Oryzias_latipes Locus RPL7A
snOPY snoRNA Orthological Gene Database
Oryzias_latipes RPL7A
Oryzias_latipes
RPL7A
12
SNORD24, SNORD24, SNORD36, SNORD36
2092..2164, 2463..2534, 2807..2879, 3076..3152
4814
AAGCCTTCGCCAGAAAGCTGTATGTTTCTATGAAAGTTGTAAAAACTTGAATGTTTTTA
TGTAAAATGCATGTAATAAGTATGCTCCCCTGGCCTATTTGAAGTTTATTTTGTAAAAAT
GTGCTTTGTACTATACTTCTGTTTTGCACAAAAAATTAAAAAAAAAAAGATATGACTTAT
TTTATTTTTTATTTAATGTACACTTCAAGGACACTAATATAGAAATCTATATTATAGATT
ATATTTTAAAAAACAGGATTTATTTTCAAAATAAATGAAATGAATGAAACTTGTCACAGC
AGTGAGGTATTGACATTTTTAAAACGTTTTCCACAAGTTTAGGTGTGTCTTGATGGGAAT
GTTTGACCATTCTTCCAGGAATGCATTTGTGACAAAGATGTTGAACGTGAACAGCTGACT
CACTCCATATAATCTCAACCTGACCTCCATCAATTAAAGGTCAGGACTGCCAAGCAAGAT
CTTGGACCTTGCTTTGTGCACTAGCCACAATCTCATTAGAACAGCGAAGGCATCATTATA
TATTTTACACAAAATGAAGAGCAAAAAATTAACCAAAATATCTTGGCATGCTATAGCATG
TCAAATTAATTTCGGTAAAATTAAGGGAGTGAGTCAAGCTGCTGAAAAAGTCACCATGGT
GACACATATATACACTATAATATCCCTTCCACCAAACTTCATTCTTGGTACAATGCAGTA
AAAAAAAAAAAACTACCAACAAATGAAGCTGTTTCACTGCTTAAGCCAGGAAACTAATCC
TTGAAGATTTCGTTAATGTTTTGGCAAAAAACTTGTGTTACCCCGCAAACCTTTAATTAA
AAATGTAATGCCACCGATAACTCTCTGGTGTGGTTTCTAATTGGTACACAAATAAAGGTT
AAAGTAAACAAATGAAAAATCAGATCCTGGATCGAGGCAGCAAACGCAGCATGTTGATGC
TCCAAGCCTCGCGGTATTTCCGTTACCCAGAATCCTTTGGTCCTCCTTTCTGCCTGAACC
AACATGGTGGGTACATACTTGCTTTTTCCGACGAAAACTTATGCCTGATAAATCTCGTTG
CATCTGTGTTTGTATACCTCCTATGTCCTCATCTAATGTCAATTCATAATGTAGTAATCC
TTAATATTCATTCTAGGTGGATATTGAAGCATGATTTGACGTGGATAATGGTTAAAATTG
AGTTTGATTTAGTGAAACGTACCCGGCAGCAGCGCTTAGGCGAAGTAGCTAACGCACGTT
TAAAAAACGACCAGCTCTTTGGACATTTTTCTATTCTAAACATTTTTTGTTTTTAATTTG
CTGTCTCGTTTATTGCTAAACTAATACTGAAGTGTGAAGAACTACTAGGCTGTTGTTTAT
CAGTTTTGAGTGAATGGACCTTAGCTTCAACATGCTAATTGTACTGTTGTGTCATGACTC
TGGTTGCTTCGTGTCGTACTATTGTCATAATTAATATAGACTGAACGTGGAGATCCGAGT
TTTGTACAGTTATGGGTAATTTAGGGTCCCAATTTTGAGCAGTGCTGCCCAATCCTGGTC
CTCGGGAAACACGGCATGCATGATGAACACACCTGGCTTGAGCAGAGCTTGATAGGTAGA
ATCAAACGTCTTAACTTAAGGAGAGTAACATGGAAAACTTGCAGGACAGTTTTTCCAGAA
GACCAGGGTTGGGAACCACTGGTTGACATGTCTTTGCATTGACCTCATTGTCGAATCAGG
ATTGAAATACAGACTAACAACTGTGTTGCTTTTTTAAATGGCATGATCTGTTAAATTACT
TTTTGGTTAAGTTACTTGACTGTTTCAACGGGTGCAGCTTGTATTGAAGAGAATTTCACA
AAATTAAATTGATGTCTTTTATTCCAACTTGGTAATGAACTTGATTAACGTTGAACAATG
TTCTTTTCAGCCCAAGGGAAAGAAGGCTAAGGGGAAGAAGGTGGCACCTGCCCCTTCCGT
GGCCAAAAAACATGAGGCCAAGAAAGTCGTCAACCCCCTGTTTGAGAAGAGGCCCAAAAA
CTTTGGCATTGGTACGTATCCACTGCTCCTGGTATGGGAGAAACGGTTCTGATGCAGATG
ATGTGACTGAATATTTGCTAACTTGATATTAATGATGACGACCTTCCACCAAGATCGCTG
ATGCATTTTTAAAAGTTCAATTCTAATGGGTTTGTGTGTTTATTGCTCTTCTTATTCTTG
GGTTTTGTCGTCCACAGGCCAGGATATTCAGCCGAAGCGTGATTTGACCCGCTTTGTTAA
ATGGCCTCGTTATGTGCGCCTGCAGAGGCAGCGCTCCATCCTCTACAAGCGTCTTAAGGT
TCCTCCTGCAATCAACCAGTTCACTCAGGCTCTGGACCGCCAGACAGGTAACACTTTGTA
ATGATCTTTGGTAAAGTGTCACTATTGGGTGATATTTTCCCTTTGACAATAAAGTTTTTA
CTTTGCAAGTGATGTAAACGAATATTTGCTATCTGATGATAATGCTGACGCATTTCCACC
AAGATCGCTGATGCAGTTTCCTTGTAGCAACAAGTAGTGCTTAATACGTTGGTCAGACTT
GTAATGTAAAGTTTATTTTTAGCCACTCAGCTCTTCAAGTTGGCACACAAGTACCGGCCA
GAGACCAAGCAGGAGAAGAAGCAGAGGCTGCTGGCTCGTGCTGAACAGAAGGCTGCTGGG
AAAGGAGACACGCCCACCAAGAGGCCTCCTGTTCTCCGTGCAGGTAAAATTCAGAGAAAA
TGTGCCAAATAGTTCATAAAAAAATCAGTTTTGATGTTTTGGCTGTTATGCAATGATGTT
CAGAATTTCTTCACCTGAAACTTTCTATGATGGTTTTTGAGCTTTTTAACCCTGAGCATT
GGCCATTATCCATAGTGAATGAATGGACGGTTTGTTTTCATGGAACAGGTAAATGTCATG
ATTCCCTTTTGTTTCCAGGTGTAAACACTGTCACAACTCTGGTGGAGAGCAAGAAGGCTC
AGCTGGTTGTCATCGCCCACGATGTTGATCCAATTGAGGTGAGATTAGTGTCAGGTTTTT
GTCGCGCTGCGGTCGCTGGCAATGATGTCTGAATTTCTTCACCTGAATCCTCCGTGTGGA
TCCAAACATACGAGCTTTTTAACCCTGAGCAGCGACCATCAGTTCTAAAAATTGACTGAA
CCTTACAGCCACTGATGTGGATATTTGTAACATATTGTCACTTTTCGGATGTTCTGCTTC
AGCTGGTCGTGTTCTTGCCTGCTCTCTGCCGCAAGATGGGTGTCCCATATTGTATCGTCA
AGGGCAAGGCCAGACTGGGCCGACTGGTGCACAGAAAGACGTGCACTTCTGTGGCTTTCA
CACAAGTTAACCCGTAAGTATCAGCAAAAGCTAAACTTTTATCTCGGGGCACAACCCTAA
CCTTTAGGTTTTGAAATGCTTGTCTAGAATGTGTATAAAAAGTTGTTTTTACATGTAAAT
AATGCAAAAACACTGCATGTTGGAGCTGCATTAACATTTGTTCTCGTCACAGTGAGGATA
AAGGGGCACTTGCTAAACTCGTGGAAGCCATCAAAACCAACTACAATGACAGATTTGAGG
AGGTGAGGTCCAAATCTGTTATTTACAGCATCTGCATCATATTTTTCCCTTAACCTCCTG
AAATTCTTTTTTCTTAGATCCGTCGTCATTGGGGAGGCAATCTCATGGGTCCCAAATCCA
CAGCCCGCATTGCTAAGTTGGAGAAGGCTAAGGCCAAGGAACTGGCTACCAAGCTTGGTT
AATATGTTTGGAATAAAAAATCTATGTCCTAATTTAAGACTCTGCTTTGGTCATTTAATC
CTCAGTTGTTGGTTCTGTTACTAAAATACCAAGATTCTTTCTTTCTGCCTTCAGCAAAGG
TTGGGGTTGTCACATGACAACTTGAGGTAAATAGATATAAAGAAATTAGTATTTATACAA
AATTGATACACAGTTCTTACAAAAGTTTATTTCTAATTAGAATTCAGACATAGCTGTTAG
AATACCAGCTACTTTTATGATCTGCAGCAATATTAAGAACCTTTAGGACACATTTAAGGT
CTAACTAGTCCTGGTTAGAGGAATTCATGTCAACTGAAAAACTAAACTCACCTGTGTTCT
CCAATACAGTTTTATTGAGTGATTACAATCTTATTTTTACAAGATCAAAGTTTAATCTTC
TTGATGAACTTTATGTACCACATGTAGGTAGTAGCTGCACACAAGCCATACCTGAAAAAC
ATGGAACTATTAGTGATCGTTTTACATTCATACATGTTTAACATAACATTCCCCACCTAC
CATGTTATGATGTACTGCATGTGTTCATTCCTTAGTGTGACTCTGGTCTGTCCTCCAACT
GGACCTCCAGGAATCGTGCTCCCTGCACGATGAAGAAAAAATGTCTTCAAATATCAGTAA
ATGGCGTAAACTTCAACAGCGCTTTTCTAACTTTCTTTAAGGCCACAGTCCCATTCACAC
ACTGAGGGCGGCTCTAATGCATGACACCGGTGCCAGCCTTTAACCACAAGAGCAATGTGG
GGCTCTGTGTTTTGCCCAAGGTCATGTCAACACAGGGGTGGGCAAGGCAGGAACCAAACT
TCAGGTCAACCGCTCTAGCCCTGTTACAGTACTCTCACATCTACTGATTTTAAAATGGTG
GGATGAAAACACCAGATTAGTTACCAAAGTCTGCATCGATTAAGATGGGAGCGGCTCCAG
TGACGTGGCTCATGGCTTCCAGGTCCCGGTAATGCCAGCGGTTTCTTTCCACGTCATTGT
TTGGTACGAACGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1930..2050, 2237..2386, 2602..2742, 2958..3037, 3242..3372, 3532..3601, 3677..3814
1023..1025, 1930..2050, 2237..2386, 2602..2742, 2958..3037, 3242..3372, 3532..3601, 3677..3778
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved