Oryzias_latipes Locus Poly:0:SNORD47
snOPY snoRNA Orthological Gene Database
Oryzias_latipes Poly:0:SNORD47
Oryzias_latipes
Poly:0:SNORD47
4
SNORD75, SNORD47
1001..1070, 2729..2804
3804
TAAAATAATGTTGCATTTAAGGAGAGGAATGTCACGTTGAGATTGCCTTATTAAAACGT
ACTTTGTCTTAAGTAATGAAGAAAAAATAGATGTGCCCCAACTTTTATTCTTTAACTTAC
AAAAGTTATATTGATCATTAAAGTTCAATTTTTTTAAGAAAATAAAATAATTTATTATTG
TTGTACTTGTTTAAAACAGCTGGTTTAAAAGTCAGGCTTGTTTTTTTTTGATCAAATTTT
GTCAGTTGTCATTCATCAGTTGACCGGCAGGGGCGGAATTCCAGGATCTACTTTTTTCCC
ATCAGCCTTTGCGACAGCGTATATAAGAAAGTCCAGCAGCGTTTGCTCTCTCTCATTCTT
CGCCTCGCTTCATGTGGTGATAAGGTGTGTATAGTTTGTCTGTTTTTTTTTCTCACCCCC
TATTTTTTTTTTGCCTTTAAGTTTTTCTAGATGCTTCTAAATTAGTGTTTCTTATTTCCA
TAATGAGCCAAATTGTGAACTTTTGTCATGTTTTGCCGGAGTTTACAGAGACAGGCCTTA
AGCACGTGGAATAGCTAACTAACTTGCTAGCTAACCCGCTAATTTATTCCCACCTTAACG
GTTTTCTATCCCGTGTTTTATGATGAATAAGTGTTGGTAGGGACATCTGAGTCATTGTGA
AGTAACGCCAACATTTCTGACATGGGATGAAAGACTAAACCCCACTATTTGTGCACGTTT
GAGCGGGATGCATGCTAACTTTAATCTTGTAAATTATAGGGTACTGTTGAAGCTGGAAAT
GATGGAAACCCCTGGTTGTGGCTGGTAAGTTAGTTTTTTTTCTTTTCTTTTTCTAAAAAA
AAAGAATAAGAACTTTAAAGTTGGAACTTGTGAAATGTTAAACTGCTGGGTGTGTTTCGC
CTTAGGACCAGAATGCAGGCCTTGCTGCGGCCCTGTCCATCCATGTGCAGGTATGTATGG
TCTGTCCTCCATGTAGGGTTTCTGTCTCTCACACGTGGAGAAGTCAGTGATGATTAATGT
GTAAGAGTAGTGGACAGGAGTGATTTCTGACAAACTATATACACTGATGCTTCTAACCTT
CAAATAAGCTCCTTTGCCATAAATGGAACTGCATCAAACTAATAGAATTATCTGCATCCA
CAGATTTATAAGAAGAATACAGACGCCTGGTTAACCTTTTCAAAGGTAAAGTGTAGCTTT
GCTCCATCTGTGATTAGATTTGAGCTTTTGCTTCTTTGAAGGGTTTCCCATCAGGCTTTG
CGCTGAATGTTAACCTCCTGAATTACGGTGACACTTCAGAGAAGCATAAATCTGTTGTGG
AGATGATGCCGTGATGACAATTATTTGCTACTCTCGACTAGATGGATGACGATAATAACA
CCACCATGTTAACATTTCTGAGGCACCAATCATTACAGATCTCTACTGTGCACTTGGACG
CTTCTTTGTATTTATAAATGCATCTCCCTCTTGTGTTTAGGCCTCATTGAAGCGGCTCCA
ATGACTAAAAAGGTAATAAGCAGATTATAAAGCGTTTGAACGTTGACTCAACTGTTGATG
ATGATTTTGTTGTGAAACAATGGGAATCTCTCTGAGAAAAGTGAAGAGGACTTTTGTTCT
GATGCAGTGCAAACTGAATAGCATGTGTCTGGATTTCTGTCTGCGCTGTAACGGGATGAT
TTCTGTCGCAGGTGGCAGTGAGGCTCCACCCCAGCACACACCTGGTTCCGGTTCTGCAGG
TGAGGTCTTCCTTGACTCGCAGAACTTGGACTTGTTCAGATGCAGTGATGAGTGCATAGT
TCAGCAGATAAGCAATGAAGAACAATCATGTCTTTCGCTCCTAACTGATGCATCCACCTC
AAAACTGACGCCATCTTAATGCATCTTGCATTTTGTAAAATTTATATTTTTTTTATTTTA
TTTCAGAATCTCATGAAGCCCACGTAGAGGTGAGTCTGAATGAATTTATAGGTTTTATTG
TGTCTGACACAGTGATGACAGCATAGTTCAGCAGATTACACCGTGAAGAACACAACTTGT
CTTTCGCTCCTAGCTGACGTGTCAGTTTAAGTTTTCGTCTCCGTCTTCAACGCTTTATCC
TTTTTTTTTATTAACGCCTGCTTCGTGTCATTCCAGGCAGGAAGGAGACTCGTCTGGCGG
CTCTCCAGGTAAGAGCTGCGATGGGGTCGCTCAGCAGTGACGTCATTTCAGACAGGATGA
GTGTGAATCAGGTCTCTGATCCAGTTGAGGATATGAACAGAATTCTCTGATCTGGATGAG
TTTTCATTTCTAAAGAACCATCACTGGTTTGGTTATAAATTGACGGTTGATTTTTCTCTT
TAGCAGATCCAAAAGATCGTTGAAACGTCCTGTTCAGAACATCGATTATAGTAAGTAGGA
ACTCCTGGATTATGCAGAGGTGCTGTTTATCCTCTAGATCTGTTCTAGTCTCATCTGATG
TGTTAAAGCTGCAGCTTTTAGCTGCTGTTGTACAGCTGACCTGTGTGATGACAAAGTTGA
GACGGATTCTGTCATGAAGGCTCATATTAGCTCTAGCTGACCTGGTCGGTGTGCGTCAGT
GTCTGAGATGCTGCTCAGCACGTTCTGACTTAATGCTGCTGCTTCTCCTTCCAGGATTCA
CCCCCTCTGGAAACGAAGGCGTCCGTATGGGCACAATAAAGTTTACCAACCTGTAAGTTT
TCCATCAAAATATTGTCAATAAAGGTTTCAACCGATGATGAAACGATTCTGCCAAATGAC
TGCTGCTGATTATAACCCTTTACCGTTCCATTTTTGTCTGAGGTTGAGGTGTTGGAACGT
CTGTTTTTTATGGTTGTAGTTTCTGAAGTGACAAAGACTTTGCTCCACAGACGGTGCTGA
ACCTGAGCGGGTCTGGAGAACCGGGCCGACATCCATTTGCTGCTGTGAACGCCTTAAACA
TTATGGAAACTCCACAATTCTGTCTTTTTTTTTTTCTCCTGTTTATTCTTCTGGTGGATA
AAACGTTAATAAACTTTGTATAAGAAAACTTTGTGTTTGGTTTCATTCAGAATAAACTTC
CGGTCTTATGTTGGTGAATGGATGATGTAAATTGGTCACCATGAGGTTTATAGATATTAT
AATCTCCCATGACAGCTAGTTTTCTTAAGAAGTGAGACGTTAACATGGCTTAAAGATGTA
GCTCGATTTTAAGCAACTGTTAATTTTCTGTACGTTTATTGGAAATTACTGCGGCTAATA
TGCCCCGTTCAAGTTTAAAGATGTCAAACCGCTGGTAAACCTCTTATGATAGCCTAGCTT
TAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved