Oryzias_latipes Locus RPL4
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RPL4
Oryzias_latipes
RPL4
6
SNORD16, SNORD18, SNORD18
2795..2893, 4184..4255, 4448..4514
5900
CACTGCCTTTAATCCCTATCTGGAAGCATTGACAAATGTATGTCAACAAAGGATCATAA
AATGCAGACAAACTTAAGTTCACGCACACTTACAGAAGACGAGTTGTGCCTTTTTTTATG
CTCCTGTTTTAATTCTTCTAAGGTTATGAGAGACCGTTTGTCCACAGTTGAACCTAAGGA
TGAGTAAAACGTGTGAAACAGTTACAATAATATGATTTTATTGATTCAAGGATGAGTTAG
TTTGGGATAAATGGCCAAGAAATACATTTGCAGGTGATGGAGTAGAGTTTGATGGCAGTT
ATTTTAGTGTCGACGCAGACTGGTTCGGCCCCAAGCCAAGTTGTTCCAGCGGGGTCAGAC
ATGTCACAGCGCACCCAAAGAGGATGTAAGGCGGGATTCTTGTCAGCAATCGACATACCA
GGATTCAAAGATAATGTATACCAAGACAGCAACTGCCTTTAGAGACAGGAAAACAGTTGA
TTACAAACACAGCTTGGAAAATGGCCTTACGTTTTGTAAATATAAGCAAAATGTTGAACA
TTTTATCCCCACCTTGCTTTCATGATTGTGAGTGGCTGTGGCACCAGTTCTGTCTGCAGA
GCATCTGCATCTGCATCATCAGCACCATCATCATCAGCATCATCAACATCAATATCATCA
TCAGCAGCATCGTCATCGTCGTTATCATCACAGCTTGATGTCATTTGCTGATTCTCTGGT
TGACATTTTTTTGGGGTCTAAAGAAAGCAGACATTACAGCATTAAAGAGAACAGAAGTTA
AATATCAGCTGCATCAAAAATGCATACACTTAAAAATCAAAAACCCACATCAGTATATAA
CCAATCTATTGGGAAAAAAAGTCATCAATTGCTTCCCACTTCCTAATTATTTGACCCATC
CAAAAGTTCAGAATACTTACAGCTTTTTCACAAACAAAGATGGTCTGGTTGCCACAATAC
ATGTTCACTGCAGCAATTTTGTCCCCATTCATTTTTACAATATGGATGTCCTCCTGGAAT
TAATAAATATTATTTAAACAAACAACTTCATACTTTTATCAACCCAGAACAGAGACTTTA
CCGCTGCAAATACTTCAGCTAAAATTACCTCAAATGTGACTGAATCGTTGCTACTTTCAA
CCTGAAGCGACCTGAAATCGACATACATCTTTACAAATTATAATAGAAATTGGTCAAGCG
ACATGTAAAATAAATGATTTGTTTTCGTTCACGTCGACACTGTTTAAACAGCACTCACCG
AAGAATAGAGAAAAACTCCTTAGCGTTAAGTATCACCTTCGAACCCATCACGTAATTTCA
GTCGATCGCTCAAAATACAAAGAACCGCAAATAAGAACCCAAACTATAGCTAAAAATGTG
AGCCACTGTTGATGTTTTGACACTCCCGCGCTTCTCCACAGTGTGACGACATCAGGTCAT
AGGTCAAATTGTGATCAGCGATAATTTTGTTTTACAGAAATCCAACACATTTAAAGTTAA
ATTAAAACAACTTTTGAAAACAAATAATTTTAATAACACACAAAAAAGTCAATATTATTA
CCTTCAAAAGAGACATGGGAAAGTAGTTCGGGCTTTCTAGTTTCATGCGCCAACGTGGAG
TCGACATATAGTCCCAATTGAAAAAAGTGGGGTTTTTTTATTCTTAGGAAAAAATATGAT
CAATTTAACATATTTAATTGTCATATTTATTATCAATATAATTACTTCATATTCTATTTT
TCACTTTAGGTAAGGACAAAAAACTATGCACATAAGGTTTTAAACGGAAGTCGTCGCTCT
GGAAGCGGAGGGATAAATCTTCACAGAAAAGTCACCAACTTCCTTTTCACTGTGGCCGCC
ATAGCGAGTGGAGCGTGGTTCCCGGCGAGCCGAAAAATAACTATCAAAAATGGTGAGATT
TTACGAATAGAATCAGATCATGCTCATCTAGAGTACTGTAACTGTACTATGTTTCAAATA
GCTTCGCACAGCTGTCTCATTTTCTTTGTACAACTGCAAATGAAAACAAGATACTGCTAG
CTAGCGAAGGTTTCACGAGGAGCCATTTTGGCCTAACAGGCTAGTTTAGCCGAGTTACAC
GTGTGACTACTACTTCAGTCTCGATTGTTGCAGCGATTTGCTCAACATATACATGCTTTT
TTTTTGTTAAATTCTGAGTATATGATTAAAGATGCTTCAACTAAGGTCTTAAAATTTAGC
TAGCGTTTTAGAAATTTGTTATAAACGACAGGAAGACCCATTGGAAATCGCCTCAGCTCG
TAACACTTAACAATAAGTGCATTTGAAAATTCATTAAGGCCACTTGATCTTTTATGTTGT
CTCTGAAAGTTCCTTACCTGATGACTGTCATTTATTTCCTTTAGGCGTGTGCCCGACCTC
TCATCTCGGTGTACTCCGAGAAAGGAGAATCTGTCGGCAAAAACGTATTGATGCCGGCAG
TCTTTAAGGCCCCGATTCGCCCTGATGTTGTAAACTTTGTGCACACCAACATGCGCAAGA
ACAACCGTCAGCCATATGCTGTGAGCGAGCTGGCAGGTTAGTTATTCTTATTTTGAAAGG
TGACTGTGATGTGTATATAAATGTAAACTCAGGCGTATAATTGTGTATTCCAGGTCACCA
GACCAGTGCAGAGTCCTGGGGAACAGGAAGAGCTGTGGCCCGTATTCCACGTGTGCGAGG
TGGTGGTACTCACCGCTCTGGCCAGGGTGCTTTTGGAAATGTATCCATTTGATCCGGGTT
TTTTTTTAAACTAGTTTTAGGAAAGCGGTACTACTTGCTATGATGGTGTAATTTGCGTCT
GACTCTGTGACCAGTGACAGAATGCCTACCGTCTTATACTGGCGCAGATGGCTGGTGATC
ATTGAGTCTGAGCAGGTTAGAAGCGTTTCAGTGTTTCTTGCTGTGGCATCAGACCTCCTT
GACTTTCGTTAAGATGTGCCGTGGTGGTCGCATGTTTGCCCCGACTAAAACCTGGCGCCG
TTGGCACCGCAGGATCAACACACCCCAGAAGCGTTACGCCATCTGCTCTGCCCTGGCTGC
CTCTGCCATTCCTGCACTCGTGATGTCCAAAGGTAACCTGAAGAAATACCTTATCCAGGT
TAATACAGATAAACTAAATTCATTAATTTATTGAAACGTAACGGCTAACTAATGCAAATC
AAAATTTAAACCAATAAAAAGACAACTCTAACTGTATGGACTTTGTTTATGTAACATTTC
ATCAGGGCACCGCATTGAAGAAATCCCTGAAGTCCCATTGGTGGTTGAAGACAAAGTTGA
GGGCTACAAAAAGACTAAGGAGGCAGTGCTGCTGCTGAAGAAGCTTAAAGCCTGGAATGA
CATCAAGAAGGTGAAATGCTCTGCAATGCTCAACTAAACACATTTAGTTTAGCTATGGTT
AACAGGTTTTAAAGAATGATCAGATTGTATGCAACATGGTTTAATTAATTAAAAAAATAG
TATATTTATTTTTACATCAATGGGTGGATCCTTGCTGATCTTGCTGAAACGAAGCGTTTA
AATTCAAAGCACACAGTATTCTATCATTGTGTTGTTGGGCAGTGGTCTAACTTGCGTTGT
GTTGTCAGGTATACGCCTCCCAGCGCATGCGTGCGGGCAAGGGTAAGATGAGGAATCGTA
GACGTATCCAGCGCAAAGGGCCGTGCATAATCTACAACCAAGATGCTGGTTTGACTAAAG
CCTTCAGGAATATTCCAGGTCTTCTGTATGATTGCATTTACCATCTGTTGTTGTCTAATT
CATCTTTTTGTTGGAAACTATTATTAACCTGCAGCCTTTGTGTAACAAATGAAAATGATT
GCTATGGTTACTAGACACATTTTGCATTCATAACTTTTGCTCCAGAATAAATCTGTTTAT
GAACATTATGATGTGGAAATCAGCACTGGCTAAAATAACTTTACTAAACCAACAACTGTT
TTTCTGTCTCATTTAGGCATCACTTTGCAGAACGTGAACAAACTGAACCTCCTGAGACTT
GCTCCCGGTGGTCACGTTGGGCGCTTCTGCATCTGGACAGAAAGCGCTTTCCGCAAGTTG
GATGACCTGTACGGCACCTGGCGTAAGCCTGCCACCCTGAAGGTTGACTACAAGTATGTC
TCAGCACTGTCCATCAGTTACTACCGTACATACGTTGCTCATGCATGTCATGATGAGCTT
CTTACTTCATGGTCCGTGTTTTTGATCTTTGTGATATTTAACGAAGTTCTGAGCTGAAGC
AACACTGTCACGTAAAGTTGGTTTAGTTGGTTTTTCTGTGGACTTAAGCTGATCTTTTGT
TCCAGCCTTCCAATGCATAAGATGACTAACACAGACCTAAGCAGGATTCTGAAGAGCGAG
GAGATCCAGAAGGCACTTCGTGCCCCCAAGTACGTAACCTTACCTTTACCCTCCAACCTT
TAACTAGCGAGCTGTGATGATTTCCACTTCTGGTCCGTGTTTCTGAACTCTGATTATCAT
GGAAGTTCTGAGTTATGCACAAATGTATTTGCACTTAATGCAGAAAGCAGGAATTCATAT
TAACAGTAGGATTTGTTACAACAGCAAAAAGATCAACCGCAGAGTAATGAAGAAGAATCC
TCTGAAGAACCTGAAGATTATGTTCAAGCTGAACCCGTATGCCAAGACAGTAAGACGTCA
TGCCATCCTGAAGCACGACCCGACTGTAAGTCCAACTTTACGCAGCAACATCCCAAGATG
AGTGTAGCGACTGTTTTTGCTAACGAAGTGTTAAATGTTTTCATAGATCAAGGCCAAGAT
GCTGAAGCCCAAGAAAAGATCTGCAAAGAAGAAGGGAGCTGAAAAGCCCAAGGCATGAAC
ATACAGACTAGAGTTCATTCAATAAACCAGTTTCAAATGGAGTCTGCTGTTGTTCAAATA
TTTATTTTCCAGGTTTAAAAATATGACATAAGCTCAGGGATTGTTAAGCATAGAGCACAG
AACAGTAACCAGCACAAAGATTTAGCAGCTTTTTTCATAGTTTAATTACTAGAAAAAATC
TTTTAGCACAATGCTTCACTTGGCATTTTACTTTATACACATCGGGTTTAGAAATGGCTG
CACATCCTTAAGTGCATTCTTGGTGTAAGCTGATTTCAAAAATACAAATTCTTTAGTCAA
CATCTTAAATGGTGGTGGTGTGGGTGGGTGTCAGAGGCTGGCTGAGTCCTATGGTGCTAC
ACAACCAGCCAGCAAAGTCCACCTCCTCTGCTTCAGACTGCTTGATGAAAGGATGTACCT
GAAAAGTAAAGTGGGAATTAGGGTTCCAGATGACTAAATCCAGTAGATGGTCTTACCTAC
CACTAGCTGCTTCAGATCGGCCCTTTCTGCAGGATTCTTTATCAAGCTGCAGAGGAGGCA
AGCAAAAGTATTGTGGCTTGCAGAACATTTGAATGTAGGTAAATAAGTTTTCCATACGTA
CCACTTGTTGACGAAATCTTGAAACTCAGAGCTGAAAATTGCAGGAAGCTTTGGTGGAGG
CTAAGAAAACAAATGTGTTCGCATCAGCAGAGTCTAAGCACAAATCTATTAAATGACTTC
AGAATGTACAAAGATGAACAAACCTCATTGACTATGTAATCAAGTAGTTCAAATATGGCC
ATTGGCGGTCTACTGTCTGGTCCATATGCTGGGATGAGTACAGAAATGAAAAGCAAGCTG
TAAATTCTGCATATTTGCATGTACCGGCAAGCTGAACAGATGTCATCGCATACTTACAAC
TTCCCGGCCGTCCAGGTGGGCGTGGTTTTGGAGATTCACTGGAGGCCGTTTCCCCTTCCA
CAGGGAACCCAAAAATCTTTTCCAACTCTCTTGAATCAGGTGGAGGGATAGGAAAGCGTC
CAATGGCCATTTCTACTAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2384..2555, 2633..2739, 2953..3091, 3245..3369, 3608..3737, 3976..4132, 4325..4408, 4584..4704, 4786..4900
1001..1015, 2384..2555, 2633..2739, 2953..3091, 3245..3369, 3608..3737, 3976..4132, 4325..4408, 4584..4704, 4786..4854
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved