Oryzias_latipes Locus Mono:4:SNORD88
snOPY snoRNA Orthological Gene Database
Oryzias_latipes Mono:4:SNORD88
Oryzias_latipes
Mono:4:SNORD88
8
SNORD88
1001..1091
2091
AAAACACAATTTTAAGCTGTAAAGAGTTTTTATGTCTTAGGTAGACTATTCTAAGGCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTTTTTTTTATACATTTAATTTTTAGGCATGAATTCAGTGTAATGCCAATCAGTGTTGTA
ATACTCCAGTCCACTAGGTGGCGATAACAAATTCAGCACACCTCTGGCAGACGCAGAGTT
TATAAAGCAGAAGAGGTGCATCCGTTTGAAATTCTTGCACAGAGTCAAATCAGCAGAACG
CACCGGTTAGAGTGGTAAGACCTCGATTCATCACCTTTTTGAAGCTTTGTATATTATAAA
TTAATATTTTTATGATTATGTCAGTAATTTACTATGTTAAGTGACGTCACAACAGCGAAT
ATGGATAACGATGTATCTATTATTATGCTTTTACGAAATGTCGCAGTCAGTATAACCCTT
AATCGTTATTTATGAAGATTTACTATAATAGTATTAATATTAAAAAATCATCGTACTTTT
ATACTGACCGGTGATAATACTTGGTATTATTCCTTTACTTGTGGAGGCCTCGTGCCCACG
TGGTGAGGATGCTACAAGCTAGTAGCTAAACACTGCAGTCCAATCTAGCAGCGCCATCAC
GCTTTAGAAGTTTATTTTTCCTTAATTGAGCTTTAATCGGACTTCTCCGCTGATGTTTTA
GCACTGGGCTCTGAGTCTCCATGAAGAGGCTGTGCATCTTCGGCCTGACAAGCCGAGGTT
TCTGAGGAGAACGCTCACACAGCACGTGGGTCCCTGGCATCGGGTCATGATGCTACACTA
AACATGTGTTTCTTTTTCTGTTTGCAGAGTTCTGGTCAAACCAAATCTGGACCCTAACAC
TAACAGGTTTGACATTTAGACTGGTTTTGATCGAAGATGCTGCTGCTGTGAGACTCTTGT
GATGCCTTGCACTGGGCTCAGAGGAATCAGTGATGACACAAGTGCAACTCTGCTACTGAC
ATGGCAGAGTCTGAAGAGACAAACATCATGAAATCTGAATTAGATCATTTTGCTCTTTGA
TCTGACAGGTTTGTGTTTTTCTCCCACAGGTTTCTATCTGCGACCACTAACAAATCAGCC
CGATCAATAAACTTGCCTGCAACTCTACCATGTTCTCTGGTCTCATTTATATACACGGGT
TTCAAACGAAAACTTTTTAAAAAAATAGATAAGAAAGGTTACCTTGTTTCTTGTTGCACA
TAGCAAAGTATATCCATGTTACTTTTGTTAAAAAAATTGCGAAGCTGAGGATGCTTTTTT
AGGCTTTGATTGGAGGTCGAGACATATTTTAAAAAATGTACATTTGAATGGCTATAGATG
CAGGATTTAACTGCTCTTTCTTTAGCCTCAAAAGGATGCCAAATCTTTCCAGAGTCCCAT
TTATAACTGCACTCGCAGAAAAAGTAGGCCAGTGGCCTCTAGGGATGAACCATGAGGAAC
CCACATAGAAAAAAGTGAAATGCTTTACGAGGCTTCCCAACCCTATTTCTGCCTTGCTGT
GTCCTGACTGTGACAGAGCACACCTGTTCTAGATATTTGGCTGCAGGTAAGGCTGAGAAC
CAGACAAGGTGGTAGACTTTGAGCATCAGGATCAACCGGCCATCCATCTTCAGAATCCAC
TAAATCCCCTTTTGGGATCCAACCTAACTACTGTTTGGTAAACCCAGAAGTGGTTGACGG
GACGGTGGCTGCAAAAGTCCAAGTCTGCTCTGCTGAAGATGCCCACACTCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved