Oryzias_latipes Locus Poly:5:SNORD14
snOPY snoRNA Orthological Gene Database
Oryzias_latipes Poly:5:SNORD14
Oryzias_latipes
Poly:5:SNORD14
18
SNORD14, SNORD14, SNORD14, SNORD14
1001..1093, 1323..1415, 1691..1783, 2251..2343
3343
ATGTTTTTTTTTTTTTTTTCCCTAAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCCCTGGGGCCCCCCCTTTTTTTTGGGGGACCAAATTTTCCCTTTTTTGGGGGGGG
GGGGGGGTCCACGTTGGTTGTAGGTCCATGGATAAATAGAACAATCCGTCGCTGCTGTTA
AACCCACTTCACTGCCTGCTGTCTTCTCTCATACAACATGCAGTAATTTCTATTTATAAA
ATACCATACGTGGATTGGGGAAAATGAGCTTCTGACCTGGCCGTGATGGTCCAACTGAGT
GGAAACTCAGACCATACTAAACCCGACCCTGACGCTTGGTGGGACAGTCTTTTATGTTAA
CTCGTCTTCTTTGTCTTTTCAGGGTTTTCCTGCAGCATCTCAGACCAGGTTGGCTGGTTT
CCTGGACCGTCATCTGCCTCGGTGGCTGTGATTCCACTGGAACGCTAAAGAGCTCGGACC
TTCCCTGGATGATGGGACGTTGTCTTCTCCAGAGCTGGATTTCAGTTCAGAGCTCCTGAG
ATGCTGGTGTGACTCAGGAGCCAGAGATGGATCTGCTCCCAGTCTGAGGGGCAAATGAAG
GTACAGAAAAACTGCTGTTGGTGTAGAAACGAGTCATGAAGAGGCTTTAGATGTAGATTA
AACCCTACATGGAGAAGTTTCAAACACAATCTAAAATGAATGTTGACAGAACCAACCAAC
ATGTATGGAACACTGTAGATGTTTCTGTGATGTTCCTCATGTTTGGTGGTGAAGTATGTG
TTTGAATGAGAGAACCTGTTATCTGGTATCCATGTGGATAACACAAATCTCTGCTTCATT
TCAGAGATGACACTAGGTTCTTTTGTTTTTCAGATGGACGTTCTCCCACGATGAACATGG
TGAGTAGGTGCTGGACCAAGTGGGGATTCCTTGGGTTGTGGTCGCAATGATGATGTCATT
TCCTGCCATTCGTAGTTTCCACCAGAGGTCTAACGGCCAAAGATGGTCCAAACCTTCCTT
GGATGTCTGAGCGACAGCAGCTTGTAGCTTCTGCTGCTGGTCTTGGTCTTCGTGTCTGAC
ATTCTGACATCTTTTCCAGGCTTCTGGTTCAGTTTGAAGGAGTCTTTGACGATGGATGGA
CCTGATTTTTGGACCCAGAAACAAAGGTGTGTGTAAAGATTGTTCTCTATCCTGGATGAA
ATTTAGCGGGTGATTGGTTCGACACCTTCAACTGTTATGAAAGCTTAAAGAACTGAAATC
CGTTCGCTGTGATGATGTCATTTCCTGCCATTCGTAGTTTCCACCAGAGGTCTAACGGCC
AAAGACGGTCCAAACCTTCCTTGGATGTCTGAGCGAACTGTAAATTAAAGTCTGGTGTTA
AATCTGGATTAAGCCGTGAAAATAAAGACTGTTTTTGTTTCAGGTGGACTTTCAGAGTCC
AGGAGTCACTCCTGTCTGGGTGGAACGTGACAGATATCCAGGTTGGTGTCTTGACATCTC
TAGTCGCTGCTGCTGTTGTCTTTAAATCTACCAGACATCAGATGGATACATTCCCATGTC
GTGTAAATCTGGATGAAATGATTCAGTGGTTTATCACTGAAGGTTGTTCCTGTAGCAGAT
AAATTATCAGTTCGCTGTGATGATGTCATTTCCTGCCATTCGTAGTTTCCACCAGAGGTC
TAACGACCAAAGACGGTCCAAACCTTCCTTGGATGTCTGAGCGAACTGAAAAGCTTCGTC
CACAGAGCGTGTGATCCGTACTACAACACGCATGTTCTTTTAGCATGTCATGTTCACAGT
CGCTACATGAAACTAGCGCATGTCTGCCACCTACAGTAGGAAAAGGCTTGGTGTGACTCC
AGCGTATGTTGGCTTTGTCTTTCCCAGCTCTGTTCTGATATGAAAGACGTGGTGTGATAG
AATTTGAGCCGTGTAAAGAGCTGTGTAGTTTCCACACAGAAGTGCAGAGTCCGATTGGTC
AAAGTTGGACCTGGTTTAACTTGTGTGTAGAATGAGGGAACTGGTGTAGTACCGCATGGA
CATGATGGTTTGAACGCGGTAGCTCAGAACTCAGATCTTTTTTCTTCTGCAGTCTCAGTG
ACTTCCTGAAATGTCTTCCAGGTGACCTTCAGCTGAAGGACCGGCGGCTCACAGGTGTGT
ACGACCAGAGGGGTCTCTTTATGTTTACCATTCACTGTGATGATGTCATTTCCTGCCATT
CGTAGTTTCCACCTGAGGTCTAACGACCAGAGACGGCCCAAACCTTCCTTGGATGTCTGA
GTGACGTGTGGCGGCGCTTGCCGTCCGTCAGGACTTCCACATGTTTTAACCTGGGTCTTC
TGTCCTTACAGGTGGACTAAGCCCCACCCCTGCTGCTCTGGGAGTGAAGTTCACGTACCA
AATATGTTGTGCAGATTTTGTTCTTTGAGGAACTTGGAATCCAGGTTGTCAATTGTTGTT
TTTAATAAAGATTCTTTCAACAATCTTTTGTCCTTTCTCTACATCAAGGTTCTTAGAGGG
AATAGTGTTAATTGGTTTTGGAACCATTCTGAAATGTGGTTTAATTTTCCTTCAGTCTGT
CATACATGACTAGAACTAAACTTTTGTCTAAACCTCGTCAAAGGTAATGGCATTGATTGA
ACCAAAGTCCTAAGAATTGTCTACACCTACAAAGCTGACTTGATGGCACCTTTAAGTGGT
GACATATAGGACCAAAAAGGCGTGAACGAGCTGTTCAACGTTGACTGGAGTCTGAAGACC
TTAAAGTACAGCAGCACCTCTTTGTCCTATAGAGGCTGGAACAAGTCCAGGTAGAAGGTG
GAGCAGATCTACAGCTCAGTAAAGATCCCCTGACCTAGTGGATGAAAGTCTGCTGCAACA
ACTGCACTAAGATCAAGTGGATCTCATTCCCAGGAGGAATTCAATTACAGTCTCTATCAT
CTTTAATCTTTTGTTGGAATTCCTGGTCTCATTTTGGAGTTTATTGACTATCGCTAGAAC
GGTTTTCTAGACCTGCAGGATAGAAAGTTCAAAAGAATTATAATTCAACAGTTCCTGTTG
AAAGCCATCCCATCATCCACATGCATACAGTTGCCTTACAGCCCCTCACTGACAGTGGAT
GTATCAGGAGCAGGGCGGGGAGCTTGTGGCCCGGTGATCCGATTATGGCTTCTGTGTAAG
GAGTACAGACATTTATCCCATTTTTTTTTTTTTACGGCCCCTTATCAAAAATTTGAAAAA
ATACCCATTTTAAATTGTTTTTATATAAAAAACCCTTNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved