Oryzias_latipes Locus Mono:0:SNORD99
snOPY snoRNA Orthological Gene Database
Oryzias_latipes Mono:0:SNORD99
Oryzias_latipes
Mono:0:SNORD99
11
SNORD99
1001..1079
2079
AAACTCAACGATGTGACCTAAATTTGTTGCACAAGAGCTTGGTTCTTGCAGTGAAGCAG
CTCTGTTCTCTAACGTTGCTGATGAAATTGATGTGATCTGTCTCCTCAGCATCATCTGTG
GTGGCCGGCCTTGCCCAGCCTCTGCCGTTGAGCACTCGTGCAGGTCTGTTCCAGTCTGTT
TAGAACCGCAGGCTTCATCGAAGCCCTTCATGCTTGTCTGTAGCATCGGGTGGTCATAAG
AAGCTGAGAGAAACCTTTCACCGACGGTCGCTGTTCAGTTTGAATGTAGCTGCTGCAGCA
ACATTAAGGGAAAGGACATTTTGAAATCACTACACTATATAATAAAGCAGTGGTGTCTTT
GCCTGCATGTTTAGTTTTACTACAATGAGTATTTTTTTATTTTTTGGTTGTAAAACAATT
TCCTTCATATATGAACTCCTGGTCTTCTGCAGGTTTTGGATGATGCAGTAGACTGCAGAA
ATGAAAGCGCTACCTACAGGTAAACACTAGAACTGCAACAGAGGTTGAACTTTTGGCTGT
GATGACAAACTTGCCCTCACTGAAAATAGTTCTGATTGAGACTTTTCTTTCTGAGCCAAA
GTTCTGCTTCATTAGAACTCCACGCTTGACACTCTGCTCATCACTAACCAGTCTGTCCTC
TCTAGGTGATGGACTGAGCCACTTTGATGCTGCAGGAGCCTGAAGGTAACTTTAGTTTCA
GGGTTTGAGCGAACACAATGGCATGCTATCCTAAGGACCTGTGCTCACTTGTAGCTTGTG
GTTCTCCAAGTGCATGCCAGAAAAGTGGGCGGTCTTTGATTGTGGCGGCCTGTGCATGCC
GCCAGCAGCCACTCAGCTGCCCGACAATGCTGTGCTGAAGCTGCAGTCTAACAGTTTCTT
CTTCCAGGAGGAATCCGGCTCCAGAGGTCCAGGCGGATGCTGCACAGATGCAGGTGTTGA
GGATCTTTCGAAGGTGTGTTGTGATTTTGATGAACAGTGTTTCTGATCCATGATGACTTC
CAAACACATGTGGACTGTTGGATGAAGCATGCGGATATGGGACTGAGATCAGACTTTAGC
AAACATTCTCAGGCTCTATTAGAAATGGTGTGTAATCTATGTTGGTTTCAGGTCCTGCCT
CCAGCCCAAGGGTGAGGTGGAGATGCAAACTACCAGAATCTCATCCTAAAAGCCTCTAAT
GGTTTGGTTCTATCAGCTTGAATGCCTGTATGAGGCAGTCTGTGAAGGGTTTAAATTCCA
GACATCCACCCCTGCTCCAATGTTTTATAAACTTGTTTGTAATAAACAACAAACTCAGAA
TGTGTGAAACCTGGTTTTTATTGAATTATTCTACAAACATGCTTAAAACAAAAGGTCACA
CAAGGCCACATGAGAAGAGCTGCTGCCTCCTGCAAGGAACTTCCTGTCTTCATGCAGAAT
CTGTTCCTATAGACGGCAACTTCAGCTCTGAGATTTCAGAGTCTGGCGTGCTGCTGCCAC
TGCGATCGCTATACGTATCCCTGCGGAAGAGACAAATGTCCAAACCTTCATCTGCAGAGC
TTCAGTGTGAATCTTACTGGGCTTACCGAGGAGAGAGCCGACAGCCCTTGAGCAAATAAG
ACTGTAGCTTTCCTGCTGCTGCTAGCAGTAGGCCCAGGTAAGGAGGCGATGGGTTGATGG
GACGGGACGTGAACTCTGGGTGATACTGCACCCCCACAAAATACGGGTGATCTGGAAACG
ACAAATACTTGACCAAGTGATCCACAACTCACATGAAGCCAACTGTTCAAGGCTGAACTA
TGACTTTTCCCCCTCCATTTCAGTGTTCTATTCAGAGCCTGGATCGGTTCATGATTCTTT
CAATCCACTCATTTCAATTTTGAACAGTTTTCGTCTTTAGACATTTCTATAAAAGTAATC
TATACATGTATTGAAGATATTTCACATCCTGTAAAAATAGGGAAACTTCAAAAAATAAGG
TGCAGATTACTGTTCTGCAGCAGTAGTTTTTCAGAAATTTGCCTCCGAGTTGTGGATGGG
ATTGCATCACACCTTTGTTCACACTATCTCCCGCTAGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved