Oryzias_latipes Locus NACA2
snOPY snoRNA Orthological Gene Database
Oryzias_latipes NACA2
Oryzias_latipes
NACA2
7
SNORD59, SNORD59
9051..9124, 10016..10090
11294
AAAACATGTTTTCTTCTTCTTTTTTTCATTTTGCTGAATTTTCTTTCTTCCAGATGATC
AAATGGAATTCTGACAGGCATCAAACTCGTGCTTTAAAAATAACAGATTTTACTGTCTGT
TAGTACATGTGGTGATGGATGTGTAGTGCTTTATGCATTTGTGCATTTGACTCTTGTGAC
TTTGATATCTTTTTGTATCAAATCTTTGTAATTTTCTACATTTTTCCAACATTTTGCTGG
TGTATAAATATTTGTGAGGCATTCAATAAAATGTATTAAATTTAAGCTCTTGTTCAACCT
TTTGTGATTGATTTATTTAAAAACAGGGATTTGATTAGAGTGCAAAGTATTAATCACTTC
CAAAAATATTTTTGATATGTTTGTGAGGATGTCTCTTTATCAGGTGTCTCCTAAACTAAA
GTGAACAAAAATTTTAAGGGCGTATAATCTTTACCAACCAATTTAAATAACTGATAAAAG
CGTGTGTCAAATGACCACAACTAAGACTAAATTATTGAAGACACCCATACTAACTTATTT
GCACAGTTGGTATAATTTTTATCATTTTTGATCAGAACCACTGAACTAAGAAAAAAACAG
GCACCCTGAGGTTCATTATTTGCAAGCTTGCAGAGCCAAATTTTTAACAAAACATTTTTT
AAAAGTTCTTACAAATACTTAATATTTAATTTCTATAGTGTAAATTTATTCCCAGCATGC
CAAACCCATCTGACAGAAAATTTGATTCAAATGACAAAAAGAAGCCTCTTTAAAAGATTA
CAATAAACATTTACTATGACAAAATGTGTTCCCAAATTTTTTAACCTAGATATATTCAAT
GCTTTCTACGAAGAGAAGGCTGTTTTTAATGCATAAAAAGACTATAAGTTTGATTCAAAA
ATTGAAACGTTTTTACACAGCACACCAGACTTTACCTCTAATGATACCGGAAGTAGAAAG
GTGCTCCACCGGATATTACGCAAAAACTGGGGTCAGGAGTTCTTTCTCACAGCCATCTTG
GAATTAGCGTCCCGAGTTGGTGAGGATCTCCGCTTGAAATCCAATATCATCTGGCAGTTT
TTCCTACATGTATGCCCTTGCTAAAGACCTGGCTGGTTTAATTGAGATGTGACCATCACG
TTGGTTGAATTATTGTTCTTGTAATGCCTCTCTGTAGTGAAGAATGTGCTGCTGAAGCAT
TGACAAGCAGCTCAAAATGGGGGAGCACGATATGTAACTTTTTAGTAGCGAACTGAGTGA
CTTGGAGTGAGCGTTTTGATGCCAGATGTACGTCTATTAAAGTAATAGCCATCTGGTTAC
CGATGTAAGTGATGGCAATGGCAGGAAAAGGCGGTTAAAGGCGAATGAGCAGGCGCTCGG
GCGGTCGCTGCTTAGCGGGAGCTAACCGTCGCTTAAGCATGGGTTCGTCACCTGTTCAAC
CGGCCATGATAACGATAAACGATTAGGTTCTGTGATGACCGAACAATAGTGTTGATTAAA
GTGTGTCGACTGTTTGATTTGCCGGTAAAACACTACGTGTAATTATGTCTTCTAGCGACA
ACAATGCCTGGTGAAGCGACAGAAACTGTCCCGATCACCGAGCAGGAGATGCAGCAGCCT
CAAGTGGAAACTGGTTCGTATCATTGACTTATTTCCATATGCTTGTTTGATGGAGTATGA
ATGAAGTGGGGGTCTTGGATTTCGAAAAAGACGTTAAGACGTCTACAATGAGTGCTTCTA
TATATTCTTAGTAAGAGGAATCGTCGTTTATTTGGCTGGTCATAAGGGGTTCACTCAGAC
ACTGAGTTACAACTGCCTAGATAGTTTGACAGACACTGAACAGGTGGTCGCACGCGGGTG
TTTTTACTTTTATTTCCCAAAGATCTTGAGTAATGTAAAATGAAAGAATTAATCCAGAAC
CCCTCTTTCATTGATGCAATGGGTTGTGATGGCATGTTCTGGCCTTGGGATTTGCCACAG
ACTGCATGCTGCCTCCGCTGAGTGCTTTTTTTGTGTGTGGTGTGTGTTTCAAATCAGTGC
CGTTTATGAAAAACTACCAAACAAGTATTTATAAATTATAATGAAATTATTTAAACTATG
CAAACATAAAAAAACTGACTTTGGAGTGGGGCATTTGTGCTGCTTAGTATACTTAAATAT
AAGGAGCACAATAGGTTTACAACATTAATTAAACTGTAACTTTTAGACAGAATTAAGAAA
AATTTGCTTAAACAATGTATTATGAGTTGTAGACATAAATTAGAGAGTTTTGATTTACCT
CGATTTCGAGTTTGAATTTGTGTTTTAAAGCTCTATTTTAGGGTGTATGTTATTAGTTTA
CTGAACAGCTATAACTGCTGGTGATTTAGGGAATGCAAACACTCATCCATTGGTCATCCA
GTATAAACAAAGTTGAAACATTTTAAGTTGATGTTGCTTTTAAGCCCCTTGATTTAGCTG
AAAGGAGAGGTTGAATAAGGAATTAAAGTGTTCTTTGTTCAGCAACAGCTCAGTTTGTTG
CTATAAAACTTTGGTCAATGTGCCTCAGGTTTTTAGGAATTGGAATGAAAGAAATGGCTA
CTTGTTCATTGGATAAAGCATCATGTTCGAAGTTCCTGTGGCTTTGAGGAAGATGCACTG
ATTTGAAATTGAGAGCACTCCTTTAATAAAAACGTAAATTAAGCGTTGCAAAAAAATAAT
TTCCCTCTAGTAAAGTGTTGTTTACCAAACACTCCAAAGAAAATAGGTGTTAGTAACATG
TTCTTACAGCATTTTTCTGATAGAGCACACCTAAAAAGAATTTAGGCTTAAAACTGCATT
TGAGTATTTCTTTATATAAAAAGTGGTGAATCAGAATGAAAAATTGCAGTTCACAAAAGC
TGTCAGTTGTGATGCAGCACCTTAAATAGATGGGCCAAAGCCTCTCTGCTCCGCTCCATT
CTGATGCATGCACTTGCAGTCACATACGGTGGATACATGAATGCTTCGTTGTCCCCGTCT
GAGCTGGCATCTGGTTCAAAATTCTACAGCTGGATAGCTCCAATATTGCTTATTAGTGGA
GCCTTTTTGTTGCTCCACTAATGTCAGCTTGGGGTTATGAGAGGTCGTAAGCTAGCAGGA
CAGTGTAAACAAAGGGATAATGGGATATCTGTTGAGGCTTACTTGCGCGCCAAAGTCCCA
CACACAACTTGCAGACAGATTTTTATGGAACTATTGCTGTGCCTCACAGAGTCTGATCTA
GAAAACGATACAGGTTTTTGGATTTTGCCTCAAAATGACAGTCATAATTAAAATACCATT
GGGAATGCTTACACAATAGATCAACATATTATTGAAGCGGGACTTTTAAGTGCTTTACAG
CTACGATTTAACTGGTACCCCCTACCACCCTAACTTTCCCCCCATGGTCTTTAGCTGCTG
CTGTTTCAATTCAAACAGATTTTCTAGTGCATTGCTTCCCTAAATAAAAATTTAATTAAA
TTTATAATTTATACTTTATTTATCCCTCAATGGGGAAATTGTTCTCCGCACTTGACCCAA
CCCCTGGGGGAGCGGTGAGCTGCAGACTAGCCGCGCTCTGGGCCCTTGGTGTACACTGCC
CTGAATGTTTTCAATCCTACCTAACGCAAATATACCTGGCTTTGTTGGCTGTCATTGTGA
GGTCTCTGCAAAAGGTCTATGACCTGAATCAGAAATGTTTAAACAGTCGCATGGAAGACC
CAGGGACAGGTTTGAAATGCTGTCTCAATGCGACTGACAGTTGACTCAGCAGAGACATTA
GTTTGTCAAGTGCTGTCTGTTGAGGGTCATGTGGGTTTATCTGAGTTACCTGCTTGTGAA
AAAGCAAATATATAGTACAAATTCAGTCATTAAATGCTGATGAGCAATCGACTATTGTGG
GGTTCAGATATTTCCTTAATTCATTTTAAGGTTTCTATTATAAGGATTCATTCCAATATA
GATGGATTTTGGGTTAGTGTTACCCTGGGTTGACACGGCATCCAGTCAGGTCAGGGGTGG
TGGTGGGGGGGGTATTACTGTTCTTCTTCACTCTGTAACACCAAACATGAACGCGTATTG
TTAGATTTCGATGAATATCACTACATGTTTTGTTTGGAAACTATTTTATGCAGCGCAACA
TTACGTGTCTGTATAAACAAAGGTGGAGCTTTCTGCCCCGCGTTCTTTATGGTTGTCAGG
CTCATGGCTACCGCGACACCGCACCCCCTGCTGGTCCATCACCGCGCTGATCAGATGTCG
CACACTGTCACAGCACTACACAACCGGGTCCAGCGTCTTGCCAAAATTTGAAGCCAACAA
CATTGATTCGGAGTGCTGTCGAGGTGGGACCCGGCTGGAGAATGTGTGAGCACAGGGTTA
GAGTTGTTCTGTTTTACTTTTTTTGAAAGCATGAGGTGGTGTGCATTCCTGACCTAGCGT
TTTCTTTGAGTTGATGTGATGCCAGATACAATTTGCATTCTAACGAAATATAGAATGAGT
TTGTTTTGTTTAGATTTATCTCCATGTGATTGCATAATTGCGGCAAGTTGTATCAAACTA
AAGTTTTGGAGATTTGNNNNNNNNNNTTGGAGATTTGTTGTTTTTTTTTTTTTTACCCTT
AACATAAGCAACCAGTGCTTTTTGGTTTGGTCACATTTAACCTGCATGGTTAAGATTTCC
AGAATTGGGTCACATCTTTTAAAAGTCTTTCTTTATTCAGCTGCCTCCCCTGCCCCAGTC
TCTACCCAGAAACCTCAAGCAGCTTCAGGACCTGCTAAGCCCAAAGGCAAAGATGCTAAG
AATGTGCAGGGTTCTTCTGCCCCTAAACCTGTCCCAGGCCGAAGAAAACGCTCCTCTATG
TCTGCCTCTTCCTCATCTCCCACCTCACCAAAATCAGCTTCTTCTACCCCTCTATCACAT
GGGCAATCTCCCTTGGCCTCCCCAGCTAGCAACTCCCCTGCTAATCTAGGAAGCTCTCCT
ACACCAAAGGTTATCAAGGCTGGAAAGCAAGGAAAAGCTAAGAAGGGAGATGCATTTGTC
CCCATGCAGGTTAACTACAATGTCAAAATGTCTGAAGACCCCAAACTAATGGCAACTGGT
GAAGCTAAAACTACTCAGATTGAGGTTAAAGCTCAGTTACCTCCAGCTGCTTTTAAAGTT
GCTTCAAAGCCAGCTGCAGCAGCCCCAATTTCATTTTCAGACACCATTCTCTCAAGTTCT
CCAAAACCGGGTGAACTTAAAAAAGCACCACTGGCTGTTTTTGCAGACGATGAGCTTCCT
CCACTGCTTCCACCAGAGAAACCAGTTAAAATAGTTGTGGCTGAAAAAATACCTCCAGCA
TCTGATCATGAGAAGACCTCAGCTGAGGCCCCTGCCTCCAAAACATCACCAAAAGGCAAG
AAGGGTAATGAGCCCAAATCTGTACCGGCTGAAGCTTCTAGACCAGCTGGTAATGAAGCT
CCTAAAAATATTTCCAATCCCAAGTCCACCCCTGTCACTGTTTCCCAGGACAAGCTAGCT
GCTGTTGAAGCTGTTAAACCACCTGAAAAAGTCCCCAGCATGCGTTCGAAGCAAGGTGAG
GAGGTTAAAGTGTCATCTTGTAAGGGGATGAAGCCAGATGAAAATGTGAAGGCAGCCTCC
ATTAAGACAGAGAAGGCGGTCCCCGTTAAAATTGAGAAAGCGGCCCCCACTAAGGCTAAG
AAGGTGACCCCGGTTAAGAGTCAGGAGACAGCCCCCACTAAAGCTGAGAAGGTGACCCCG
GTTAAGAGTCAGGAGACAGCCCCCACTAAGGCTGAAAAGGTGACCCTGGTTAAGAGTCCG
GAGACAGCCCCCACTAAGGCTGAGAAAGCGGCCCCTGTTAAGGGTGAGGAGGCGACCCCC
ACTAAGGCTGAGAAGGTGGTCCCAGTTAAGAGTCCGGAGACAGCCCCCACTAAGGCTGAG
AAGGTGGTCCCAGTTAAGAGTCCGGAGACAGCCCCCACTAAGGCTGAGAAACCGGCCCCT
GTAAGGGCGAGGAGGCGACTCCCACTAAGGCTGAGAAGGTGGTCCCAGTTAAGAGTCAGG
AGGCGGCTCCCACTAAGGCTGAGAAGGTGGTCCCAGTTGATGGTGAGAAGGTCTCCACCA
AGTCTGAGAAGGCAACCCCATTTAAGAGTCAGGAGGCGGCTCCCAATAAGGCTGAAAAGG
TGGCCCCAGTTAAGGGTGAAAAGCCCCCCACTAAGTCTGAGGTGATTACGGTTAAGAGTC
AGGAGGCGGCCCCCACTAAGGTTGAGAAGGTGGTCCCAGTTGATGGTGAGAAGGTCTCCA
CCAAGTCTGAGAAGGCAACCCCATTTAAGAGTCAGGAGGCGGCTCCCACTAAGGCTGAAA
AGGTGGCCCCAGTTAAGGGTGAAAAGCCCCCCACTAAGTCTGAGGTAATTACGGTTAAGA
GTCAGGAGGCGGCCCCCACTAAGGCTGAGAATGTGGCCCCAGTTAAGGATGAGAAGGTCC
CTGCTAAGTCTAAGGCGACCCCTGCTAAGGCTGACAAGGCGACCCCTGTTAAGAGTCAGG
GGAGAGCGTCCACTGTTAAGGCTCAGGAGGCGGCACCCACTAAGGCGGAAAAGGAAGCCC
CTGCCAAGACTGAGAAGCCTACTCCCATTGAAACTGCAAAGCCAGCCCCCACAAAGACTG
ATAATGCAGCTCCCCCTAAGACTGAGAAAACAGCCCCTGCTAAGACTGAGAAGGCAGTTG
AAGAAGCAAAAACTTCACCCCAAAAGCCAGGTGAAGACAGCAAACCAACTTCTGTTGAGG
GTGATGAGCCAGGTGCAGCAAACAAAGCAGCTAAACTTACTGAGGCCAAGTTGATTGATG
TAAAAGAGGCTCCAAAGGCTTCCAAGCCTGTTGAACCGTCATCAGTTTCAATAAAACCAG
CTCCGATGGAGCCTGCTCTTTTAGCCCCAGCTCCTCGAAAACTCACTTTTGCAGAGGCGG
TTGCTAAACCTGCACCTGTGAAAACCGAAGCTGTGGTAAATAACATCCACCCTGAACCAC
TTTCCCCTACCAAACCCATCCTTACACCAGCTAAAACTCCGGCCAACATGGAGCCTGTGA
TCAAGATCGACAATGGTACTAGCTGTTTGTCTTTTTTGTGCTTGTCCATCTGTTTGATCT
GAGCTGAAGAGATATTTGTACTTTGCCCCTAAAAACTTGCATCAGACCTCATTTGGCCGT
AAATATTTTTGAAGGATGGCATTTGATATGAAGCGGACCTGCTTAAAGAAGCCAGCGCAT
TGATATAGAACATTTAAGATATGTGACTGTAACTTCTTTTTTATGTGTGCATTATCACTT
TTTAATCCACACCCAGCAGCTAATCAAAATAAGTTATTTTTTTGGTTAGTGAACGCCTGG
GCACATTCCGAGGTCGCTTTATGCCAGTACAGTGACAGGCAAGTGGCAGGAAGGCAACAG
CACAACAATTGACTGATGGGAGGGTCTCCGAAGTCCCCCAAATCCTCTGATCGGCGTAAT
TTAGACTGTGGCCCTCCATATGGTAACAGCACGGGCCCTCGACAAAGGCCCATGTTAACG
GGGGCCCGACAATGACCAGAGGTCCACCTGGCAATCCCGGCTGCGGTGGTTTATTTGATA
TGGACTGTTGCCGTCCAGAGACATTTACATATTGTCCAATTAGAGCTGCCGCCGCCCGGC
TGTCAGATTTTGTTATGGTGTTTGTGACTTGTCATAGAACCTACACTCATGTAACAAGAG
TTGCCTAGATTATTAATATTTTTATTATTAAAGATAGGATGCATTCCCAGGCAGTACAAA
CATTTAACATATATTATCTGGGACCACTAAAGGAGCTGTTACCCAGCAAAAACTGACCGC
CTCTGAATGAAGCAGTCGCCGCCTGTTTTTTGACAGAAGTTTCATTTGGCACCAAATTGG
TCATGTTGATTATCTGTTCTTTTGGGGAATATCTTTTTCTCCGAAGTTCCTCCTCTACAG
TCCTCATGCAAGCACATACGATACGCGGACATCCAAACATACGATGCACGGACGTCCACC
GTGGTTATACTATTTATAAATTACTTTTATGCCATTTCATTTTCTTAAAAGATTTTGACG
AAACTAATAAACTTATAACTGATAAAGGAGTTCCTTGGAAAAGGTTTTTTTCAGGAAACA
AACAAAAAAGTTATTTGTATCTTGTGTTTTAAGTATTTTGTGATTTGCTCTCTGTTTGTT
TTATATATTTCATAAACTAGAAACAACTGAGGTATTTCTGAGTAAGACGGTGTAATAATT
TGGCCGGTAAAAATATGTTGGCTGCTGAGCAAGGAATAAAATTTTGGTCATTGTGCGCAG
CCATTTTGGTGTACACTGAAAGGCCTTCTTAAGCGCATCTGTGAATAGCCAAGAAAACAG
TTGATCAGTTAAAAAGCCAAGACACTTCAATTGTTGTTTTTTTCCCCAATTTGATGAGCA
CTCACAGGTTGGGGTAAACAGTTGTCAACAGAGATGGTGTAGATGTTTGGAACTAAACCC
CCCTTCTCTGCTGCTTTCAAATCAGCTTTAATTATGCCCCAGATGCCTGGAAAATGCATA
TAAATGGTCTAAATTAAAAGAAAAAAAGAAAATCCTGGGGTGAACGCCCCAGAGAGGACT
GATAGCCTCCCATCTTCTCCTCATTGGCTTCCTACTCTTAAAAATTTAAAGGGCCCTGAT
TATGGGTAAACCATTGAAGAAGACATGATTGATGTCTTTTAATTTTATAACTTGTTTTTT
GTGGTTCATTCATTCATCCTTTCATCCATTGAATGAATGAATTTTTTTGTCGTGTTTATT
CATTTTTTAAATAGCTTTTGGTAGGGGAAAAAATATATTAAATATATCTGCTTGATCTTT
CTTAGGATCCGGCACTGAGTCGGACAGCGATGATTCTGTCCCAGAGCTGGAAGAACAAGA
CTCAGCCCAGACACAAACGCAACAAGCCCAGGTACAATTCCCTTTCACTTTTGAAAACTT
AGCACTCAAGTTTGTGTTGCCCAATTGATTAACTGAGGGTTTTAGATTGACTCTTCGGGG
ATGATTTACACAGTGACTTTCGTTCTTCTGAGTCTACTGAAGCCAGCCTTTCTGTTCTGA
GAAGAGATTTTCATTTCATCCAGACTTTATTTACTCCAAGTCAGTTCTCAAACATTTAAA
ACATGACTTTTCCTCCCTAAAGCTTGCAGCAGCAGCTGAAATTGACGAGGAACCAGTCAG
CAAAGCCAAACAAAGCCGCAGTGAAAAGAAAGCACGAAAGGTAATCATGACTCCAGCTGT
GTCAACTGAAGGCGGCTATCGTTATTTGTTATTTACAATGTCTAATTTGTGTGTTCTCTC
ATAGGCAATGTCAAAGCTTGGTCTTAGGCAAGTAACGGGGGTCACCAGGGTCACTATTCG
CAAGTCCAAAAACATCCTGTTTGTCATCACCAAACCAGACGTCTACAAGAGCCCAGCATC
AGACACATACATCGTCTTTGGAGAAGCTAAGGTAATGAGACTTTGCTGTTTGTGTTCGCT
TAGAACTTTCAAAACTGATCGACGGGTTTAGGAACTTTTGGAAACGAAGGTGTTTTTTTT
CCAACTAACAAACCATCTACTGTTCTTTGTTTTTGGGTTGCAGATAGAAGACCTTTCTCA
GCAAGCCCAGCTGGCTGCCGCAGAGAAATTCAAAGTTCAGGGAGAGGCTGTTTCAAACAT
CCAGGAAAACACACAGACCCCTACAGTACAGGAGGAGAGCGAAGAAGAAGAGGTACTTGT
CGGAAAATCAATTTAGGGTGGACATTAAAATTTGAATAGTACATTGAAACTTTTTTGAAA
TAATTATTTTGTTACAGGTTGACGAGGCTGGCGTTGAAGTGAAGGACATTGAACTCGTTA
TGTCGCAAGCCAACGTGTCGCGGGCAAAGGCTGTACGCGCCCTGAAAAATAACAACAATG
ACATCGTCAATGCTATCATGGTGAGATTTTTTACTTAACCTCGGATTTCAAGTAACTCTT
CAGTGATGATTTAATACAGTGACTTTCGTTCTTCTGAGATTACTGAAGCCAACATTTCTG
TCCTGAGAAGAGGAAAACCTTTAAAACTGTAGCAAATGCATTGTTAAAATTTGGACCTAT
TTTTAATTTCTTTCTTTTTTTCTTTTTTTGCAGGAGTTGACAATGTAAGGGGACCCTGTC
AACGAAGAGTGGAAGAGTGTTGCTGATTTAATCTCATTTATACAGTTTATATCCAAGATG
GAAATAAAGTTGTGGCTTGGTGAAACTAAAACTAAGTTGTTGCTTCTTATTTTGGGAGAT
AGATATCTTGAGACGGTTTTTGTTTGTTCAATAAATGCCAGAACCAGAGAATTAGTTCAG
AGGTTGATTATTTTTCAAAGAAAGGCCTGTTCTAGACCAAAACATTTTTTCTTTATCTGG
AAATATGTTACAATAACAAACTTGGTTTTGTTACATCCAACATGCTTTTCCTGTGTCATG
CCTTGTGAAAACAGAGTTTCGGGTTAAAGTCAGGGTAGTTTAAACATGCTTCCTGGAATA
CCCCCCTGGAGTGGCCTTTAAAGTCTGTTTCCCAGCAAAAAAAAACCATCACAGCTATTG
AGAAGATCTGCATGGAAAAATTGACCAAAATAGCAGCTACAGTGTGTAAAAACTTGCAGG
AAAGTTTGACCTTAGTGATGGTTAACCTGGATTACAATTCCATAATGAAAAAATAGTGAT
AATTATCATAAAGCATAAAAACCCGACAGTAGGTGATGGTCTATCACAAATTAAAAACAA
AACAGAATGGTTCAGTAGTAACACTTAAAGCACAAAGCAGTTAGCCCGTGTTTAATATGA
GCCTTGATTTCAACACACTGCAGCATAAAAAAGGCAAACCATAAAGATTATGAGGTGTGC
TACAATTTTACAATAATTTTATTTTAATAAGCTCTGTTTACATACTGGTAGTTTCAGTAT
ACTTTCATCCCAAGACATACACTGGTATTTCCTCACCAATCCAAATTATCAAAATCAGGT
GTCCTAATCACTTGGTTTGGCCGCAAGTGTATAAAATCAAGCACTTAGACAAGCAGACTG
TTTTTAATAAATTCATGTGAAAGAATGGGCCGCTCTCAGGAGCTCAGTGAATTCCAGCAT
GGAACTGTCAAAGTACGGAGCCCGTGTCCTGACATGGAAAAAATAAAATATATCTCGTTT
CCACAAATTAATATCTTGTTCCCACAAATTAATAATCCATTTCCACTAAATACTATTTCG
TTCCCTCAAAATAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1088, 1555..1632, 8885..8970, 9202..9279, 9364..9510, 9643..9771, 9857..9979, 10173..10294
1563..1632, 8885..8970, 9202..9279, 9364..9510, 9643..9771, 9857..9979, 10173..10184
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved