Oryzias_latipes Locus Poly:6:SNORD31
snOPY snoRNA Orthological Gene Database
Oryzias_latipes Poly:6:SNORD31
Oryzias_latipes
Poly:6:SNORD31
18
SNORD30, SNORD22, SNORD31, SNORD31
1001..1069, 1229..1353, 1539..1610, 2131..2203
3203
ATCTCTTCCTCAAAGGGACCTGAACATTAAATGTAAGTCTTTTAAAAGGAATTGGCACG
TCTTTTTAACTGCTGTGCAAATATGATGATTAAAATATTTGACAAGCATATGCCTGATCA
TAGTGATGTCATCCTTAAATCTGACTACCTCAACATTAGTTCAAGTTGTGTTTTAAGATG
TTGCCCTGTATTAGAAGTTTCCTTTGTATCTTTTAGGTTGAAGATTTCCATGAAGCTGAC
ATGTCTACCAGCAACATATCATGTGAGTTTATTTTAAATTTGACATTTAAAAGTTTTTTA
AAGGTGTCTTTAAGGTTTGAAAGGATGAAATGGGTAAAACCCATCAAACATTTGGACGAC
TTTGTGTCCCATGGCAATTTGTCACCAAAGCCCTGATCAAACGGGAAACCTTCAACCGCA
GCAGAAACGGCCTGGTTTGATCTAATGTGTGTGTCTTTTGCAGGACGACTGGGTCTGAAG
TATTAAGTTGAGGTAATTTTTTTTTTCTCTTTAATTTCTAAAACACAAGGGGGTCAGGTG
TGCATTTAAAGCAGTTTCAGTGATGATTAAACTTAGCTCACTTTGATCCCATGTGAAACG
ACACAAACATCTGAGCAACTGCATCAGCTAGAACGTCTCGCTGCTTCAAATTGTATGACA
GGAAAAAAAACCTTTTGCTTCATTGATTCCTTTTGTTCTTTGCAGATGCTTCAGCTGATT
CCAGCTCAAACAGATGCGATGCAGATGAGGTTAGACTTGACAATCTCTAAAATGTTAGTG
TTGGTCTAAATATAGGACTTCCACCTCCGAACATGCAGAGAAGCTTCTGTTGGGGTAGCA
GAGTTCAGCTCTTGTCCTTGTTGGAGGACCTTGTTATCCCCTCGACACTAGAATCTATTT
CAAATGTGGAAAAAATAAATCATCAAAGCTTCTTGTAGTTAAAGTTCTCAAACATTTCTT
ATATTTAGACCAACACAGTTGCTGCTGATTTTCAGCCTTCTGGAAATGATGAGATAATTT
GGAATCTCGTTCGTCTGAACTGCTGTTGAGAACTTTAATTTCTGATACCGTGAAGTTATC
TTCATACGACACAATGCCGCGTGTTGCTGAGCTTGAGGCTAACCATCGTTTGGTTTCAGG
ACCTTCTCTGTTGACGCTCCATCGCCCGCTGGACTGCAAATCCAGGTGAGCTGCTGATCA
GTTTGTGCCCTTTTTGTCTCTGTCCAGTTTATTTATGATGACACTCGCACGCGTCTTACG
CCATGTGTTGACGCCAGACCTGAAAAGGTGAACCCACTGGTGTTGCCATGGCAATAAGGG
GATGACTCGTTGGGGTTACCAACAGTCTGAATGGAAACTTGGACATTTGCGTTCAGCTTC
AGATGGTGTTGGAGTTTAAATCTCGCATGTTTAAACTATTTCCTGTATTTTAGGTGGAGT
TTATCTGATGTGGGGATGGAGCTGCTTTAGGGAGGAACAACTTTGTCGAGCAAGGTTGGT
AGGTTGTTTTATTTTTGAGAGCTTGTGGCCACTGATTCTCAGAAAGGATGAAGTTTACTT
ATACCGCCCCAGTCTGAAAGTTCATGACTGATTGGTATCCCCTCTGATCTGCATTGTTAA
TTAAAGAGAACCTCTAAAAAAGCTTGCTGCCTTCTCATGCTGCTGTCGTGTTGACTCTGC
AGGTCAATAACACCAGGACATCTTTATCTGTCAGCTGACTACAGTTCAAGGCGACGTCAC
ACTCCTGAAGCATTGACGGGTAAATAAAATGCCAGCCAAGTTTCTGGGATTGTGAAGATG
ATGTGCTCTGGTGTGCAGTTGGAAGGTTCAGGCCTTTGCTTCAAGGCAGCGTCCCTCTCC
TGTTGACCCAGTCTGGCACCGAGAACCCTCCCCCCAGGTGTAAGGTGGTCTGCTGGGCTC
TGATGGAGAGGGAGGTCACACTTGAAATAACTGAAGATGAAAATCTGATCACAGCCCAGA
AACTATAAAGGCTCAAATTGTTTTTCTGTTTTTTGTTTTTTAATTCAGTAATGAGTGAAA
GGTCTTTGTCTTCAACAGGAGAAGCTTCTGTTCAACCAACTCCACGATGGTGAGTTTCTG
TTGACCCTGGAGAGATTTCTGGAGATGTTTGCAGACGTGATGAGTTCCTATTACCGCCCC
AGTCTGAGAATTCATGACTGATTGGTTAACCCCTCTGATCTTTGTAGGGAAATGAACTGT
TTAAAATGTAAACGAATGATAAACACAAATGGCTGAATTTGTTATTTGTCTTTTTAGGCT
GGATGGTCTGTGGTGCCTTTTTGAAGAATGAAGTTTTGTTTTTTAAACTTTGAACATTTA
ATAAAAAAATGTGTGCAACTTGACATGACTTGTCAAAATTTGTGAACATTAACCAGGTTT
TTCTGTTGGTAAACATACAACTTAATCTGATAAGAACTAAATATAACAAAACAAATGACA
CAACTGGAATGGGATTTTAGTAAGGAGAAATTTCAAATGGTGAAGCATGACTGGAAAGTA
TTTGGGATGACCTCAGAGCAAGCAGAGACCCCCCCTCACCCCGACACTGGCGGTCAAGGC
TGGACTGAATCAGAGCCAGAACTGGGAGGGCTGGCGAAAGGTCGGTTGTGGTGAGTGTCT
ATGTGGCAGTATGACCACAAAGGATTGCACTCGGTTGGACAAACTGATTAAGAGGTGCAT
CTGTGATCGGGAGGAGGGCTTGGACTCTGGGATCTGTGCTGCAGAAGAGGATGATGGCCT
TGACTCAGAGCATCCTGGACAATCCCAGACACCCCTTGCACAACACTGTCTGGTCAGAGG
AGCGCAGAGTAATGGGCTCCTTTCACTGCACTGCATGATGGAGTACTTTAAGAACTAATT
TGTCCCTACAGCTATCAGGCTGTTTAATGAACTGATTCTGTGAACTTTTTTACTGGTGTG
TGTGGTTTGCTACTGGACACCTGAATTTCTCCTTTGGGAGATTAAAGTTTCTGTCTGGAA
TGTGGATAAAATACCAACTTAAAAGGGGGAATTTGGCTGAAAGTAAAGCATGTTAGCTAT
GATGTACCTGCAGATGAGGTAGATCTCCTTCACCTTTACCATCTATGCATTCCAAGCAAA
CATTAAAATTAATCCTAATGTGATGTATGCCAATCTGAATAGGTTTCCTAGGCCATCTTG
GATGGGTTACATTTTATAGGCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved