Oryzias_latipes Locus Poly:1:SNORD49
snOPY snoRNA Orthological Gene Database
Oryzias_latipes Poly:1:SNORD49
Oryzias_latipes
Poly:1:SNORD49
14
SNORD49, SNORD65, SNORD49, SNORD65
1001..1072, 1382..1448, 1766..1838, 2018..2091
3091
AAGCTAGCTGAAGCTTACCTTGGTAATGGTGGATAAACTCTTCGTGGACGAATTTATAT
CCCTTGTCCAATTTGTTTCCTTTAGTGGACGAATGCATCTTCACACTATTCATCACATCG
GTGCTGGTGAACTTCGGAACACAACTCGGGCTCTTCGAAAACACTCTAGGCTCTGCCATT
CCTCCGCAAGCGAAGCACAAACCGGAACTAGGTTTACACGTTGATGACGTACTTCCGGTT
TTTGCGAAAAAGGTCTATGAGGCGCCAAATTTACTTGAAAAGTTGTGACGTAGAATGTCC
GCGCCGCTCCAGTTTAAGTAGGCTCTCACGCTGCAAGTCAACCTCTCTGTGGCGCTCCTG
CCTGCTGAGCCGGACGTAGGTAGACAGTTGCTCTTTTATTTTGTGGCGGCGTTCTTCCCA
AGCAAATTAGAAATGTATTTTAGTTTCCCTGAAACAGTTTTGAAAGTTTAGGTTTTATTT
TTAGACCATTTCTGTTAATTCCGAAGTTGTGCTTGAAATGTGGTCTGTCGCAGGCCTAAG
AGTAAGACAGCCACGTGGAGAAGCTAGCAGCTGTTTTCTCTGAGTTTATCGCATCTTTTG
CGTATTTGATTTTTTTCTCTCCACTGTATACTAATTTTAAATGTAACAGAATTATAAAAC
ATTTTAGCAATGCTCTTCAGTTTATTGCTTTTTTTGGGGTCAGGTTTAATTTAGCGGCTA
ATGCTAATGCGTAACCTGATGTCTTCTTCGTCATTCCTCTAGTTATTCATTGCTGTATAA
CGCATTTTTGTGCCAGTAAAATAAATGTTAAATCCGGTCTTTCTGTTGGATAAGTTTGTG
TGTGTATAAATAAAATCTTTAGTGCTAATTGTGCCTTTCTTCTCAGGTTTTCGATTGAAA
ATCAGAAATGAGTTTAGCAAACTTCAACCTGCTGTCCTGGAGGCTTCACGCATTTCGTGC
AGGTACTTCACTCCATCATGTTTTCCTTAATGTTTTAAATTGTCTGTGATGAAAATTGTG
AATAGGAAGTGCCGTCTGATGCGATAACTGACGATGTTTCTTGATCACAGTTCTGAGCCT
GAACGTGACTGACTACTAGTTTAAACCACCAATCTTCATTTGTTCATCATGTGAATTTTA
TAGTCTTTGTGTTTTCCAGGGAACATGAAGAACACAAACTCGAGGAAATCGAAGGTTAAA
ATTAAAGTAAGATGTGTAACTGTAATCGAGAAATTTGCATGATTGTAAAGTTGAAGTATC
TGTCAGATTAAAGTATTTCTTTTCATGCTTGTTTTCCTCAGTGATGAACAAACTCCGGAT
TGTCTGTCTGAAGGTAAATATGCATCAATTCATGCTTAAAACTGTCCGCCTCTGTTGTGA
TGAAACATAAACTGAAATAGCTGGAATTACCGTCAGATTGTTCAGTGGTGATCATAAGGT
TTTCTGAACACTAAATGGGCAGGAACATTTTTTATTAGTTAAGCTCTGTTTGGTCTCATT
GTACTTTTGTTTTTTTGTAGGTGTTGGACAGGTTGATGTTCAAAAATGTACTTTAAGGAT
ACAGATGCTTTAAGTTGCCTCTGGTAAGTTGATCTAAAATGTCTGAACTCACTGATAAAA
CAAGTTTTTAAAAAAATATTGCATAAATGAAAACATTTAAAACCAAAGGCCTTTTTATTC
TGCATTTGTTTATTTGTGTGATCGTTAAAAGATCTTAAAATGTGGATTGTTAGCCACAAT
GGTGACATTGTTGTGACGTAGGGATTTTCAATGATGAAAACCTGGAATAGGAAGTGCCGT
CAGATGCGATAACTGACGAAAATTTCTAATCCGCTTTTCTGAGAATTACTATATAATCAC
AACTATTGTGTTTAGGTTTGTTTTCTATTGTTCCCTCGTTTATTTTTTATTTTTTTCTTG
AAACAGGTTCCCTGCAGATCTCGCCGTTCCTTGTAACGCTTCTGGATGAAGATGAGAGGT
AAACACCTGGCTTATCTTCTCGTTTCTGTGAAGAATTGTAGTGATGAAACTAAACTGAAA
ATAGCTGGAATTACCGGCAGATTGTTCAGTGGTGACTCTCGGTTTTCTGAATAATTAAGT
TAGTGTTAATACTTGTAAATGTGAATTTATTTATTTTTATGTTTAGTATACCTCTTTTCT
ATTTTAGTATCAGGCAGTAAAAGGGAAACCTGCATCGTTACGCCACATCATTCTGTTCAA
TCTGGTAAGATTTGTACATTTTGCCTTTCCGGTCATGGCCTGGGGACCACAGAAAAAAAC
TAGCCTTTGGCTAATTCTGGCTTAAGTTTGATTTAAAATTTTTTTTTAATTGCATTGTCC
CTTTTTTAAATAAACTTGTAACACAGAGGCACTTTTACATTTCTGCTTTAATAGCTTCAT
GATTTGTCTTATTTGGTAACTGAATGTTTTGTTTTTCTTTAGATGGAGACCTAAAGCAAC
GGCCGTCTGACATGTTTTGAAGTTCTAGCTTGGTTTTCTTTAAACCTTTTGTTTCAGAGC
TTCCCCTCCAATTAACATTTATATAATCAACAGAACTTTAATGTATGTAGAAAATCAATG
GTTTCTGTTGTAAAAAAATTTCACATGTAAAAGTCATATTGCAACTGTTGAGGTAAACAG
AAATACTCTCATATTCAGTCCTAGTTTGCACTTATTTCATTGCTTTGATTTAATTACTTG
ACCAAAACAACACTTGCTAATTACTACACTAAGTGACATTAATAAATGCTGGTCTTTCTG
TTTTTTATTAAAGTGTTTTGATGTTATTTAGTCTGACCTTGTTTTATTTTTGTCCTGTTT
TAGACCAGCTAATGTTGTATTACTACATGAACTAATCTGCTGTTAAGATAAATTAATAAA
ATTGTGATTTTGAAATTCTAAAAATAAACATGAAAATCATGATGTGAATGTTTATTTTAA
TAAATGGTTCTGAGATTTGCTGTGAAATTCGTAACTTAACTGAAATTAAGCCAGTAAACT
TTTATTTTAGTCACAGCTTTTTTTCTTAAACATTTCTTTATCTAAACACATGGGGTAAAT
GTTTAAAATGGTGGGATTTTTAAATGCAGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved