Oryzias_latipes Locus NOL5A
snOPY snoRNA Orthological Gene Database
Oryzias_latipes NOL5A
Oryzias_latipes
NOL5A
5
SNORD57
4736..4803
6539
AATTGTATTTTATTGCAAATAAACATGTTTTGCTGATTAGTGTTTTCTTTATATTTTCA
GTAATTTAGTCTCTTTGGAGTGTCAGGTCTGTGTTTGAATAATTAAATCTCAACACTCCT
GTTGATGAAAAGCTTTCAAGAAGAAAAAATGCATTTTTCGGATTAAAATACATTTAAAAT
AATTTTTCCATTGTTGCAGCAACATTTCATCTTTAGTTACTTTCTGTCCAAAAGAATAGT
TCTTTACCTTTTTTTGTCCACAATATGTTTCTAAGCGAAGTACCTTTTAATCAACTTAGG
ACAGTTAGATTTGAAAGTAGCTTTGATAAAAGCAAATAAAAGTGCTTTTAGTGATTAAAA
GACATGCAGCAATTTAGTGTAAAAAATGAGTAAGCAGCAATTTAACCATAAAATACCTAA
ATGAAGAAATTAAATAAAAAATACTAGACTGGAAAGACTCAGAGGAAAATATGACATTTG
TCCAAGCCTGTCCAAAGCCCATGCAAAATGATTTCCAATGATTACTTTTACTGAAAAAGC
TTCTTGATAAAAAATGTGTGACTTAAATGTGAGTAGACACTTCTATACAGATGAATGAAT
CTGAATAGACTTGTGTATACTGTTTTTGCAAAGATGTTTATTTGTGATTATTACACTTTC
AAGAAAATGAGATGGCACCATTTTCTTTTATCTTTGGTTATTTTTCTTTACTTTCTAATT
AACGTATTACTTCAAATCTGAAATAATTTAGATATATATAGGTTTTGTCATTTCTATTGT
ATTATTCCTATATTTTGATGCTTTAAATAAATAATTCAATAAATACTCCAATAAAAATAA
AAAATGTGATGTAATGCACTGGTTGATGATCAATAAAAAAATTCGGAGGTGCCATAATTG
TGAACAAGAGGTGAAGCCAAGCTCGCAGCAGCTGTGAAAGAAAGGCGGAGAGGGAGGAGC
CAGTATAATCTCGCGAGATGTGGGTCATGTCAAAGTTTTCTGCTCTCTTTTCGTGTGTGG
AAGCAGCGGAGCAGACACGTTGTGTGCCGCTGCGCAGATTTAGCCATCATGGTAAGATAA
ATGACTCTTGTGCACCGCCACCTTTATTCTGAAGAAACAACTTGAAGCTACGCAGAGGCG
ATAAATCCCCTTGTACTTGTTCAAATGACGTTTAAAAAGTCAAGGGAAAAAATGACGACC
GTTTTTTGCGGCTAGCCGCCTGTGCGGAAAGAATAGGCGGGAGTGTCTAAAGTTGTTTTA
ACAGCCACAGACTGAATTGGTGAAAAGGTACATGAACAGCTGTGTTAGTCAAAATATATT
ATGTATACAGAGTTTGAAGGATTTTAAAACCGCGTGAAGGGGTAATCGCTAAGCAGTTAG
CATTAGTTAGCTTAATAGCAAGTTTGCCTGGGCCCAGGTCAAACACGTGGGTTCGACAAG
CCACCACGTGGTTCCAGTTTAAAGTAATTCATATCTGCCTAAATCAACTTGCAATAAAAC
CACTTTTACTACAAATGTCATTTGGGATAAATCTTAAAGGGATTTATTGTTACTTACTTA
AATGTACCTTTCGCAGGTTTTGCTGCACGTGTTGTTCGAGCACGCGGCGGGCTACGCGCT
GTTCGCCGTGAAGGAGGTGGAGGAGATCGGCATGCTTCTCCCCCAGGTGAGCCTGTTCTC
CTGCGTGTCCCGGTCTGGTGTGTTGTCGGGAGTGGATCAGAGCGGTGAACGGTGTCTGTG
TGTCCGTCGCAGGTGGAGGAGAGCGTGCTGAGCATCGGGAAGTTCAACAGCATGGTGAGC
TTGGCTGCTTTTTTCCCCTTCAAGTCCGCCCAGGCCGCCCTGGAGAACATCAACGCAATT
TCTGAAGGCAAGTCGTATTTATTTACTGAATGGGTTTGTTTTTTAAGATTCTCAGCTGTA
ATGATGGTTTACAATCTGTCAATCCACTGATAAAATGTGATGATATTTTTATGTTACTGC
TGAACATCTGGGGAAAAGTTGAGTTTATTCATGCATCTTTTAGTGATTAAGACTATTTCC
TGGTGCATAAGAAGTGTTTGCTGGCTGCATGGTTGGATTACGGGTTGTGTTTTTGCTAAA
GGTTGCGATGTTTTTTCCAATGCAGGCGTCGTTCATGCTGATCTGAAGCTGTTTCTGGAG
ACAAACCTTGCTCTATCTGGAAAGAAGAAGCCGTCTTTAGGGGTTTCTGATGCCAAGATC
GGAGCTGCGCTGCAAGAAGAACTGAACATCTCCATACAAACCGGTGGAGTGGTGGCTGAG
ATAACTAGAGGTGCGTTATGTCTTTGTTTGAATACAGACGTGAACTCAGTTATTACTTTA
TTACTGTGAATGTTAATATAAAAAGGGGTGGTCTGTTGTGATGCACTTTTGATCCTGACA
TTTGTGATGGTTTATACTGAAAATCTGAACAGCCCCCAGATGTTTCCGGTTTTGTGGCAG
TTTCCTTTTGCGCCCACAAACCCTCCTGTTTGCTTTCACTTTGCAGGTATTCGCCTTCAC
TTCCACTCTCTGGTGAAGGGTCTGACCTCTCTCGCCGCCTCCAAGGCACAGCTTGGTCTG
GGTCACAGCTACTCCAGAGCGAAGGTCAAGTTTAACGTGAATCGGGCTGACAACATGATC
ATCCAGTCCATTGCTTTGTTGGATCAGCTGGATAAAGACATCAACACTTTCTCCATGCGT
GTGCGGTAAGCTGGTTGTTTAGGATGTTTTTGTTTTGGTTCCAGGGTAAAACTGAATTAA
ATTCTATAAAAGTTTGAAAGATAAAGTGTCCTCCTAATGCTTACCACAGACAGTGCACCT
CAGAGTGTTGTCTGTATAGAAACAGGAGGTACATCAGCCTTCTCCTAACATTTGCGCGGT
ACTTGCTGACATCTCGTAACGCCACACTGTTTGGGGGGATACATTTCCCTGTCTGGTTTT
TCCCTAACGTGTGCATTTTAGTTTTGAAGGGTTATATCACACAGGATATTCATAGTTTGT
TTCCTTGTGCACTCCAGGGAATGGTATGGCTACCACTTCCCGGAGCTGATCAAGATCGTT
TCAGAGAACTCAATGTACTGCCGCCTGGCCCAGCTCATTGGCAACAGGAAGGAGCTCACA
GAGGAGAAGCTGGAGAGCCTGGAGGAGGTGGTGATGGACAGTGCCAAAGCTCAGGCCATT
CTGGAGGCGTCTCGCTCCTCTATGGGTCAGAATTTAAGCCAGTACCCTACTGTAGCGTTG
ATCTTATAAGCCCCTTTTATGCCCACCCTGGACCGATAATCGTCCTGGGTGCCTAACACA
GGGGGGTAGATGATATCTCTCATAAACCTGTAGTGAAGGCGTGTCCTCCTCACTGCGGAT
CCTGTCGGGAGAAACAATCCCACAGTGCAGCTCAAAATACAAACTGGTCCTTTTCTTTGT
TCATAGCTATCGTCTTTTCCCTTTCAGGAATGGACATCTCTCCAATTGACCTGATCAACA
TTGAGAGGTTTTCCAACCGTGTTGTGTCCCTGGCTGCGTATCGCCAGGGGCTGCAGGAGT
ATCTGCGCTCTAAGATGTCGCAGGTCGCTCCAAACTTGGCAGCCTTGATTGGAGAAGTGG
TGAGGAAACGCTTGTGTCTCTGTCTGTTTCTTGGACCAATGATGTTTTGCCAAAATCTGT
CAATCCCCTGAATCCGTGTGATGAGAACTACATCGGTGCTGATGGTCCTCTGCACATTTT
CCTAAGCTCAGAGTTTCAGAATTTTGTTCCGACTCATAGTTTTCTTGCGTTTTAGGTTGG
AGCTAGACTGATCTCTCATGCTGGAAGTTTGACCAACTTGGCCAAGTACCCAGCATCAAC
CGTTCAGATCTTGGGAGCGGAAAAGGCCCTGTTCAGGTACTGGGACGCCCCCGCCCTGCT
GGGGACAAAAGTGGGTGCAGTGATGGCAGGGCTGGGCAGGAGCAGAGCGGGGTGACTGGA
GAAGACCAGAAATTGATGTCTTCTCTGGGGTGATCCCCCTCTCCCAAATGCACCCCCACA
GTCTGAGCAACCACTCACAACACCGAGGTAGAATATCAGAAAGCTTTGATGTGGTTTTAT
GATTGTGTCTAAGAGAGCGGTTTGACGCCGGGTTCCACAGAAGCCTCTGACATGTTTGCT
AAGATAATTGGGTTTTTACTCAATCCCAGCATGCAATGCTGGACCTGGCTTTCGCCATGT
GAAAGGGATATTGTTTTCCCAGAGCCCTGAAGACCCGCGGTAACACCCCCAAATATGGCC
TCATCTTCCACTCCACCTTTATTGGACGAGCAGCGGCCAAAAACAAAGGCCGCATCTCCA
GATACCTGGCGAATAAATGTACTATCGCATCCCGCATCGACTGTTTCTCTGGTGAGTGCC
ATTGATTGGTTGGTTACTGTTGTTCGCGCCGGTGTCATTGCAGTGATGCTCATATTTTTC
GTCAACAGCATTCATCCTTTCAGGTTGATGTTGAAAAACTTATTTTCTGAGCAAAACCAC
AACTTTGAAAAATGCATGATTTGCTGTTTCCATTAGATTTTGTTTAAGGCTGCGAGTTTC
TACTTGATTCACAGAATTACCCACAAGTGTTTTTGGAGACAAGCTGCGTGAGCAAGTGGA
GGAGCGTCTGTCCTTCTATGAGACCGGTGATGTGCCTCGGAAAAATGTGGACGTCATGAA
GGAAGCTGTGAAAGAGGTGAGCTCGGCTGAAGGTTTGAAGAGAAACGGTTTGGTGTTGTA
AATGATGAAAGGTCTTTCCCTGATGTCACAGTGAGGGTGAAAACTGATTTAATGAGCCTG
ATGCAGCACAGACAGATTCCAAAGGCCATAAGTTTTCCCTGCTAGTCTTGGTCACACCTC
GGTGTTCTTGCAGGCTTCGGATGTTGCAGCTGAGTTAAAACGCAAACTGGAAAAGAAGGA
AAAGAAACGCCTGAAACGGGAGAAGAAGCTGAAAAAACTAGAAGCGAATGGAGAAGCCAA
CAGTGATGCAGAGGTAAAGTTTTGGTTTCAGCTCGAGTGAGCATGTTTTGATTTGAGACT
CGATCCTCAGATGGTCTTTTCTCAGTGTACGACATGCAATATCAACGTGACTCCGAACCA
TTGGCTGGTCCCATCAGTGGGCTTGATCACTGAAGAGAGTCGTACATTCAAATCCCATTC
TTCTATTTGAGACATTTAGAGCCTGATGGGCTTTTCTTTTATCTCAGGCTGAAGCTGCAG
AGGCAGAGAACGGTGCAGAGGAGAGTCCAGCCAAGAAGAAAAAGAAAAGGAAATCGGAGG
CAGTGGAAGCTGTGGCAGAGCAACCTGAAGGTAATGGCACGGAGCAAGCAGATCCTCCAA
AGAAGAAAAAGAAAAGAAAATCAGATGCAGATGGAGTGGAAGTCAAAATGGAGGAACCTG
AAGACAATGCCACAGAGCAGGAAGAGTTTCCAAAGAAGAAAAAGAAACTGAAAACCGAGA
AAGTGGATGGAGAGCCAGCCACTGAAACTCCAGAGATGCCAGTTTCTGGAAAAAAGAAAA
AGAAAAAAGCTGCAGAGTAAAGGCTGAAGTGACTTGACCCCCCCACCCNNNNNNNNNNCC
CTCTCTCTTGTACAGTATTTTTCATTTATCAGTGAGTGAAGGAGTTTCATTTTCTGTTTT
GGTCATTGTAGAGCAGGTTTGATAAAGAAACGCTGTTGTGCCTTGAGCTCAGTGCAAATT
AAAGTGTCATTTAAACTGTAAATAAAAATCAAAAACCTCACTTTTACTTTTCATTGGAGT
TGTGGCGCTTACATGTGATCAAATGGTTATTGTGGTTCAGTTTGGACATGTTCTAAGTCA
ATTTGTTACATTTACTCTGCTCACCAATGCAATTATTTGTGACAAAAAACTGAAGCTTTG
AATAAAAACCGCCCATTTCAAATGTATACGCTGTACGTTCTGTGTTTTGATACAGTCCCG
TCTTCTAACTGAATTGGTCTTAAAGGTTTTTTTTAATTTTAACTTCAATTTTCTCAATCT
CAGTGTATCTCAAAATAATTTGAACAGGTTTAGTGTCAAATCTGTATCCTAAAAAAATTG
AATTTGATTCCATCTGATTATTTCAGTTAACCCTTGTGTTATCTTAGATGACCCCACCCT
TACATTGATGTGTTCTCCCTACCATGACAAAGGTGGATAAAGGTAAAAAGATTTCATGTA
CTCCATGGACACCAGTGAAGATCACAAATCATTGAACGATTGAAGAAGCGCACTGTCTAG
TGGGTCTAGATGATCCAACTCCCAATTTTAAAGTGCCTAGGATAGCACAGGGGATAAGTC
AAATATTCCACGTCCTCGATTCACCAGTGTGCAGAGCCACACAGGTCTCAAATGGGATTT
GAACCAATGCTTTCTGAGTGCTAACCACACCATGCAGTCCTTTATCAGCTATAAAATTGG
GAAACTGCTCAAACTGAAAACCTAAAGTGTTGACACGCAGGTGAGGGTTTTTCATGATTG
AATCAAAAGTGCAGAAAGCAAACCCAACCGGACATTTTTTCTGCTATATAAACCTGTCGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 1576..1665, 1752..1866, 2125..2289, 2506..2704, 3017..3204, 3447..3598, 3775..3875, 4222..4370, 4574..4695, 4873..4992, 5207..5539
1068..1070, 1576..1665, 1752..1866, 2125..2289, 2506..2704, 3017..3204, 3447..3598, 3775..3875, 4222..4370, 4574..4695, 4873..4992, 5207..5536
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved