Oryzias_latipes Locus Mono:5:SNORD35
snOPY snoRNA Orthological Gene Database
Oryzias_latipes Mono:5:SNORD35
Oryzias_latipes
Mono:5:SNORD35
8
SNORD35
1001..1083
2083
CTTTTATACTAGATTAGAATTGTGAAAGTTTCCTTAGAAATAAATATTTGACTTAAATT
TTTGTTTTATTGTTGCTGAATATCGATGTTGGTGTTTTAATGCCGTAATATATGTATATA
TATTACGTACGGACGTAAAGTCCCCCCCCCCACCAAATTCAAATTGATTCATTTTAACAT
TTCACTTTTTTTTGTCAAAATATTAATGTTTTTAGGAAACAAAAATAAAATGTATTGACC
CACTGACACCTGAATTTATTTTTCAGCTATGAAAAAAAAACCTTTATATTTAAATCAAGA
GGTCATTTGAAACTTAAACTTTTAAAAAATGCACATATGTAGTTTGTGCTTAAGAAAAAT
AACTTTCTAGAAGTCAATTTCAAAGCATAAATATGCTGCAAATGCCATGAGTAGTTCTGA
GGAAGGTGCCTTTAGCAAACGCTGATGCAGCTGTGCCTCATCCTTTAACTGGACAAATGT
TTGGTTTAGGGCTGTTCTGTTCCTGCATCCTTTAACGTTTAGATGACCGTCTCTCTGCAG
AGACGTCACCGTTGGAGACATCGTGACCGTTGGAGAGTGCCGACCGCTCAGCAAAACTGT
GAGGTTTAACGTCCTCAAAGTGACTAAGGCTGCTGGAGCGAAGAAACAGTTCCAGAAATT
TTAGGTTTGATTTGGAGCAGGACGGCTGCTGGATAACACGACCCTTTCAAATAAAGAAAA
TCCTGTTTGAAATTGTTTTGTGGTGTTTGTCAGTTTCACCAAATCCTGTTGTTCAGAAAG
TTTTGTTTTTCTAATTTGATTAGAGATCATTGGCTGCTCGGTGGAGCATTGGTTGGCGCT
CTTCCCTCACAGCAACAAGGCCGCTGGTTCAAGTTGCTTCACTGTAAAACTTTAATGTGT
TTTTCATTTGAAATTTGGATAGCAACATCAAAACCCCAAGAGAGGTGAGATAAATGAACC
ACACCCTGCTCTAATATAAACTTTGAGATCTGTTTGTAGCCTGCAAATGATGTTTTTCTC
ACGATGGTCTTCCAAGCCTTCGGGTTCTGACGACATCGCCTTTTGGCAAAACTGATGCAG
GAAAATAAAAAGTTTAGTCAATGCTTCAATGTGAAGCCTGCAATAGAACCCTTGATGTAT
GTAATTTTTTTGTGGTGCAGTTCTTGCCTCAGCAATAATTCTGGTTCAAGTTCCGGCTGG
GCACCTGAAACAAAGTCAGTGGGGGGCCTTTCCGTGTGGACTTTGCATGTGTGCACGTGT
GGGTCAGTCAGTGGTCCCCATCTGTTTTAGCACCACGGACCGGTTTATTTTTTTTTCAAT
CTTTATTACACAATTTTCTATTTTATGAACCGGCCTTTAAGATGTTGGCGGAGGATTACT
GTAGCAACGCCACTTCAGAGGAGGAACAGATACGTGACAACACTAACCCCGAAATTTGAC
ACGCATGGATAGAACATCGCAGGTGTCGTCATCCTCCCCCCCCTTCCAACGCTCATGGTG
CAAAAAGGAAGTACTGTCTATAAAATGTAGCTTTCTTTTTTTGGAAGTGGAAGGCTCCTC
CTTTGTCTCCTGGCTGGGCGTTTTCCCTTTGGCAAAGAAACTTTCCAAAGACGTTTGTTT
TTACTCATTTTGCTAGCTCCTGGGTTTTATTTTAGTGGTAGCCTATCACGTGACTGAGAA
GAGCGCCTTGGCCTTCGTTAATGGTGACGAAGACCGATGTGACAGAGAATGGGGCAATTT
TTCAAAATAAAACATCCTTCAGATTCCGATATAAATAAACTGGAAGTAAAGTAAATTATT
ATTTTTGCGCAGCCCAGTACCAAATGACCCACAGACCGGTCCGGGAGTTGGGGACCACTG
TTATAAGTGATTTCCAGTGATTCAAGGCCAACATGTATATCAAACATTACTGCAGCTGGA
TGGCTTCATTAAGAACAAAGAGAACCAGACAGATGTGAATGGGAAATGCATCTCCTTTTA
TAATCTAAAGGAGCTAAATCAAGCAACAAATGCGAGTTCTGGGGATGGAGAACATGGATC
AGAAATGGGTTTGTACTGTCATCTAATAGTAAAGAGACTATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved