAAATATT
ATAAAAAACCTGTAGCTTTTATTTACATTTAGACAAAAAAAAATATTGAAGGACTTTAAA
AAATCTTAGATTAACTTAATCTACAATACAACTTTACTTAAATAAATGATCCCCAAATAA
ATTGATTAAATATTGTAAGAACCGCACTACCAACTAGCCTGGAAGCAGCTCTGTGCCATC
ATGTTTGCACACGGCGTTTTTCATATAAAGAGGTTTTCTACTTCATTTCTATTTGGTTCA
TGGTAATGTTTTGACTTCTCATCTTTTTCCTGAGTTTATGGAGCTTTGTGGTGATGAAGA
TTCCTTATTTGGGTTCTTTCCTTCAGAACGTGATCGATGGGGACCTGTGCGAGCAGTTCA
ACAGCATGGACACACACAAGCAGAAGAGCGTTGCTGAGGAGCTGGACCGGACACCGCCAG
AAGTCTCCAAGAAGCTGGAGGACATTCGCACACGTTACGCTTTCTAAACACACCCACAAT
TTACATGAAGACTCACACAAACTCTGTTGTTCAGCAGTTTAGCCACCGTACTGACTCAGT
TTTATGGTAATGTTTGGTAAACACAACTTATTTCATGGAAATATCAGAGAAGAAGAAGGA
AAAAAAAAAAATTAATTTGCAGCCATTTTGCCCCCATATATGATGACATGATCCTCTTTC
TCTCACAAGTTTAAGAACCAAACATGTGAGAGGCTTTAGCCACAATCAAAGGAACACAAA
CGGCCCATGACCCAATTTCAGAGTTTCAGTTTGTCTGCTGTGTCAGCACAAACCACCAGC
TGCAGTTCAGCCAAAGTGACACAAAACATCACAGAGGTGTCCTTCAAATGGAGACTTCCT
TTGGCTGCAGGGGACATTTTGAAAATCATCCTCACACTGAGCAGCATTATCGAACTCAAC
AAAATGTATTGCAGACTGCTCAAGAATGCGTTTCGTTTAGCAATAGGGGTTCATGTTCTC
TCCCATGATCAGAGATATATTTTGTGCAGCACGAAAGCCTGAAGATGACTAAATATTTTC
TCTTTTTATCAGAGCAGAAATGGAGAAGTAGGCTTTTGTACGCTGACGATTTCGTCTGTA
GAGTTCTCGCTGACGTCTTTTTAAACATGTGCTCGGAGCGTTGCAGCAAACGGAGGCTGA
CCTTGAACCGAGTGCAGCCTCAGGCCACTCTTCAGCGAGCCTTCCACCAACCGTCATACA
ATTCTGGGTCAGCTCAGACTAAATAAGTGGGTGGAAAAGTCCTGAAGGGTTGCTTTGGGT
GGTGCTCTTGTCAGTACAGTAAATTCCCAACCTCAGCCACAGACACTGCATTCCACAGCA
ATCACTGGACTTGGGGGTTTGTGGGACAGAGACAGTGGTCTGTTTTTTTTGTAAATAAAG
TTGTTTTTGTACTTTATAATATCGTGTGGCTTTTTTCATTTTTCAGCAGAGGCTGTGTGT
TGAAACCATGAGTCCAGGGACAGAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1096, 1669..1808, 2813..2968, 3539..3709, 4892..5064, 5277..5418, 5846..5958, 6189..6326, 7474..7577, 7670..7835, 7927..8022, 25668..25740, 26589..26740, 26880..27035, 27743..27898, 29229..29372, 29593..29715, 29907..30061, 30851..31025, 32352..32557, 33462..33618, 35514..35639, 36407..36445, 36523..36613, 37001..37083, 37363..37461, 41002..41145, 42241..42345, 43646..43786
1739..1808, 2813..2968, 3539..3709, 4892..5064, 5277..5418, 5846..5958, 6189..6326, 7474..7577, 7670..7835, 7927..8022, 25668..25740, 26589..26740, 26880..27035, 27743..27898, 29229..29372, 29593..29715, 29907..30061, 30851..31025, 32352..32557, 33462..33618, 35514..35639, 36407..36445, 36523..36613, 37001..37083, 37363..37461, 41002..41145, 42241..42345, 43646..43783
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved