Oryctolagus_cuniculus Locus RPS12
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus RPS12
Oryctolagus_cuniculus
RPS12
GeneScaffold_3322
SNORD101, SNORD100, SNORA33
1525..1596, 2493..2568, 2907..3038
4226
GTTTGGCTCCTCTCGCGCCCTGTACAACGAGCTTGCTGGGCCTCCGCAGGCCACGCCCC
TGGCAGAGAGGACCGACGCGAGGCTGCCCGCGTCGTGCCTGCAGCGCGCGCCAATAACTG
GCCCGGCAGAGGCAGAAGACGCACAGTCCTCTTTCCGGAAGACCGCCTGAACCCGGAAAC
AGAGGCACTCGGGGCCCGGCACGGCCACAGCCACCTCTTTCGTGGGAGGGAATGCACATG
CGCACAGGGGTCCTTAACAAACCCTTAAATACCGTCATGCGGACGCGTGCGGCCTCTTTC
CCTGCCGCCGCCGAGACGCGCGGAGGCGGAGGCCCGGGGTGAGTGTGGAGCGCGAGTCGT
GTGGCCCCCCCCGGAAAGCGGCTGTGGCTGATTATGGGTTCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCCAAAGAAAAAAACAAGGAATATGGATGAAGGCCTTCC
AACAAGGATCTTAGCACTTATGTCGAGAAAGGACACCTCAACATAAGGTTAACCCCTATT
GCCCTTTGAAGCGGCGTCCCATATTCCGACCTCGGCAAGGGAAAGAAGACAGTCCAATCC
TCTTATCCGGAAAGATCGCCTGAATCCCGGAAACAGGAGGCACTTCGGGACCCGGCCACG
GCCCACAGGCACTTTTTTCGTGGGAGGGAAAGCACATGCGCACCGGGGGTCCTTAAACAA
CCCATAAAATACAGTCATGCGGAACGCGTGCAGCCTCTTTCCCTGCCGCCGCCGAAGACG
CGCGGAGGCGGAGGTCCCAGGGTGAGTGTGGAACGCGAGTCGTGTGGCTGTGGCGGAAAG
CGGCTGTGGCTGATTATGGGTTCCTGATTCTAAACCGAGTTAAGCAGTTGTGTTTTCCTT
GCAGTGCGTTCAAGATTCGGCTTCACCCGTAACCCACCGCCATGGCCGAGGAAGGGTGAG
TCCGGGGGCCTGGGAGTTGGGGTTCACGTAGGCCGCGCGGGTCGGGAGCCGGCTGCGTGG
GGCTGGGTCTGCCTGGGCGCCAGGGCGCTCTTGCGGAGCTTCGCTGGTGTGTCTACCGGG
GTACATGGGAAGATTTCGTGACCTTGCTGTCCTGTGTTTTTAGCATTGCTGCTGGAGGTG
TAATGGACGTTAACACTGCTCTACAAGAGGTGCTGAAGACCGCCCTCATCCATGATGGCC
TAGCCCGTGGAATCCGTGAAGCTGCCAAAGCCTTAGACAAGTACGTGTATCAGTCTCAAT
ACTGTGGGTTGTTGCAGCCGGAACAAAACTGCAGCCAAGGGAAGAAAGCGTGAAGTTAGC
ACAAAAGTTGTGAATGGCATCCGTCCTACAAGAGACCTAGGAAAAGGTATCAGAACTCAG
ATCTTGTATAGCCCACCGAGAACACGTGGCTTGCTGTGTGTAGTGGGGGTGAGCGCCGGG
TTCTAAAGCGGAGCAGAACTACAGTGTTTGAATGATGACTGAAATTGTCGGATACCCCTT
CACTCCTTCCTGAGTGACACACTGCAGTCTGACAAACCTGTAGGTTACCGGGAATCGTGG
GGAGGCTCAGCAGAGCCGGCATGAAACTACCGGAGCGTTGAGCTCCTGTTTGTTGAAAAA
GTACCTGGGTTTGTACTTTTGTGCCTACAACTGATAGCTAGGTGGAATCTCGAATGGTTA
AGTAACTAACCTAGTTCTGATATTTATTGGGCTGGTTAGGTTGGCAAAACAATATTCTTG
AGTATAATTTCAATGAACATAAGATGTTTATACAGTAAAGGATTTGTCATTTAGTAAGAG
CTGAGCACATAGTAAACACTCCTGCTGGGATGCAGTTTGGTGGATTTAAATCTTCTGCAG
GTACATGACTGCCGTGCTCACAAAAAAATAACAAAACTGTCTTGGTTTTGTTTGACCACA
AATACATGACATGTACGAACCTGATATTTTTGGGGTGAGATTTGCTGAAGATTGTCAAGG
ATTTTTATAAGCAAATTGACTGGGTTCGTTAACAGGTGTGTCAGATTTACGATGGGTTCT
GTAATGCGTCTACTGCAGAATTATTACTGAGTGTAGGGAGTGCAAAGATAAACCTTTGAA
AGTACAGGAGTATTTGCTGTAGGCCTGAATTTGCGATTTTGTTCTTCCATTTCAGGCGCC
AAGCCCATCTTTGTGTGCTTGCATCTAACTGCGATGAGCCTATGTATGTCAAGCTGGTGG
AGGCCCTGTGTGCTGAGCACCAAATCAACCTCATTAAGGTAAGTTACTGGTCTGCATCAA
GATGACTGCCTGAAAATTGGGCTCCTTTTTGCAGGTGTAAATACAGGGACCTGATGTGGG
CTGTGGGGAAGCTCATTGTAGGAGCATTTACACCGGCAGAAAGAAGTGCTGATTTTGGTG
TTGGATATGGAACAAAGATTGAGTGCTAATGGTGCTGTGAATGATGACAACTGGCTCCCT
CTACTGAGCTGCCTTGAGGAAACTGCCATGTCACCCTACTGACTACAGCCACCTCTCTGC
TTCCATTTCTTGTCGGTGGCTTAATGTCTGTCTGCTAATAGTGATTTTTCTTTTCTAAAT
CCCCCCAATAGGTTGATGACAACAAGAAACTTGGGGAATGGGTAGGCCTCTGTAAAATTG
ACCGAGAAGGGAAACCCCGCAAAGTGGTTGGTTGCAGTTGCGTAGTGGTTAAGGTAAGTC
AGTTTTTATCTTGGGGCTGAAGATTGTGCCAGCTGACCATATATAACCTTATATTCAAAT
AAGATTGAGAGTCATGTGAAGGAAAAAATGGCTGTCAATGGCTTGGAAAACTCGGGATTT
TAGAAATGAAATGTAAGCTTAATTTAGAAGCCAGCCAATGAATCTGCTTACTACCTATTG
TGTTTCTGCAGAAATCTAGAAAAAGCTGGCAATAGTAGTGCCATGTTACGAGCCTTAAAG
ACATTGAAGTCTTTCAGGTCCCTGAAAATGGCTACAACAAACTTCTGTGATAAGAAAGAA
GCATTTTTAAGGCATGGTTAATTAAAGGTTCATAATAATTAGTTGCTAAGGACTTCAAAT
GAGATTTGTAAATGTTAATAAGAAATTTTTTTTTTTTTTCAAGGACTACGGCAAAGAATC
TCAGGCCAAGGAGAGTCATCGAAGAATACTTCAAATGCAAGAAATGAGCAAATAAAAATT
TGGTTCATATTCTCTTGTCCGCACTTATTGATTTGGTGGTAAGATGAGTGAAAAAACAAG
CGAGCTCTTCAGCGAGTTTGACTTGGAAAAGTTTACTGCAAGCGATGCTCTAAAGCAGCT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCAGAGTCAAGGCTGGGACAGGCCAAAGTTAGAAGCAAGGAATGC
TACCTAATCTCCCATGTGTGTGCTAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1183..1299, 2215..2317, 2651..2752, 3163..3192, 3194..3226
1001..1014, 1183..1299, 2215..2317, 2651..2752, 3163..3192, 3194..3223
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved