Oryctolagus_cuniculus Locus CCAR1
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus CCAR1
Oryctolagus_cuniculus
CCAR1
GeneScaffold_5431
SNORD98
13053..13117
29102
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGGTAAGATTA
GTGGTTTCATTCTTTAGTTTATATTTATTAAAGCATGAACATGTAACATAAAGCTGTTGA
GGTCCTGAGAGAGACATAAATCAGTTAAATTTAAGAAGTATTACTGAAATTTTTTTTAGT
AAACTATCACAGATTGTAGTGTACAACTAAGCAGTCAATTCTTGGAAGAGATCCAAATAA
CCTTAATTTTCTTCCCTCTCCTTTTTAATCTCATTTTAGCTGCACTGGGTGTTCAGCAGC
CATCACTTCTTGGAGCATCTCCTACCATTTATACACAGCAAACTGCATTGGCAGCAGCAG
GCCTCACCACACAGACTCCAGCAAACTATCAGTTAACTCAAACTGCAGCATTACAGCAAC
AAGCTGCAGCTGCAGCAGCTGCATTGCAACAGGTGAATCCCTACTAGTTTATGATTTCTG
ATACAGCATTGTAAGATCTGAGTGGTCAGGGTTGCTACGAAAAAATTGAGAGGTTTTATC
ATGCTTATTTTTTTTGGTTGTATATGCCCAATACTTAGAGAAAGATGTTGCATAATTGAA
ATTCTAATGAATTAAGTTCTTAAATTTGTTCTTCTACTTTAATTATTTAAACAATTCAAT
TTTTACAAATTTCAGTTGTAAGTAGTTATCATTTTGTTTATTTCAAAGTTTAGTTGTTCC
AGAAAATTCCTTTTCATTGTAACTATTTACGTTATGTAACTGTATTTGTAAATCATCTTT
AGAGAATGAATAAAGCTAATATATTGTTCTTTGAAAAAATTTTTTAATCTTTCAGCAATA
TTCACAACCTCAACAGGCCTTGTATAGTGTGCAACAACAGGTTAGTTTATATTTTCTGTA
TTAAAAACTGATTTTAAAATAGCCAATTGTTCCAGAATTCATTGTTGTTGTTTTATTCCG
GAAGAAGCTCCTGCCAGTTGGATTCAGATCAGCTCAGTTCTGGACATTGCAGCCATTTGG
GGAGTGAACCAGCGGATGGAAAATCTCTTTCTGTGTCTCTATCTCTCTCTGCAACTCTTT
AAAATAAATCTTGGAAAAAAGAAAGATTATAATGTGTTCTGTTGAACCATATGCAAAGTG
CAGTATACAACCATTCTTACAGAAAAAAAGTATGTCAAAAAAGTTTTATTTATTTGAAAA
AGAGAGGAAGAGATGTTCCAAACACTACTTCATTCCCCAAATTCTTGCAGTACTCAGTGG
TAGGCCAGAGTAAGCCAGTAGCCAGGAACCTCATTGGTGTCTTGTATATGATTGGCAGGA
TTACAGACACTCACACCATTATCTGCTCCCTCCCAGAAGTATAGCACNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTATCTGCTCCCTCCCAGAAGTATTAGCACGAAG
CTGAATTGGAAACTTAGAGTGGTCAGGACTCTTAACTTGTTGCTAGGATACAGAATGCAG
ACATCCGAAGTGGTGACTTATCCTACTATGTCTCAATGCCTATTCTGGCCCCCAGAAAGT
ATTTGGATGTGATTTAACCTCTAATACATGGTGAATCTCAATAGTTTTGAGTTAGAACCT
CATATGCATTCTTTTATCCTATCATAAGTAAAATTTATGTTGAAGAATTATTTTTTCAGA
AGATTTATTTATTTACTTGAGAGGTACAGTTAGAGAGAGAGACAGAAAAGGTCTTCCATC
TGCTGCTTCATCCCTAAGTGGCCTCAATGGCTGGAGCTGGGCCGATCCTTTGTGGGTGCA
GGGACCCAAGCACTTCAGCTATTTTCTGCTTTCCAAGGCCATAGCAGAGAGCTGGAAGAG
GAGCAGCCAGGATACTAACTGGTGCCCATGTGGGATGCAGGTACCACAGATAGAGGCTGA
GCCCACTACACCATGGTGGCAGCCCCTCCAGAACTTTTTAATTTCCCCTCTTCCATCAGT
TCCTTTTACTTTCTTGTAATGGTATACTTCGCTATTGCCAGAAGAAGCGTATTTGGGGTG
TCATGGGACAAGTTGTTAAGTCACCACTTGGGATGCCTACATCTCATATCTGAGTGTCTG
ATTCAAGTAGCCTCTCCTCTGCTTAACATTCATCTTCCTGCCAATACACACCCTGGGAGC
CTGCAAATGATGCCGAAGTACTTGGGTACTTACCCCTTGTAGAAAATCCAGGATGAGTTC
CAGGTTCCTGGCTTCATCCTGGCCCCTGCTCTGGCTGTTGTTGGCATTTGGGGAGTGAGT
CAGTGATGATCTCTTTCTTTCAACTAAATGAAAATAGAAGTTAAAAAGACAGCATATATA
TATATTTCAGAATGTGCGGTCCTTCATGGTCCCCATGCCTATGCATATCTGACCATTGAT
AGTGCTTCTCATTTCAGGCGTACATAGGAATTAAATGGCGAGATCTATCTATCTATCTAT
CTCTCTTTCTTTCTTTTTTTTTTTAAGATTTATGTATTTGACAGCCAGAGCAACAGAGAG
AGAGCTCTTCCATCTGCTCCTCTTTCACTCCCCCAATTGCTGCAATAGCCAGGTCTGAGC
CAAGTGGAGGAACTCCATCTTGATCTTCACCTGGGTGACAGGGGCCAAGTGCTTGGACCA
TCTTCGTCTGTCTTCCCAGGCACATAAGCAGGAAGCTGAATCAGTAGCAGAGTAGCTTGG
GACTTGAACAGGCTGGCACTCCAGTATGGGATGCCAGTGTCTCAAGCATCTACTTAACCT
GCTGCGCCACAGTGCTCGCCTCAGTGCCATTTTTTGAGACAACTAGCATACCGATGATAC
TGAATTATTCCTTTAGCATAGTATTTAACTTTGTTAACTAGAAAAATTCCCCTTTCAAGA
ATTGTGGAGTTTTTTGTGAGTTGTATTTCTATGAAAGTAGTATACTGATGATACTGAGTC
ATTTCTGTAACATGGTAATTAACATTGTTAACTAGAAATCTTCCCCTTTAGGGAATTGTG
GAGTTTTTTGTGACTCTTTATTTCTATGAAATAACAACAAAAATAATATTCTTTTATTTG
TTAAATATAGTGAAGTACCTGTTCATTGAATAAGTTACTAATAAATCATGTCTTCAATTA
GAAATGTTTGTAGGAGAGCCCTATACCTAACAACCTCTGTTAACTTTTTCAGATTTTTCT
TTAAAATAAAGTAACTGTTTAATAGGAATTTTTCCTTTTGTAAATCATCTATGAAACAAT
TCTGATTGATCCTTTTTCTTTTGTATTTTTCCTCTATATTCAGTTACAGCAACCCCAGCA
GACTCTTTTAACCCAGGTTGGTGTGGTGTTATTTTATTTTGGATATCTGAGTGAAGGGTA
GATAAAAGTTTTTATTCCTATTCTGTTTTTTCTTTAATAACTTAAAGGTATTTGTTGGAT
TCACATAATAACTTAGCAATTTCATGTTAAATAAAGGTGTATATAATTCTGTTTTTCTTT
TATGCCTTTTGATTACAGGTCCAACTAAGAGTCCAAATACAAATAAGGTCTTTATTTCAA
ACTTAATACTGATTTTTTGCTTTTACTTTTTCTTTATAGCTCATATTTTTGAAATTTTTG
CACGTTATTTCTTCTTTAACCCAACCTTAACAGGTGACATTATTGTGTTACCAGTTTAAT
TTCTCAACAAAATAAAAAAGTTTTGAATTTCTGATATGTATTTGCTTCCACAGACTTCGC
AGACAACTTATTATTATTATTTTTTTAACGATCCTTTAAAAGTATAAAAACCGTTGTTTA
ACTTACTAACAGTTCAGGCTGATTTGGGGCTAGATTTGGCCCATGGACCATGTTTGCTGA
TCCCTGGTATGTACATAGTGTGTAGTACAATGTAGGTGCTAAAAAGGAGCTGGATATTTT
TTATGTACTTGTATGGAATGATAGCTCAGAAATACGAAGCAAAAGGAAAAGGTATGGGCC
AGTGTGTATTATATGCTTCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCTATTGC
AAACTTTGTGTTTTTGTAGGGATGAGTGGAATGTAATTACAGAATGAGTCTAGAGTCCAA
TATGCATGAATTTTTGGCTTTTTTTTTTTGTATCAAAATAAACTTTTAACCCCATTTTCC
ACAACTATATTTTAAAGTTCCTTCATAAACCTGCTTTTTAAGAGAGTTTCCAGGCTTACA
TTTCCCATAGTTTACTTTTTTTAAAATGATTTATTTATTTGCTTGAAAGAGTTACACAGA
GAGAGATCTTCCATCCACTGGTTTACTCCCTAAATGGCCCATTGGCCGGGGCTGGGCCAG
GTGGAAGCCATAGGAGCTTCCTGCGGATCTCCCATGTGGGTGGGAGGGGCTGGATTGGAA
GTGGAGCAGCCAGGTCTTGAGCTGGTGCCCTTATGGGATGCCATGTCACAGGTGGTTTTA
CCTGCTTCTCCACAACACTGCCCTGTAGTTTACTTCTAAATAGTTAAGTATATAAATCTT
TTTAAGAAAATCTCTTTTAATTATGTTTATTTCTTTTTTTTTTTCTTGCAGTGCTGTCAA
AGGGAAAACCCCGCAAGTGGGTGACAGAGTACTGGTTGAAGCTACTTACAATCCTAATAT
GCCTTTTAAATGGAATGCACAAAGAATTCAAACATTACCAAATCAGGTACACAGCATACT
GAGTTAGGTATCGTAGAAACTTGGTAATTGAGCCATTTATTCTTTTTCTTTTTTAAAACA
TTTTATTTATTTATTTTTGTTAAGAATCAGTCTCAAACCCAACCTTTACTGAAGACTCCT
CCTGCTGTACTGCAGCCGATTGCACCACAGACAACATTTGGTGTTCAGGCCCAGCCGCAG
CCTCAGTCACTGCTTCAGGCACAGATTTCAGCAGCTTCGATTACACCACTGCTGCAGACT
CAGCCACAGCCTTTATTACAGCAACCACAGCAGAAAGGTATTATGTGCAGTATGCCTTTG
CTTTTTGATTCAGACAGCTGTACACTCTTTAGTTTAAAATAATGATAAGCATATGCCTTT
CGTTACAAAAGAGGTAAGGGTACATATTTGGCGCATCAGTTTAAGATAGTGTTTGGATAA
GTCATGTTCCATATCAGAGAGACTCTGTTTCTAATTCCAGCTTTCTCTGAGTGCACACTC
TGGGTCGTAGCAAGTGGTGGCTCCAGTGCTTGAGTTCCTGGCTCCTGGCTTTGGCTTGGC
CTTGCCCTTGGCTATTTCAGGCAGTTGGCTTGTGAATCAGTGAATGGAAGGGATGAGTGT
ATGTCTGTCTCTGTATTTCTGTCTCTAACCCCTCTCCTGTCTTGTTTTGCTACTTTTCAA
ATAAAACAAAAAAAATTTTTAAACGATTTATATATTTGAAGGGGAAAGTTACAGTGGCGG
GGCTGGGGAGAGATTTTTTTTTTTAAAGATTTATTTATTTATTTGAAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGACAAAGCTTAAACCC
TAGAAACTTCTTTTCTCCCTTTTTCTATGAAGACCTTCTGTAAAGTGATACCTTGCCCCA
GAATGCAGGAAGAAGGAATGCAAAGAAAAGAAACCAAGAATTTAAGAGTGGGAATGTGAG
AGGGAGGAGAAGGAAGAGTTGGTGCATGGCAGGAGGAAGGGTAGGGAGGGAAGTATCACT
ATGTTCCTAAATCTGTACATATGAAAAAACATGAAACTTTATAACTTAAATAATGTTTTT
TTAAAAATCATCTGAACAAAAAAGACTTGGTCCCCAGCTACCCCCTGCCCAGTCCACAGT
CTATTCCCAGAAATCAGACTCTTTTTCTCCAATTAATTTCTACTTGGTTGTCCGTTCCTC
AAACCTAAGCATAAACACATGTTTCTCTGAGTCTTCATTTCTGAAAGTTCCCATCACATA
CAACATCAAAGAAACGGATGTTATGCTTTCCTCTTGTTAATCTTTCTTTAGTTAGAGGAG
TGTTATCCATGTCCCTTGTGATGGGTGAGGAAATGTTCACACTTTTGTACACCTACAATG
TGTATCCTTCATATATTCATGGGAGGCACCCAGAGAACTAGCAGTTTTCAACAAGGTGAC
TTTGAATTCCAGTTTATATAGCAATTTTAACCTTTGTTTTTCAGCAGAAAATATTTATAG
AAGTGACAAGACAAATGAAAAGTACTTTGTATTTCTATGCGTAGCAATTTATGAAGGCAA
AAATGTCATAAAGTCTAGTTAATAAAGTTGGTATTTTGTTTTTTTTTTTTAAAGATTTAT
TTATTATTTGAAAGTCATGGTTACACAGAGAGAGGAGAAGCAGAGAGAGAGAGAGGTCTT
CCATCCGTTGGTTCACTCCCCAATTGGCCCCAATGGAGCTGCACTAATCTGAAGCCAGGA
GCCAGGAGCTTCCTCTAAGTCTTCCCAGGCTGGTGCAGGGGCCCAGCATTTGAGCCATTT
TCCACTGCTTTCTCAGTGGAAAGTGGAGCCAGTGCTCATATGATGAGCCACAACAGTATC
CCCATAAGCTCAGGCTTTAATCTCTGTTCTGGGAAGAGTTAGTGCATACAAGATGAAATT
GAATAGCTCTCATTCCTTCCAAGCTAGAACTCCGCAGTTTCACTTTATCACTTTGAAGTA
AATTCCCAGAATATAAGTGAACCTATTGTAACTAGAACTGATTTTAAAGTTTCAAATAGC
TCCTCTTATCCATAGTTGTGCAAATGAAGACTTTTTTTTTACATTAAAGCATTATGAGAG
ACTGTATGCCGAAGAAATGATGTATTTCTTGTCATGTTTTATTTATCGATTACTCCTCTG
GGGTAAAACACTCTATCACACATTTTAGGAATAGGAAACTATTACACAAGTTTTTAAAAA
TATTTTTTTGAGAGCAAGAGCCATGGAGAGAGAGTTCTTCCATTTACTGGTACATCCCCA
TATGCACATAACAGCTGGGGCTGGGCAAGGCTGAAAGTAGGATCCTGGAACTCGATCTGT
GTTTCTCACATGGATGGCAGGGACCTACATATGTGAGCCTTTATGTGCCACCACCCCTTG
TGTGCATCAGCAGGAAGCTGGAATTGGTGATGTGGAGCCAGGACTTGAGTCAGGCACTCT
GATATGGAATGCAGTCATCTCAACTGCTTTGCCAAACATCTGCCCTAACGCATACTGTTT
TTGGTAACAAAACTCACATAAATTTTTCACATTTTCATCATTTTGACAGCATAAATTAAT
CTAAAGTAGTATAATTGTATCTGTAACCATAACTGACAAGTTTACCACTCTATTTTAGCC
TTCAGATAAACATCTCTTCATAAATATTAGTTCATATTTCATACTCTTGTCTTTATTGTC
TTTTTAAAAGACAATATTTTTTTTTTTTTACAAATTGTTGGTGTTTTCCAATTTAATTCA
CTATACTTTTAACATACATCTCTTGGCCTTTTACCAGATTGATTTACCTTTGTGTTCCTC
TGCTTTAAAAGCTCTGCTTCTTAGGAAAAAGGAAATCATCCTTTTAAAAATAAGTTGCCA
GATAAAAGGCAAGAAACTTATTCCCTCTTTACATAATAATCAGGTATGGATCTTAACCAT
TCACATAGAGGGGTATGGAGGTGTGGATAATCCAAAGAGCATTTGGATTTTGCTTCCATG
TGAATTTCTGTACTTAATTTTGAATATAAATATGCTTGGTCTAGGAGCTTACTATAGAAT
TAAGTTATATATTTTTATACTCTGTAAACCTGATTGAGAAGCATTTAAATACTGATTTGT
TTACATTCTTGTCCTTTCTTTGTATCTATTCTATATGAACTGTTATTTTTTCAAATATTA
TTCAGTTCCAAGTGAGGTGGAACTGCTTTTATTCAGATCTTCTCTGGAGCTGGGGTTGAA
GTTATTTCAGAGGGTCTTCTCTAAAGAATTATAAGCTACACACAAAAATTAAAGAAATAA
AGATAACATGTCGGTACTAGCCATTTATTCAAAGCTGTGTAAGTAGTACAAATTTAAAGA
TAAAATTTTCATATGTCTCCATGCAAATCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTGATTTTCTTAATT
ATTTAAGTAATTTATCCTAACCTCCTTTTGCCTTACCTCTTAAAACTCATGAAAACATGA
GGATGAAGTTGATGTTATTGAGGTTTTTTTAAGAGTGTTTAATGACTTCTGAGAGCCCAT
GGTAGAATCTGATTTTGGGTACATGCACTAAATGTTAGGCTTAAGGGAAAAATTTAGCAT
ACTGTTTATTATAAGTTTTCTTCTGCTTTAAAATATTATTTGTCAAAAAAAGCAGCCCTT
AAAAAGTTACTTTCCATTTTTATTAAAAATTTCAGATTACTAATATTTAAGGATAATTAG
TAGTACTTCTCATTTTTTTACATTACTTTAGACTTTTGACAGGATTGAATTATTTGACTA
TAATAGGTTATGCTGATGGCTAGCCCTAGCATGGAAGATTTGTATCATAAGTCATGTGCT
CTTGCTGAGGATCCACAAGAACTTCGAGATGGATTTCAACATCCTGCTAGGCTTGTTAAG
GTAAAATGAAACATTTATTTTAAAGTTTAGATTGTATTCACTTTACTTAGTTCTAACTCT
ATGTACATTATAAAGTTAAAAGCGCTATTTTTAATCTTGTTGATTCGTATTGTTAAGGTA
CTCAGATTTAATGATGTAGGTGTTTTTCTCATTGCAGATTATGGTTCTATCTTATTTGTA
TGTAACTAGCTCACATGTCATTTTGGTCTTTTATATCTGTAGCATGATAAATCTTAGTGG
TAATGGGATTTAGAGTGTCTTGATGCTGTTAAAATTTGAATTATAGCTTGTTTCTTTAAA
ATAATTTTATCTGAAGAAATATTTTAGAAGGATGAGTTATGATGTGTAAATCCTATTCCA
TTGCTGAAATGCAGTGTGGAACACGATGAACTGAACTCTTCCTTGACTGACAGATACCAG
AGGTAGTAAAAATGATGTTGGAAAGGTTTGTACCTTTCCTTTTCAAGTATTTATTTGTAA
TTTTGATGAGTTGCATAATCTATGTAAATGATTCTTTGTTTTGAATTAGGTTTAATGGGC
TTGAAAGGCAAGGGTGGACCCCTGGCCTTTGAAGGCCACTGGGCTCCTTCGTTGGATGCA
CCAGACCAGAAAAGAAAAACCCTCTCGTGTGAGTAGAGCTGGCATATCCTTGGTGAAAGC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTTGATTAGAAATGTTT
TTCTTATAGTATATGTCCGATGTTTTTGTCTATGAGTACCCCCCACCCCCACCCCGGCCC
AGCCCCCAGTATTTTAGCACCTCTAATCATGCAGATAATCTGAAAAGCAAAATCCCCATT
AGTAGCAAAAGTTTATTTGGTGCCAAAAATGTTTTGGGGAAAAAGTATTGAGAATTGATC
AAAATAAACTGAAAATTTTTTTCATTATGCTGTATTTTGGAAGTTGGATGTATGTTGAAA
TACTTTTCATTTCATGCATAGCTGGAGAAGATCGTCAAGAGAGAACTTCATTTCATTATA
ATTCTTTTGTTATAAAATGATGTAGTTGCTGATTATTTTTGTTCAGCCATATTTTCTCTT
GAGGGTTATTTGTCCTTTGTATTTTAGTATATATCTTGTGACTTACTTAAGAATATTCTT
TTTTAGCACATGAGATCTGAACAGCTATCCAGCTTCTTCAGGTATTCTCTAAAGTATGGG
TAGCTCTATAATGAAACTTAAAGAATGTCTTGGGGGAACATATTCTTCTTGTAACCATTA
AAATATTGTACAAATGTACCAAAAGAGGAACTATGGCTTCTATAATTTTTTTTTCTTTAG
ACCAACCTCAAGTTCTTGCAGCAAAATTTCTTTACTTGATGTGCTACAAGTGAACTAGGG
TCTTTAAAATGTATTTTAGAATTTTTTTTCCAACATGCTTCTTCCCTTGCAACAGGTACC
GTTTTGCAGAGATTCGCTACCATCGCCCTGAGGAGACCCACAAGGGGCGTACAGTTCCAG
CTCATGTGGAGACAGTGGTTTTATTTTTCCCGGATGTTTGGCATTGCCTTCCCACCCGCT
CAGAGTGGGAAACCCTCTCCCGAGGATACAAGCAGCAGCTGGTCGAGAAGCTTCAGGGTG
AACGCAAGGAGGCTGATGGAGAACAGGCACTGAACGCTAATCCCTTTTTCTATTTCCGCT
TCTCACAGGCACAGGAACACAGGCACAAATGCACACCACACACTACATAACAAACACACA
TGGAGGAACATAAATGGTAACAGCGACTGGTAATCCAGCTTTCAGCAGTATAGTTGTATG
TTCTTTTCTCTTAAAAATTCTGTCTATTACGCTGACTTTTAAGACTGCTAAGACCTCAAA
GGAAAATAGTTGTGCTTAAATTGCACAGTTTTGTTTTTATCATAGGTCTAGTTGCTGGAA
TCTGGGACCAGTTGTTGAGCAAGATTCAGTATTAAGCCATTCTAAACATTTTGCCATTTT
CTAAAGTTTAAAAGAATTTTCTCTTTCACGGTCATCAGTTCTAGTCATGGATATTTGAAA
TTGGACAACCACAAGTCTGAGAGATTTGAAATTTCAGGCTATGTGGCAACGTCTTTGGTA
CATTTCAAAGGTCTGACTAAATCAGTCTTTGGGTGGCTTGAAAATTGGGGCAAGATCACA
CACTGTGTGGTTAGTGGAGACCAGCAGTGTTTGTGCATCCCTGATATCCTTTGTGTTGTA
ATTTATCACCCTTTTGTGTTTCACAGATCTGGCTTTGATTGGCTGATGAGTGTCTTTGTG
ATCAGTTAAAAGTGGTAGAATGTATGTACGTGGACTTGCCTAAATAATAACTTTAGGAGA
AGACAATCTGAAACATTTGTGACCTTGCACAGATCAGCAACAGACTTTTAAAAATAAATT
ACTTTTATTTTAAAGTTTCAGAATAGTAATTATGTTCTTAACTTTGTATGTCAGGATGAA
GAAGAAAAAGATGATGGTGAAGCTAAAGAAATTTCCACTCCTACCCATTGGTCTAAACTT
GATCCAAAGACAATGAAGGTAACTTGGAAATTATGAAGGTTTATAATTCTAAATCTCTGA
ACAAGAAGAGTAATCTTGGTCAGAATGTGTAGTTTAATTTTGTTTTATTCAGATAAAAAC
TATTCAAGGGGTGGACATTTAACCTAGCTGTTCACATACCCACATTCCATATATGAGTAC
CTGCGTTCAGATGCCAGCTCTGCTACTGATTCCAGCTTCCCACTAATGGAAGACACCGAG
AGGCAGTACTTGGGTCTCTGCCACCCATGTGGGAGATCTAGATTGAATTTCCTGGCTCTT
GGCTTCGCCCTAGCCCTGGCCTAGCTTTTTGGGCCTTTGGGGATTGAACCAGAGGATTGG
AGTTTGCTGTCAGTTTTTCTCTGCCTTTCTTTTTCTTTTCTTTTCTTTCTTTTTTCTTTT
CTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTAAGATTTATTTTATTTGTTTGAAAGAGT
TACAGAGAGAAGTAGAAACAGAGAGAGGTCTTCCATCTGCTGGTTCACCCCCCAGATGGC
CACATCAGCTGGAGCTGATCCGATCTGGAGCCAGGAGCCAGGAGCTTCCTCTGGGTCTCC
CACGTGGGTGCAGGGGCCCAAACACCTGAGCCATCCTCCAAGGCTTTTCCCAGGAGCATT
AGCAGGGAGCAGGATTGAAAGTGGAGCAACCAGGACTCTATAAACGGTGCCAGCACGCCT
ATTTATTAATTTTGCAAGTTAAGATTTACAGAGAGAAGGGGAGAGAGCTTCCATCCACTG
GTTCACTCTCAAGATTGCTTTTACCTGGCTAAGCTACAACACCAACCCCTGAAACATCCT
AAAATAGATTACAGGGGACTGGCATTTGGCACAATAGTTAAGTTTCAACATGGGATGCCT
TCATCCTATATTGGAAATTTTCTGACCCAGCTTCCTTCTAATGTACACCATGGGAGTTCC
TCAGCTGGTAGCTCAATTACTTCAGTCCCTGTCACCCACATGGGGGACCAGATAGAGTTC
TTGGCTTTGGCCTAACAGCTCTGGCTGTTTAGAGCATTTAGGGAGTGAGCCAATGGATAT
AGTGTCTTTCTCTGTTTTCTCTGTGTGTCTGACTGCCTTTCAAATAAAAAATAAATAAAA
ACTCAGAAAAAGTCTTCAAATTACTTTCTAAAATTATTCTGTCATTTTGTATTTCTTTTC
ACAAGCATTTTGTATGGGCTATACAAGTGTCTCTGTCACCAAATTTTTTCAGAAATAATA
CATGTCTAGCAGATAAAGCTGCTACCTGAGATGCCAGCATGGTTGCTGGTTTGAGACCTG
ACTGCTCCTCTTTCAATCCAGCTTCTGCTAATGCACCTAGGAAAGCAGTGGAAGATGGCC
CAAATGTTTAGGTCCCTTCTACCCATGTGGGGGACCTGGAATAAGCTCTGGGCTCCTGGT
ATCTGCCTGGCCCAACTCTGGCTGTTGTGGCCATTTGAGGAATGAACCAGCAGATGGAAG
GTCTCTCCCTCTCTGTCTCTGACTCTGTAATTCTGCCTTTCAAATAAATAAAAAATAAAA
ATCTTAAAAAAAAGACAATTATTTTGTTTACTGTTTCAAAAATCCCATTTTCTTTATCTG
TTTTTATGCTCTGTATATATAGGTAAATGATCTCCGAAAAGAATTAGAAAGTCGAGCTCT
TAGTTCCAAAGGATTAAAATCCCAGTTAATAGCCCGATTGACAAAACAACTTAAGGTAGA
AGAACAAAAGGAAGAACAGAAGGAATTGGAGAAATCTGAAAAAGAAGAGGAAGAGGAAGA
TGATAGAAAATCTGAAGATGACAAAGAGGTATGTTTGAGTCATTTAAAAACACTGTAATG
GTATTTGCAATGGTCTTTTCTGAAGTTCTTGGATTGTGTAACTTAATGCTGTTTATTTGT
ATGTGTGTGTATACAAAATTATGGGATAAAACTCAAGTCTCTGAAATATTTTATTGAATC
ATTTTATATCTTGTGATGGCTGTTACATAATTTTGTGCATTAAAACTTGCAGAACTGTTT
ACTGAAAAGGTTGAATTTTATAGTACGTAGATTATACTTCAATTAAGGTACACACACACT
CTGGTTCACTCCCCAAAATGGTTGCAACGGCCGAAGCTGTGCCATTCTGAAGCCAGGAGC
CAGGAGCTTTTAGGTCTGCCACACGGGTACAGGGGCCATCTTCTACTGCTTTCCAGGCCT
TAGCAGATAGCTGGATCAGAAGTAGAGGAGCCAGGATTCGAACAGGCGCCATATGGGATG
CTGGCACTGCAGGGCATGGCTTTATTCACTAAGGCACAGCACCAGCCATGAACTAATATT
TTCTTATTTGACTCAGTTATAAACATGTGCTTTGGTGATAAAAGTATCCCAAAATTAGCC
AGTGGAATCCCTTTTAATGTGCAGGGTGAACAATTGACCTCATAGTTAAGATCCCAGTTA
GGATGTCCATCTCCCATATTCTAGTGCCTGGGTTCAGTTCCCAGCTCCAGCATCAGATTT
TAGCTCCCCATTAATGCAGACCATGGGAGGCAGCAGTGATGGCTTAAGTAGGTGGTTCCT
GCCACTTACCTGAGAGACCTGAATTGAATTCCCAACATGTGCTTCAGCCCTTCTGCCACT
ATAGGCATTCATTTGGGGAGTGAAAAAGTGAATGGAGACTTTGTACCTGGAGACTTTGTA
CCTGTTGTGTTTAGAGACAAATGTCTCTCAAATAAAGAAAAAATACTTATCAAGTTACCT
GCCCTTTTGACTGTTTTAAGAGTACTTATTTTCTTGTGAAATAGGATGTTTCAATCTTAA
TTTTTTTTTAAAAGACTTAGTTCATTAAAAGAGTTAGAAAGGAGAGACACAGATCTTTGA
TCCACTGGTTCACTCCCTTAATGGTTGCAACAGCCTCAGCTAGGCCATGCCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATAGTTTCCAGGTCATCCATGTATGGA
CTAAAATTTCATTGTTTTTTTAGACTGAATAATAACTTTATATGTATTTATAAACCACAT
TTTCTTTATTCTGATGGATGTTTGGATGGTTCTCATTTCTCTGCTGTTGGATATGATACT
GCCTAACAAGACCATTATCTTGGCCTGGTGCTGTGGCATAGCAGTTAAAGCCACTGCCTG
CAGAGCCAGCATCCCATATGGGCACTGGTTTGAGTCCTGGCTGCTCCACTTCAATCCAGC
TCTCTGCTATGGCCTGGGAAAGCAGGATAAGATGGTTCACGTCCTTGGGCTCATGCACCC
ACATGGGAGACCCGGAAGCTCCTGGCTCCTGGCTTCAGATTGGCACAGCTTCAGCTGTTG
CGGCCATCTGGAGAGTGAATCAGTGGATGGAAGACCTCTCTCTCTACCTCTGCCTCTGCC
TCTATGTAACTCTGCCTTTCAAATAAATAAATAAATCTTTAGGGAAAAAAAAAAAAGGAA
CATTATCTTTGTATGTTTGTGGGGGTTTTTTTAGTTTGTTTTTTCTCTTACTTAATGCCT
GTAGCAACCAGGGCTGAGCCGGGAGCCTTGTACTTTATCCAGGTCTCCCTTGTGGGTGGC
AGTTAGTGAAGTATTTGAGCCATCATCTCCTGCTTCCAGGGTGCATGTTAGCAAGAGGCT
GGGTTGGAAGTCGGGGAGCCAGCATCTGAAAGCTGTACTCTGGTAAAGAATGTAGATAGA
GCAAGTGGTTGCTTAACTCACTTTTCTTAGTTGAATTTAGTTTGCTTAAACTTCTATTAG
GAGTTTTGCTTGAGATTTTTTAACTTCACAGAGGCCTAGTCTGTTTTTCATTATCTGTTC
AAGAAACTGCAGTGGTATAGCTTTGTTAGGATTTCCTCTCTTGTCCTTTGTTATTTTTTC
TCTAGACCTTCTTTGTCTTTTTGCCCTATCCTGCATAATATTGTTTTTGTTTTAGGCAGT
TTCTCCTAAATGTGGTGCTTTGTAATGGAAGGAAGACCCAGTAAATCAGCTTTGCAAATT
CATGGGCTGGAATAGGGACCTTTCTGATCTTAACATGGATGCTCTGCGTTTACTCTCCTG
TTGGGAACAATACTTTGCCTAGTTTCAGCTGCTTTACTTAAATTGACCTGCTGTACTTTC
CAATAAATACCAGTAGGCTGTTTTTGGTTTTCTTGTTCTTAGGTACATCTTTCAACTCTA
TTCCTTCCTTCTTTTCTCCTCTCTGGCTCCATAATGCCAGCTTGTATATTGGTTTGGGGA
GACTTTTTTCACTTAATTTTTGTTTGCCTATTTACTTATTTGAAAGACTTACAGAGAGAG
AGGGAGAGACAGATTTTCCATCCACTGGTTTACTCCCCAGTGGCTGCAATGGCCGTGGAT
TTAACTGTGAATTATAATTTCAATTATTTAGGAAGAAGAAAGAAAACGTCAAGAGGAAAT
GGAACGCCAGCGTCGGGAAAGAAGATATATTTTGCCTGATGAACCAGCCATTATTGTACA
TCCAAATTGGGCTGCAAAAAGTGGGAAGTTTGATTGTAGCATCATGTCTTTGAGTGTACT
TTTGGACTACAGATTAGAGGATAATAAAGAACATTCATTTGAGGTAACGTTTTATGTTTT
AATTAGGATCCACATTGAGTTCACACATTATGACCAGTTAACGTACCTCTTAAATCTTTT
TGAGTACCTCTTTCATTGCTTTTGTTTTTTGTTTCTCTTGGAATTTACTTAGTAAATAGG
GAAAAAAAGCAACAGACTTTTGCCAGTTACATTGCTGAGGTAAGTCTTGGTATTTCCTAT
AAATTGATAGTTGGGTTTAAGTTCTTAATCAGGTTCAGGTTTAGTTGTTTTCCTTAACTG
TTTTTATAAGTTTTGCTGTGTTCCTTTATCACAGAATCCGTAGGTACATAATGTGTAGCT
GTCTTACTTGAGATTATTATTGTGCTAGAATTAGGATGCCATTTAACTTGTTGAGTTGCA
AGAGAAAATATTTTTGTCTTTTCACTGTGAATCTTGTTTATTTGTGCCATTATTTTAGAG
CAGTTTTGTAGCATTTAATTCCATGTCAATTTTCAAAAATTTTAAGGCTTTTCACCTTGA
GTAATTGCTTCAAAAATTAAGTGTCCAAAAATATTAGCTAATTTTATAGTTACTACCCCA
TACAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGTCATTGTTTA
TCAGATGCTAAAGTGAAAATGAAGGAAAGTACTTCAAGAGCTCTCCAAATGAATTAGATG
ACGGCTGAGGTGATTATATAAAGATTTTATTTATTTGAGAGGCAGAGTTACAGATGGAGA
CAGAGACAAGGGTTAGTACTTGTAAGGTGAAAAGATACGTAGAATTAATTCTGCTTTTCT
ACAGTTTTAGGTTCTTTCCATCTAGTATATTTTAATTGTTGTGAAAATCTAGGGAGGAGA
TCTTTCTCTTGACATTTATATAAATGGAGATTTGGTTTAATTTGTATTGATGATTAAGAG
TATAAATCTTCAACATTTTAATGGACATTTTACTACTAATGTATAAATAGGGACTGGGTT
GTGGTATAGTGGGTTAAGCTGGAGCCTGCATGTTGGCATCCCATGTGGTCGCTGGTTCAT
GTCCTGACTGCTCCACTTCCAGACCAGTTCCGTGCTTATGGCTTGGAAAAGCAGCAAAAG
ACGAGCCAAGTATTTCGGCCACTGCACCCATGTGGGAGATTTGGAAGAAGCTCCTGGCTT
CAGCCTGGCCCAGCCCTGGCCATTGTGTCCATTTGGGGAGTGAACAAGATGTAATATATT
TCTTTCTCTCTCCCTCCCTCCCTTCCTCTTTCCCTCTCTCCATCCTCCACCCTCTCTCTT
TCTGTAAATCTCCATTTCAAATATAAAATCTTTTTAAAAAGTGTCTAAACTTTCCAAAAT
AAATGCATAAATACTGTGCATAAAGAAAAATTGATTATAAAATCAATAGCAATTATAATA
AATTATACTATCTTTTATGACTAGGAAAAGATTCTGAATAAACAGATTGCCCAAGCATTA
CACATTTTAGAACAAGACTTTTTTTTTTTTTTTTTAAGATTTTTTAGTTATTTATTTGAA
AGTCAGAGTTACAGAGAGAGGAGAGTCAGAGAGAGAGGTCTTCCATCTGCTGGTTCACTC
CCCAATTGGCCGCAATGGCCGGAGCTGCGCCCATCTGAAGCTAGGAGCCAGGAGTTTCTT
CCGGGTCTCCTACATAGGTGCAGGAGCCCAAGGACTTGAGCCATCTGGTACTGCTTTCCC
AGGCCATAGAAGAGAGTTGGATCGGAAGTGGAGCAACCGGGTCTCGAACAGTGCCCATAT
GGGATGGCAGTGCTTCACGCCAGGGTGTTAACCCACTGTGCCACAGTGCCGATCCCTAGA
ACTAGACTTTTAAGAACCTATTAAAAGCAGCGAATCTTAGCTTTTTTAAAAAAATTTTAT
TTATTTGAAGGGCCATGTTAGAGAGGGAGAGACAGAGATCTTCCATCTATTGTTCACTCC
CTAAGTGGCTGCAGTGCCTGAGGCTGGATTAGGCCAAAGCCATTTGCCAGATTCCATCCA
GGTCTCCCTCATGTGTGGCAGGGGCCCAAACACTTCCGCTTCCCAGATATATCAGCAGGG
AGCTGGATAGGAAGAAGAACAGCCAGGAATCAAACCAGCGCTCATATGGGATATTGGCAT
TTCAGGTAGTCGCTTAACCTGTCAGGACACAACGCCAGCCTGGGAATCTTAGCCTAAAAA
TATGTACATAGAAAGTTTTATATATAATTTAAGGTTCATGTGTATACTTCCTGTTTTCCA
TGGATCTTCATACTAATAATAATACATGCTTGGTCCTCATTGTTTTAATTGTTTATTGTA
CCTGAAGTGTCTTCCCAAGATATCCATATGGCTTCTTTCCTTGCCTCCATCTGTTTACTT
TTCAAATGTCACCTGAGCAGAAAGGTGTTGTTTAAATATTCTCTCTTGGTCATCTCTATT
TTTGCTTATCATTTGATGTTGATTTATTTATTACTTACTTCTCTCTGCTGGATTATTAGC
TGTTTGAGAGGAGGTTTTTATTTTTAAAATTGAATGATTATTTTGAAAGGCAGAGTTCCA
TCTGCTGGTTTACTGCCCAAGTGGTCACAACAGCTGGGACTGGTCCAGGACAAAGTCAGT
GAGCCCACAATGCCATCTGGGTCTCCCACATGAGTTGGGCAGGGCCCCAGGTACTTGGTC
CATACTCTGTTGCCTTCAAACCAAGCACATTAGCAGGGATTTGGATTGGACATGGAGCAG
CAAGGACCCAAACCAGCACTCCAGTATGGGATTCCACGTTGCGTGCAGCTGTTTAACTCA
CTGTGCCATAATGCTGGCCTGGAGAGGAATTTTTATTTTCTTCACTGCTATATCACTAAT
GTCTAGAATATTCCCTCATATACTGTAGGCATTTGATGAAAAACTTGTTGGACAAATTAA
TAAAGTAAATTTATCTGAAGATTAATTGTTGCTTAGGATTGCAAACATCTTTTGTTTTTT
TCTATGTATTTTTAAATGTTATAGTTTTTTTAATATTTCACCATTTATATCTTCAGAACA
TTCTTTTGAGGGTTTTGAGATTCCTCAACATCGTTGACATCAAGTGCTTTTTTTTTTTTT
TTTTTAAGATTTATTTATTTGAAAGAGTTACAGAGAAAGGTAGAGACAGAGAGAGAGGTC
TTCCATCCACTGGTTCACTCCCCAGATGGCCGCAACAGCCGGAGTTGAGCCGGTCCAAAG
GCAGGAGCCAGGAGCTTCTTCCAGGTCCCTGTATGGGTGCAGGGGCTCAAGGACTTGGGC
CGTCCTCTGTTGCTTTCCCAGGCACATTAGCAGGGAGCTGGATCGGAAGTGGAGCAGCCA
GGACACAAACCAGAGCCCATATGGGATGCCAGCACTGCAGGCTGGGGCCTTAACCCACTG
CGCCACAGCACTGGCCTTGACACCAGTTCTTAAACCCATATTACAAAGTATGCATAGTTG
TTAGTTGTAGCAAGTTTTTATTTGATAAATTACTGGATTTATTCTATATTTTTATTGGAA
TTGATATCTTTCTACAGGTTTCATTGTTTGCAGAACTTTTCAATGAAATGCTTCAAAGAG
ATTTTGGCGTCAGAATATATAAATCATTACTGTCTCTTCCTGAGAAAGAGGACAAGAAAG
AGAAGGATAAGAAAAGCAAAAAAGATGATCGAAAAGAAAAAAGAGAAGAAAGAGACGATG
AAACTGATGAGCCAAAACCAAAACAGAGAAAATCAGGAGATGATAAAGATAAAAAGGAAG
ACAGAGATGAAAGGAAGGCATGTGATTATTTCCATGATCGGCAACCTGATTTAGACGTTC
TGAATGTGTGTTATTATAACCCTTACTGTACATGTGAAATTATTTCAAGAAATTTTAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCTGTGGCGCAGCGGGTTAAAGCCTTGGCCTGAAGTGCCGG
CATCCCATATGGCTGCCCATTCTAGTCCTGGCTGTTCCTCTTCTGATCCAGCTCTCTGCT
ATGGCCTGGGAAAGCAGTAGAAGATGGCCTAAGTTCTTGGGCCCCTGCACCCACGTGGGA
GACCTGGAAGAAGCTCCTGGCTTCGGATCAGCACAGCTCCAGCCATTGCGGCCATCTGGG
GAATGAACCAGTGGATGGAAGACCTCTTTCTGTAACTCTTTCAAATAAAATAAATCTTTA
AACAAAAAAAAAAAGCCGCTGTTTCAGGAATGTCAATCTTTTTGTTTACTTGAACAACAG
GTAAAGAAACTGCTGAATAGAGTAGTGCTCCGTGAATCTTGCTTTTACCGGAAATTAACA
GACACCTCCAAAGATGAAGAAAATCATGAAGAATCTGAATCACTGCAGGAAGATATGCTA
GGTTTGAATATATTAAGGTCTTACTTTTTTGTTGATAAATTATTAGAGATGAAAAAATAA
TACAGTGTTTTATATTATAGGAAACAGGTTGTTACTTCCAACACCAACAGTAAAGCAAGA
ATCAAAGGATTTGGAAGAAAATGTTGGCCTCATTGTGTACAATGGTGCAATGGTAGATGT
AGGAAGCCTGTTGCAGAAGTTGGAAAAGAGTGAAAAAGTAAGAGCTGAAGTAGAACAGAA
GCTACAGTTACTGGAAGAAAAGACAGGTAAGGGACAATGTTGGTATGTCAATACTTTTTA
CCACCCTGTTAGGAGATTATATATATATATATATATATATATATTGATTCCAAAAATTTT
AAACTTTCTTCATGGTGTTGTATAAACTTGTGATGTATGCAGGTCTGTCTGTCTGTGTAA
CTCAGTAGCTGAGTGTACTTGTCAAAGGCTGTGACTTCACGCTTTCTGGCGGGAGGCCCT
GTGCTGCCTGAACAGGGCAGCGGGGCTGCCTGCTGTCTGGGCTGCACCTCAGACACGGAA
CTCCATTGACTGTGCCGGATCTTCAACTTTCCATATAAGACCTGGGGGCAGAGCAGCAGC
AGATACTGACACAGTCTCCAAGTTATATTTTAATCCTTTTTTCCATGACCTTTTTTAAAG
TAGTCTCCTACATATCCACACTTGCTTGTACTTGTACATAAACTGGCATTTAATGCACAT
AATGTAACTTTTGATCATTTCTGCTTAAGGTTTGAAATCACTTTTGCTTTATAAGAAAAT
CTTAGCTATTCATGTGTTCAGATTCATTTGTTCTGTCTCTTCCTTTCTAATTCTATGTAA
CTTCTTTTAGTCTAAATACCATCTGCAAATGGAACCTGGGTTTTGAATTAATACTCATCA
ATGTTTTAATGAATTCTTCAGTGTGATTTGCAATTGATTTTTATAAGTATGTGTACATTT
TAGTTCCATAACTCTGAATTGATTAGAGACAAAATTGTGAATTTTGGATCTTTTCTTTAA
ATAGATGAAGATGAAAAAAACATACTAAGTTTGGAGAATTCCAACAAAAGCCTCTCAGGT
GAACTCAGAGAAGTTAAAAAGGACCTTAGTCAGTTACAAGAAAACTTAAAGGTTTCAGAA
AACATGAACTTGCAATTTGAAAATCAACTGAATAAGACAATCAGAAACTTATCTACAGTA
ATGGATGAAATCCACACTGTTCTGAAGAAGGTTAGAAATTTTAACATTGTTATGGTTCCC
TTCAATGTTTTAAGTTTCTGGCATTTTATTATTTTATTGATAAACGTTTAGTCATTTTGT
TGTAGAAGTAAATAATGGTAGTGTAAGTCCTTTAGGAGATTCAAAAGTGACTTTCCAAAG
ATAATATTTTCCTAAAACTTATTTCACTATTTATACGTACAGACTTTTTAAAAAGATTTA
TTTATTTGAAAGGTAGAGTTAGAGGGATATAGAGATCTTCTATCCACTGGTTGACTCTCC
AGGTGGCCAGGGCTGGGCCAGGCTGAGGCCAGGAGCCTGAAACTCCATCTGGTTCTCATG
TTGGTGGCAGGGACCCAAGCATTTAGGCCATCTTCTGCTACTTTCCTAGGTGCATGAGCT
GGATCAAAAGTGGAGCAGCCAGAATTTGAACAAGTGCTCATGGGATGCTAGTGTGTCAGG
TGGTAGCTTAAACCCACTGTGTCACAACAACATCCTTATATGTATAAATCTCTTGAAGCA
AATTTTTTTTTTTTCTTCTTTGAAAGATTTTATTTGAGAGCTACAGTTAAAGACAATGAG
AGATACAGGGAGAAAGGTCTTCTATCCACTGGTTAGCACACCACTGGCCAGAGCTGGGTC
GATCTGGAGCCAGGAGCTTCTTTCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACTGGCATCCAT
ATGGGATGCTGGCGCTGCAGGCAGAGGATTAACCTAGTGCGCCACAGAGCTGGCCCCAGA
AAATTTTCAGTTTCTTTTAGAACCAGAGAGTGAACTTGGGGAAGATAAAAACATTTTTAA
AAAAGAATTTTTGGGGGGCTGGCGCTATGGCATAGCGGGTTAAAGCCCTGGCCTGAAGCA
CCAGCATCCCATATGGACACTGGTTCTTGTCCTCTTCCCATCCAGCTCTCTGCTATGGCC
TGGGATAGCCCTAGAAGATGGCCCAAGTCCTTAGGCCCCTGCATCCATGTGGGAGACCCG
GAAGAAGCTCCTGGCTTTGGATCAGCTCAACTCTGGCCATTGTGGTCAACTGGGGAGTGA
ACCAGCAGATGGAAGACCTCTCTCTATGTCTACCTCTCTTTCAAATAAATAAATCTTTTA
AAAAAATAAAAAATGATTTATTTGAAGGAGAGAGTAAGAGAGGTTTTCTGTCATTTGGTT
ATTCCTCAAATGGCTGCAGCATCCAGATCTGGGCCAGACTTAATCCAGGAACCTGGAACT
CCATTTGAATCTTTAATGTTGATCAAGTAGTTGGGCCAACCTCCTCTGCTTTAGCAGCAG
GGCAGCCAGGAATCAAACCGTCATTCTGATCAGGATGCAGGCATTGCAGGTCGCAGCTTA
GCTTACTGTGCCACCATGTGGACCCCAAAACTATTTTTTCAGAAGTGGTATTGGGTAGAA
TTGAGGGAAATTTTTTTGGTACCAAGATATTGAAATTATCAATATTCTTATCACTTAAAA
AAATTAAACAGTAATCCATTATAAATTAACTTCAGAGTAACATCAGAGAATCTAATGTAA
TCTTTTTCCTTATTCTTTTATAGGATAATGTAAAGATTGAAGACAAAGATCAGAAATCCA
AGGAAAATGGTGCAAGTGTATGATAAAATGTGCCGTAGTAATGAGGAATGGTGTTAAATA
ATGTAATATATAAAATCATGACATAAGAATGTTTGAAGGTGATGCATGTTTGATTTTAGT
AGTATAAATATGTTAGCTCAAATGATGTATAAAGTTTTATCAATGTGTGTCTGCTTTTGA
AAATTGCTTGTAATTCCTAGCATCTGAATTATTAAACACTCCTTGAGTGAAATAATTTTG
CATTGCAAAATGTTTTAGGATGAACTTTGTTATAGTTTTAACCCCAATAAAGTTCATCAG
TTTAATTGACAGTAGTATTTACTTATGAAATATTGGTTATTAAGGTACCTAGAAAAATTT
AATTTATTTATAGAATTTTTAGTTTTTAAATTTTTTAGTCCATCTTTTAAAATTTCAGTA
CAAATCATAAAGTAGCATGATGCTTAAGTTTTTCAAGCTTTTGAACCAGAAATTTTTTTT
ACTTTTCACTAAAAGATGCCTTTAATTACTGAAATTCCCTAAAAGCATTCAGTAAAACTT
CATCCAAAAGACAGTATATCAGAAAGTAAAAAAAGTAACAATTAGGATTGTCACTGTATA
TATTAGGCTTTACATAAAAATAGTCTTGTTAATATTAATAGTTTCAGTTAATTGTTCTAC
TTTCCAAGAATAGTATCTACATTACTTTGTCAAATGTACAGTTTAGTATCAAGCCATTAG
ATGTCAGTGTGATGCTTTAAGTCTTTAATTAAAAATAATTTTTTATTAATCTGTGTACTT
CCTTTAGGAATATTAATAGATAATCAACTGTTCAGTCAAAAGTAGGAAATGCAATTTATT
CTAAAACAGTGATTATTTATAAGGGCTGCATTTACCCCACAAGGAACATTTGACAATGTC
TTCAAATATTTTTGTCATAGTTGGCTGGGTGCTCCTGGTATCTGGTTGGTAGAGGCCAAA
GATGTTGCTAAACATCATGTGATACATAGAACAGCTCCCACAAAATGGAATTATCCAGCT
CCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1171, 1555..1599, 4063..4095, 5609..5802, 7191..7305, 7404..7596, 8188..8317, 8418..8579, 11625..11850, 12606..12719, 13249..13251, 13254..13332, 13334..13364, 13366..13372, 13376..13378, 13380..13417, 14215..14425, 15234..15317, 16942..17127, 19771..19962, 23537..23776, 23978..24089, 24190..24272, 24373..24519, 24960..25080, 25160..25345, 26104..26309, 28043..28102
1001..1171, 1555..1599, 4063..4095, 5609..5802, 7191..7305, 7404..7596, 8188..8317, 8418..8579, 11625..11850, 12606..12719, 13249..13251, 13254..13332, 13334..13364, 13366..13372, 13376..13378, 13380..13417, 14215..14425, 15234..15317, 16942..17127, 19771..19962, 23537..23776, 23978..24089, 24190..24272, 24373..24519, 24960..25080, 25160..25345, 26104..26309, 28043..28099
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved