Oryzias_latipes Locus RPS5
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RPS5
Oryzias_latipes
RPS5
11
SNORA3
1828..1961
4708
TTTTACAGTAAGATCTTGAAGGCTAAAAACATAATATTCTATTTTCCAATGATTTCATA
GATTCAGAAATGCAATAAAAGTGAAAACTGTTTCTACAAGTACAGGATGAAAACAGAGTA
TTAGTTGGCCAATGATGCTTCATGAAAGGAATAAATAAATAAGTTTGAGAAAAAATTACT
GTGAAATTATTAGATAAACAGTCTGCTATGATTGTGTCATATAAGGTTGTGAAAGTTAAA
ATGCGACTCATAGTCCAGTGCGACTTATCTGTGTTTTTTTCTACTTTATAATGCATTTTT
GGGCTGGTGCGACTTATACTCCGGTGCGACTTATAGTCCGGAAAATACGGTATATTTTGT
TTAAACACAAGCTTTTGTTTTGAAGAAATTGGCTGGAAAAGGGAGTTTGGGCTATATCTC
ATTTAATAGATGAACGGGGGGCCTTGGGGCGGTCCTGCTGGCCCTGGCCTGGGTGGCGGT
CTTGGTCGCCCGGGGGGCGGTTGTTCCCTGCCTGTTCCCGTGTGGCGTTGGGGGAATTCC
GGCTGCCGCTGCTGCTGCGGCGGGGGTATGGGTGTGGGGGTGGCTGGGCGCTCCTCCTCT
TTCTTTTCACATTCCACCATCCATTTTAGAAGAACATAAACACTCACCTGAGCACAGGTG
TTAGCTCACCTTTGCACTAATAGTTTGCATGATTGAATGAATGAAAGATTTCACACTAGT
TGGTTTAAAGGCATAGGTATGCGTTCGTGAACACTATCTGTTTTGTGTGCATGTTGACAT
GTGGACATTTTTGCGGCTAGCAGGTGTGTTGATAATATTTGAGTGTGNNNNNNNNNNTTT
CCTTTGTCTCATCATTAATATCGCTGTCAGTGACAGATAGGCCGTAAATGTTTGTGTAAA
AGAACAAAACACAATTTCCCGTCGTGCTCAGCGCCACCGGAAGTACCCCGGGATTCACCG
GATATCTGGACGCGGCGCCTCGGAAAGGCCCTTTTCCGTCTCAGAAAAGTGTGGTACACA
ACGGCGGACACAAGTGAGTGAAAATGTGACATTTTACGTCCTTTTAAAGCCATAAAAAGT
TATGAAATGTAACATTTAAAATCACAAACGAGTTCGTTTTTATGTTGAACGGAGTGTAGA
ACATTACTTTTCGGGAACAGTCATTATTTTTGTCTCCGAGGAGCGACCGTGTGGAGCTTT
AGCAGCTAGCTAAGCTAGGCTTGCAAGCACATGTGGATGTGGCTCGTTGACTCGCATCCG
CTCTTCGTGTGTCATTTTATGATAATCTGACATATAGTGTCAGATTAAAAAAATTAAAGT
GTTTTGTTTTCACTTCCAAAATATGCATTCTTAGCCATGTGGTTGCGTAGGTAAACTAGC
TCTTAAGCTATCAGACGCGGTGTATGCTAAAGCTAACCGGGATACTTTTCATTCTCAGTC
CGTCTCTTAATTTTTTTAAACCAGAGTTTTAAATTTTATTTGCTTCTCTCTGAAGCTTTC
TTCATTTAAATTCAAAGTCTTTATTCACTTCCATCCTAAATGCTGTGTTTTAACGTTATT
CGATAGTTTTTTTTTATTGTTCATACATTTTATGTATATTAAATGATAACATTGTGCTGT
CGCTTTGTATTTTTTATTTAATTTTTTTTGCTTGTCACCTCTATTGTACACCTACCCGTC
TTTGTTTCCATAGTGACTGAGTGGGAGACTGCCCCAGCTGTGGCTGAGACCCCAGAGATC
AAACTCTTTGGTAAATGGAGCACCGATGATGTCCAGATCAATGACATCTCCCTGCAGGTG
AGCGCCAGAGGAGTTACAGTCAAACCTGAGCGAGGCTAGAGTCACACCCTGACATAGATC
GGTTGTCCCGGTGTGCTAGAGTGCTCGCAGAGGAAAGCATCTCTGCTTATTCGTTGACTG
AAGTCTCATGTGACCCAGCCAATCACCAGCTCAGATACATCATCCATTGAGCAGAACGAC
CATTATTGATGTGTCAAAGAAGGATTTTAAGTTGCTTTTCTGTTACAGGATTACATCGCT
GTAAAAGAAAAGTACGCCAAGTACCTGCCACACTCTGGAGGCCGCTATGCCGCCAAGCGC
TTCAGGAAGGCCCAGTGTCCCATTGTGGAGCGTCTGACCAACTCCATGATGATGCACGGA
CGCAACAACGGCAAGAAACTGATGACCGTGCGCATCGTCAAGCACGCTTTTGAGATCATC
CACCTGCTGACCGGAGAGGTAACGCTGGACAAGATTGGTTTTGCAATCCATTCTAACTGC
GCCTTTGAGTAAAATTTTCCATATTAATGTTGGTTTTAAAAGTTTTTAGATTTTTAACAT
CATTAGCATTTGTGGTGCTCCTCCACTGCTTACAGAATATTATAAGTGTAATATACGAAA
AGTTGGTTTGAGCTTGACGAAATGACATAGTATATGAAGATAGAAGGAATGTTGGCAAAA
GGCTTGCATTGCCAAGGAAATCCCAAAATGTACTATTGCCGATTCTTCCAAAAATGACAG
AAGCAGTCGACCAAAACATAAAATGGTTGCTATGGAGATAAAACCGACAGCAAAGCCACT
ATTTTGGGGAAATTATTTTATTTTTTCATTAGATTTGTCACATAGAAGCAGAAGGGGGGG
AGCGTAAGGGACGACGGCGCCCGCTACTGATGGCGTTAATGTTACTTTCTAACAGCTGCT
GACCGATTTGTGTTTTTCATTAATCTGAAGCTCTTTAATTTAATTACCCCTCAAAATAAA
CTTTGATGCAATGTTTATTTACAAAAGACATAAAATGGAGAACATGCGATTAAAAATCAA
ATGTTTTAAGCAGTGGAAGTGATAAGAATCTTAACACCAGATCCAGTTTTAGTGAAGCAG
TGTTGATGTAAACGGTCAGATTTTGTTTGTAATTTAGTCTCTAAATCTCGTTTCCAGAAT
CCCCTCCAGGTCTTGGTCAACGCCATCATCAACAGTGGACCCCGTGAGGACTCCACCCGT
ATCGGTCGCGCCGGTACGGTCAGGAGGCAGGCCGTGGATGTGTCCCCCCTCCGGAGGGTC
AACCAGGTGCCGTTCTCATTTTCACCTACTTACATTAAGATTCAAGGAAATCCTAAATTT
GAAAAAAAAAGCGAGGCTAGAGTCACACCTGAATATGAACCGTTGTCTCGGTGTGCTATA
GCACTCGTAGAGGAAACATCTGAGTTTATTCATTGGCTGTAGTCTCCCCCGTGACCCAGC
CAATCACCGACTCTGAAACACAACAGCCCCTCCCTCTTGGTTTAGAGGGACCATGCTGAA
CTTTTTCTGCTCTGTAGGCCATCTGGCTGCTGTGCACCGGAGCCAGAGAAGCTGCGTTCA
GGAACATCAAGACCATCGCCGAGTGTCTGGCTGATGAGCTGATCAACGCAGCCAAGGTGA
GGAGATCCTGAGCTCACTTACTGGAAAAATCAGTCTTGAAACTATAAATTAATGTATTTT
TCCTCCGTTCTTCAGGGTTCTTCAAACTCCTACGCAATCAAGAAGAAAGACGAGTTGGAG
AGAGTCGCCAAGTCCAACCGTTAAACATGTTTGCTTTCTAACAGAATAAATGTGAAGAAA
TTCCCTATGACTTGGTTTTATTACAGATCTGTTACAACTTTGGGGCAAAGAGGTTACAAG
TAGGTCAAGTTTTAGGATCAGTTTAAGGGTAGATCATGATTTCAGCGGAGACCAACGAAA
GTGGATTTGATCCCAACATTTCAAGTGGTTTTAATCTGTGCAGATGTTTTCTGCATCCAG
TACAAAATATTTAACTGCAACCTTTATTTCTAATAGTGATGCTAAACTGCAGTTTTAGTG
GTAAAATCCTTTACAGCGGTCATGTGAACAAAGTGGCGAGCTTGAATCTTTACGATCGGC
CGGCATTTGTGTCAAACGATGAGTGAAAACGGAGCTGGATGAGGATTTAGAAGTAGGTGT
GCTTTCTGTTGATGAGGAGGCACAGCGAGGACAGAGACGCTCCGAGTTTGGACGCCTCGC
TGCACGCCGTTGGCAGGAGGCTGTAATCTGGCAGCTTCTGGAAGGCCTGCAGAGGAGAGA
CGTCCAGTTTACCGAGAAGAGGATGTGATGTTTGGCAGTAGTGGGGTTTTCACAATAAAA
CACATTAAAATATCTATTGATCTGGTTTCAGAGCGTTTACACTTTTCATTATCATTTTTA
GAAAAAACTCTTTCTAGGACAGTTTCTGCAAAGCAGCAGGAATTCACCTCTGAATTGCGG
GCGGGACCATGGCAAGAGGCATACCCCACCCCCCCTTCCCAACATCTATCTTTACAAGCT
CTCCTGCTAGCTTACAGCCCCTGTAAAGTGCAGCAAAAATGGCGAGCAATACTGGATCTA
TCCAGCCGTACAGTTTAGATCCAGATTCCCGCCAAAACGATGAAAATAAAGACGCTCGAT
GGACGCATCAGAATGGAGGCGGAGCGGGGAGCTCATACATACCATCTTTTTTCAAACAAT
TTTTTTCGTCTGCTCCTTTACAATAATTTGAATAAAGAAGTACTGTTTTGATCCTAATTT
GCTTCACACATCAGAAAAATGCCCCAAGAACATGTTAAAAACGGTCCATTGGATAAGGTT
CTTTAAAGTGCTGCAGTCTGGACTTTCCAGTTCAGCAAACTGCAACAGTGAAATCAGATC
GTCAACATTTCCCTCTAATCCAGTCCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1032, 1693..1796, 2028..2237, 2937..3065, 3317..3415, 3495..3708
1032..1032, 1693..1796, 2028..2237, 2937..3065, 3317..3415, 3495..3560
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved