Oryzias_latipes Locus RPLP0
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RPLP0
Oryzias_latipes
RPLP0
5
SNORA63, SNORA63
1549..1675, 2019..2143
4127
AGCCCAAAACTGGTTGCTGTAGGGGCCATTCCTAAAACTCAAAACGACGCTCCAGCCTT
TCCAGAGAGACCAGTGGTCAATAAGTTTTTTGAAGTACTTACACGTTGCCCTGACGCAAA
ACTTGTCCGACACGGGCAGAAAGGTAAAAACATGGTTCCAGACCTCTGACGGAATCTGCA
TAAACGACTGTGCCATCGATTATTCTAAAGGGCATAGGAACTGGTTATAAACAAAAGCGC
AAAAACCCGCAATCCCCCCCAAAAAAAGACCACACGAACCGGTCCCTTCTTCTAATTTTT
CTTCGTTTAGGTTCCTCCGGTTTCCAAACAAAACAGCAGATTTGTGCAACACCCCCATCT
ACCGGTGAGGAGTGCGATTCACGATTTTAGAAGCAGAAGTCACTTTCAGTCAAATTTTGT
TTTAACTCTTAAGTTATTATTATTATACTTTAAATTGATATTAAAAAATAGTAATTATAT
TATTTTCAAAGGGTTGTGGAAAATATGAAGGCTTCAGCTGGTTTCCTCAAAAGTGAATGA
CGTAAAATTTGGCCAATAGTATTTAAGGAACCGCCCCATGATGCAACATGATTGGCCAGC
AGTTTTTGATATACTCCCTAGCCAACCTTCCCCTTCCTCTTTCTTTCACGCGGCCCTAAC
GCGGTAAGTTGACCGTATGCTGCTGTAGTAAAACCCGGGAAAAGTCTAACTTACTGGGTT
TTTGTTACAAAAATGGGGCCCAAAAATTCAGAATGCGTTATTAAATTCATTCAGTTGAAG
AACATTCAGTTTGGTGTTTATAGGTGTAACATGACGGTGAAGGCGAACGGGGCCTGCTCT
GCTAATGCTAACATTTTATTAGCATAGCGAAAGCTCTCTACTAACTATATCCATTTTCCG
CCCAATTTAAAGTCGTCTTCTGTGTGTCTTCTTTCTGTCGTTTGTAGAGTTCACCTTGTC
TTTAAACCAGTTCTTTGGCAATCCCTGGTAGCACTGTCAAGATGCCCAGGGAAGACAGGG
CCACGTGGAAGTCCAACTATTTTATAAAAATTATCGTAAGTAAAATGACTGCAGGTTGTC
TGTTTTCTAACATTTTATTTTCAATGTTTCCAGTCTGCAATGTTTACCTTTTAAGCATCC
GGCAGATTTGGCTTGGTTTGAAATTTTATTATATAGTGAACATTTTCACAGCTGCAGAAA
GTTTGTAAAATGTATTTTCAAAATATTTTGCAACCTTCACACCAAAACAAACGTGCAACT
AAGGTTTTGAGGTGATGAGAGAATGCAGCACATCTTATTTGGGAGAAAAATGCCTAATTT
TTGGAAAATTCTCAGTAACATTTTATTCTCTCCTACACATTTGTATTTGAGAACCGTTCT
GGGTTTTTTTTTTTTTNNNNNNNNNNCCGTTTGTCCCTGGGAGGCAAAGCCGTGGTTTTG
ATGGGTAAAAACCCCCTGATGGGTAAAGCCATCCGTGGACCCCTGGAGAACAACCCTGCT
TTGGAGAAGTGAGTTCTTACTTTTTTTTTTCCCCCTGAGATTTTAAGTTTAGCAGGATAT
CTACTGTGCAGCTTGTGTGGTGCTGCATTGTCGTTCCCCCTGCTGAAAGTAACATGTTTC
CAGCTATCCCTGTCTGTCTAGATCCCCGACAGTTAGGGACGCAAGGTCTCAGACACTTCA
CCTTTAAAAAAAAAAATCATTTGGTGTTATTTACAACTTACTTCTGTGATTCGACAGGCT
TCTGACGCACATTAAAGGCAACGTTGGCTTTGTCTTCACCAAGGAGGATCTGACTGAAGT
CAGGGATCTGCTGCTGGCCAACAAGGTAACCAGGTCTGGCTCAATTGTTCATTTGTTCAA
TGATTTTTGTTCAATCTATTTGGATTTCAAATCAAAAACACATTTTGTGATTAGTCTTTT
CAAAGGTAATTTGATAACTTGAATTGGTAATGTGTACCCTTAGTTGGTTTGTGCAGCAAA
AACGGCATATAAACTGTAATTGGCTACAAGCAAGAGCCTGTGCAGGATAAGTTACAATGC
AGCTGTGTAGTACTGTATTGTCGTTCCCCCTGCAAACAGTAAGCTGTTTCCTCGCTATCT
CTGGCACGATCTTGTGACTGCCAGAGTCGTATGGTTTCAGACACAATAGAATGCCAGTTT
TTTTTCTCAGCTTGTTTTCTAAATGTAGCACGATTCTGTGGCTTTTCCCAGGTACCTGCA
GCAGCTCGAGCTGGAGCCATTGCCCCCTGTGATGTCACTGTGCCAGCCCAGAATACTGGA
CTTGGTCCAGAGAAGACCTCCTTCTTCCAGGCTTTGGGTATCACCACCAAGATCTCAAGA
GGAACCATTGAAATCTTGGTATTTAATGGCTGCAGGAGATGCTGATCTTTTTTTTCTTCT
TTTTTTTTAGCCATAATTCTCATGTTTCTCTTTTTTCTTTTTAGAGTGATGTTGGTCTGA
TCAGGACTGGTGACAAGGTCGGTGCCAGCGAGGCAACTCTGCTCAACATGTTGAACATCT
CGCCCTTCTCCTTCGGACTCATCATCCAGCAGGTGTATGACAATGGCAGCGTCTACAGCC
CTGAGGTCCTCGACATCACTGAGGCTTCCCTTCAGGCCCGGTTTTTGGAGGTAAGACGTG
CTTCATTTAGAGCCCTGAATCAGAGCAATTTAAAGTCTTGATTGTGTTTTTAATTTGAGT
TAACTTTTATCTCTAGGGTGTGAGGAACATTGCTAGTGTGTCTCTGGAAATTGGCTATCC
CACTCTGGCCTCCATTCCCCACTCTGTCATCAACGGCTACAAGAGAGTCCTGGCAGTTGC
TGTGGAGACGGACTACACTTTCCCTCAAGCTGAAAAGGTGTGTTTCATGCTAAGATGCTT
GAGTTGCCTTAGCATGTTTTGTTTTCATGGAACTGGAATAGAAATCCCACTGCTGCTGCG
GTCTAGAGTAAAGCTAACATGACTTTTTTTGACTGCAGGTCAAAGCCTTCCTGGCAGATC
CAACTGCTTTTGCTGCTGTTGCAGCACCAGCAGCTGCTGCAGAAACTGCCGCTGCTGCTC
CAGCTGCCAAGGAGGAGGTTAAGGAGGAGTCTGAGGAGTCCGACGAGGACATGGGCTTCG
GTCTTTTTGACTAAAGACCAGTAAACCAGACCTGATTTGAGTAAAAACGCAGAGTGTAAT
AAACTCTTCTAACAGCGTTAGTCCTTTGTCTTGGGTTTTTATTTTTTACCAGCTAAACCT
AACTATGTAAGTCATAAAGTAGATGTGCATCTGAACTGATAAGTAAAGGATATCCAAAAG
TTTCCAAATTGAGTACATATTAGTAAGGTAAATGTAATCCTATAAGAGGCCTGACCCATT
TTTCCTTTAAAATGGTGTTTGTGTGATGCACTATAGACCAATAGGACCATAGAACACATT
TCTAGCTGTTCAAATTCCAAAACTACTAAAACTGTAATGCGGAATTGTCTTGTGCCCCTG
ATGTTAAAAGCGATTTGGATGCCATGGACACGACCTTTTTAAATATAAGGCAGAAAATAT
GTCGGATTTCCCAAAGTAAAATATTAATGTGATCATTTTCTGAAACTAAATCCACTGTCT
CCTGGTGGTTAAATTTTGGATGATTTCTAAAAAATGTACACTTTCTTTCCCCGTGCATTG
TAGTCTATATTCTCTGATCTAGTGAGCACTGGTTTTTCCACTATGAAGATTTGGACCGCT
CTACAAAAGGACAAACCCTATAGTGCTCTTAAGTAGTTCTTTTGGGTTAAACTTATCCAG
AAATGTAAATTCAGATTATTTTTAATAATTTTAGGTGTTAAACCATAATAGAGTGGTTGG
AGGTTATAGTTAAACATTTTGTTTTATATAAAGCCCTACATTTAAAACTGCTATCTACTC
TTCTCACAATAGACTAGAACAAATACTTGTGCAAGTTTCACTAATTTCGAAAAGATGTAA
TGATCATCATTGATGTAGCAACACTGAAAATATGTAAAGGAAAAAAGTAGAAAACCTGAA
TCTGATTTTAAAATTTAAGGGCTCTGAAAATGAGGATTCTGTCAAAAGAAAAAGTTCAGC
TTAATTTTGTAATCCTGGTTTTCAGTGAAAGGTCAAATGGTTCCTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1054, 1091..1154, 1405..1507, 1737..1824, 2211..2357, 2444..2629, 2716..2946, 3068..3127
1001..1054, 1091..1154, 1405..1507, 1737..1824, 2211..2357, 2444..2629, 2716..2946, 3068..3127
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved