Oryctolagus_cuniculus Locus O02749_RABIT
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus O02749_RABIT
Oryctolagus_cuniculus
O02749_RABIT
GeneScaffold_2566
SNORA48, SNORA67
3040..3171, 5903..6045
7425
ACATAGGGATTACTGCCTGCCAGATCTTCAAACTTTTTTTTATATATATATATATAAAT
GCCACGGTCCTGCTCTGGTCAATAAAGGATCCTTTGGAGATAAATAAGTGGTGGTGTTCC
TTAAGGGGCCTCAAACTAGTGGATATGCTGTACCTCGGGCCTTCGAGCCAGTGCGTGAGC
TTCTCGTTTTTTTGCATCTTGAGGTTTCAGGGGCTCAGTCACCCAGANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTGTCTTTGCTGCAGGGCAGAAC
ACAACTAAAATTTGGGCGGTAGAGGAAACCTGGAGCAGAAGGAAAGGGAAGTGGTAGTTT
TGGGAGCCCGGAAGTCCCTGGAGGCTAAGACCTCGCCCCCCTTGCGTGATAGGGTCTATG
AAGCCACATGACTAAGGCGCTATCGCCTCTGCACGTGTAAGGGTGCAGGGCCCAAGATGG
CTGCCAGGCCTCGAGGCCTGACTGCTGTATGTCACTTCCGTACCGGCGAGAAAGGCGGGC
CCCCTAGCCAATGAGGCCGCGGGGCGGGCCCTCGCCTTGATAGGCGTTCAAGCTATCCAA
TGGCGGCTGCGAGCCAGAGCGCCTACGAGCTAACGTCACGCCGAGTTGCCGAGCGCCGCC
AGGCGGGGCTGAGGCGGCCAAGCCAATGCGATGGCTGGGGCGGGGTCGGGCGCTCTATAA
GTTGTCGATAGGCGGGCCCTCCGCCCTAGTTTCTAAGGATCATGTCTGCGAGTCAGGATT
CCCGGTAAGAAAGGCATTTGCAAGAGGTTGTGGCTACTCACCCTGCCGCTCCCTTCCGAG
GGCCCCGTCGGGGAGGGGCTGAGAGCGCCACCAGGGTTGCGGGGGAAACCGAGCCGGGAG
GAAACGTCCGGCGGTGGGGGGAGGCGGGCCGGGGGCAGATGAGCGGCCGAGCTGCCGCCA
GAGCCGAGGCAGAGGGCGAGAACAGCCCGCGTAGGGCCCGGAGTGCGAGCTTCGTTACGA
GGCCTCGACCCGAGGCAGTGGCGTACGTGAAGCCCCAGCGCTGAGTGACAAAGGCGAGGT
CGCGACCCAGCGAGGAAGAAGGGCCGCGGCGGCCGCCACTACGTGGCCATAGCCGGCGGT
CCGGTTGCCCCCCTGTGCCGGGGGGAGGGCCCGCGCGTTGGGGTTCGGGAGGATTCTGGC
GGTACCACTCGCGAGAGGCGGGGGTGCCTGGGTCCTCAGGTCCAGTCGCTTCGTCGGGTT
GAAATACGGGTCGGGGAAGAAGAAGCCGGCCGTTCAGTGTGCTGGTTTTCTTGACGGCCA
GGACTGAGCCTAACCCCGAGGAGCGGCCGCGTGAGGCACCAGGAGCCCACCCGGCGCCGG
GCGGGCGGGTCCATTTTGCCGCACAAGCCGGGCATTTGGCAAACTGCGGATGGGCAGGTC
CACTTTCCTTCGGGGGTGAGCGGCCTGAGGTATGGGAGGGCGACGCCATTTCGCGACGGG
GGCGGGCGGGATGTGGATTGTTCCATGGAGGGGGGAGACGCCGCCGGGTGGTCGAGGGAG
CAAGCACATGGCGGCCTGAGGTGTTCCCCTCCCCCAGTCCGCTTCGCTTCTAAGTGTTGT
GCAATCTCCCCCTGTGCTAGCTCGGCTGGGGCTCATTGTGCGCGAGGCCGCCACCGCCCG
CGGCCTCCCACATCCGGGCACCGCGAGGGGGGGCTCGGCTGGAGGGAGAAGGGGAGGGCG
CGGGCGGAATGACGTGGGGGGGAAGGGGATGGCCTGCCCTCCGATGTGGGAGGTGAAGGG
CGGGACTTCCGGCGCGCTGGTGCCGCGAGGGGCGGTGCACGCGCTTCGGCTTTGAGCCGC
GGGGCCTTGGGACACGTGGGCCGGCGGCAAGCACCGCATCCGGCCCCATGAGCCTTTATG
CTTCGAGGGAGGTTTCCCCTACCGTGTGGGAGGGGGGGGCCTGCCCTGATCCGCTCACAG
GACGGGGCAGAGGCCCTGACTCAGTTTTAAAGTAACTTGAGAGTGTCTTGACCACTGGTG
GGAGTTAGATTGGGGCTGAGTGCTGATGGCATCATGCTTGGCCGGCTGCTGATAGAGCCT
GACTGTCAGGATGTCTGGCGTGGTTCAGGCAGGCAGGGCACAAAATCCAATCTTTGAATC
AACAGATCCAGAGACAATGGCCCCGATGGAATGGAGCCCGAAGGTGTCATCGAGGTGAGA
CTGGAACCTGCCACCACTGCCCTCCACCTCTGAGAGGCCGCTCTCTCTGTCCCCTGGTTC
CTGGAGTAGAAGAGACTTGGGTCTTGGGTCACCAGAATTCAGTGCGAATCCCGAGGACAT
AGTGTAACCCCGAGTAGTACAGCTCTGCCCCAAAGGAGTCTTGACCATGGTTTGTAGTGA
ATCGATTAGTATTCCTGAGGCTAGGTGTGAAACGTGCCATTCATGCCCCTCCAACCTCAC
AGCTAAAGTGGACTGGCCCCTTAGAGTGACTTCCCAGCCCACCTGGAACCAGCGGCCTCC
CTCCAAGGTGTCAAGGTTGTGGGTTCCAAAGCGCTGGCCCAGGCACCAGTTGGTGTTTGC
TGAAGCACAGCCTGTGCTCACTAATAAAGCTTCCGTTTCCTTGCCTCCTACAGAGTAACT
GGAATGAGATCGTTGACAGCTTTGACGACATGAACCTCTCTGAGTCCCTCCTTCGTGGCA
TCTATGCCTATGGTTTTGAGAAGCCCTCTGCCATCCAGCAGCGTGCCATTCTTCCTTGTA
TCAAGGGTGAGACCTTTTGGCCCCAGAACGGATCTGGCACTGTCCCTGACTGGGGTAGAA
TGGCTTTGGGTTAGTGGTGCCCATCTATCAGCCAGGGACAAAGCAAACCCTTGTTTATCC
CAGCTTGGCTTTTGGTCTGTGCCCCTGCCTGGGTCATGCCTGGGACACACGGACTGCTGG
CTTGCCTTTAATGAGGTACTGTTGTACACAGTTCTCACAGCCCTGTTTTCTGGCTTAGTG
CAATGCTAGAGTTGGTAGCCTGATCGTTCTCTGGATTTGCCCCCGTTATGTCACCATACT
GTGGTGGGGAAGGTTTGTAAGGCACTTAAGGCGTCATTCATGATTGGGTGCTTGTTGATC
TCAGCTCATTGAGTTAGGCATAAGTCAGGATTTGACTGTCCCATGAGCCCAAAGTGCAAG
TTCTCCGCCAGATCTCATTTCTTGTCTGTCTAGGTTATGATGTGATCGCTCAAGCCCAAT
CTGGGACTGGGAAGACGGCCACATTCGCCATATCGATTCTCCAGCAGATTGAATTGGATC
TGAAGGCCACCCAGGCCTTGGTACTAGCACCCACTCGGGAATTGGCCCAACAGGTGAGAA
CGTGGCTTCTTTCTCCTGGAGGAATAATGAGCATAGCCTGAAATCCCGGGGGGTTACTTC
CAAGGAGGAAGAGGATGCTCGGGGGGTGGGGTGGGATGGGGCGGTGATTTTTAGCTGGGT
TAATTATATGTCATTTCCTACCCAAACGTAACAGCTGCCACTTCTCCACCCATTTCCTGA
GTCAAATGACAACACTGCTGGGCCGGGCCTGACTGGCTAGGCAAGTTGGGTGACTGTTTA
TGCACACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTAACTGGCT
ATGAAGCGGGTAAATAAATAGACCACAGTTGCCCTAAAGCTGAGGGTTCAGTTACATGTA
TCATGGTTGTTGGGAAGACCAAATCCGTGGAAAAGTGAGATGGGACCTGCCACGGTTGTA
GCTAACAGCTGCACACCCACCTCTCTCTGGTTCAGATACAAAAGGTGGTCATGGCATTAG
GAGATTACATGGGTGCGTCCTGTCACGCCTGCATCGGGGGCACCAATGTGCGTGCTGAGG
TGCAGAAGCTGCAGATGGAAGCTCCGCACATCATCGTGGGCACCCCTGGCCGCGTGTTCG
ACATGCTTAACCGGAGATACCTGTGTGAGTAGCTCAATTTTCCACTGCCCTGTATCCCCC
TCACCTTAGCCAAGCCCTCCTTGTCGGCCAGCTTCGTTCCCAAGGCCGCTCGTTCTCCCT
CCCTGAAAGCTGCTCTGTGATGAACCCCATGCGTGTCAGCTGAGCCCTGGCTTCCCTGTC
CTCTCAGCCCAAGCCCAGGGAGTGTTCTACTTCCTGGGGCTGTTGATTGGCCTCCAGGGC
AGCCCTGGGCAAAGGATCAATCTCTGTATTCTGAGAGCAGACTGCCTCTGTCTCCCCTGT
TCTTCAAGAAAGTTGGATATATTGCCTGTTTCCCAAGCTACTACATAGTAGTATTTCTTC
CATGCCTACAGCTCCCAAGTACATCAAGATGTTTGTACTGGGACGAAGCTGATGAAATGT
TAAGCCGTGGATTCAAGGACCAGATCTATGACATCTTCCAGAAGCTCAACAGCAACATCT
TGTGAGAAAGGCCGTGCTAGAGGAGCTGCCGGGGAGAGCCCTTTGCGTCTCGCACCTTCT
GTGGGACTGGGGGACGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGAGT
ATAGCCCCTGACTGACTATTCGCCCCAACTCCAGGAGTGGAAAGCTAGACACACTATGTG
ACTTGTACGAAACCCTGACCATAACCCAGGCTGTCATCTTCATCAACACTCGAAGGAAGG
TCGATTGGCTCACTGAGAAGATGCACGCCCGGGACTTCACCGTCTCTGCCATGGTGAGCA
TCCTCGCACGCCAGCCTGTGTGAGCCCAGCTCCCCTGTGCTCATCTCGATCGCTAACCTT
CGGTTTTCTCCCTTAGCACGGAGATATGGACCAAAAGGAGCGAGATGTGATCATGAGGGA
GTTCCGCTCTGGCTCTAGCCGAGTACTGATTACCACTGACCTGCTGGTGAGTAGGGGGAT
TTCCAGCGCTGGAAGGCAGAAGAATCCAAGGTGATTCCCTCTCCCAGGGGCCCGACTAGT
GCCTCTCTCAGGAAAGTAGCAACTTGGAAGAAAATCTGGCATGCCCAAGGGCTCTCAGAG
CAAGGGGCCGCTTGCTTCCTTTGCCTGCCTTGGGCTGCCTACATGCACTCACTGAGCCCC
TTCCGGATGGACTGTGTGCACTGAATTCTTCTCTGTCTCCACATAGGCCAGAGGCATTGA
TGTACAGCAAGTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGGGAAAACTATAT
TCACAGGTGAGTGTGGGTCTGGACCTCCTGCCTAGCCCCCTGCATCCTGGGCGGAAGTTT
TGGACATCCCTCAATGCTTGCAATGTATCCTCGTGTTTCAGAATTGGCCGTGGTGGACGC
TTTGGCCGTAAGGGTGTGGCTATTAACATGGTGACAGAAGAAGATAAGCGGACTCTCCGA
GACATCGAGACCTTCTACAACACCTCCATTGAGGAGATGCCCCTCAATGTTGCTGACCTC
ATCTGAGAGGGGCTGTCCTGCCACCTAGCCCCAGCTGGGGTTCAGTCCTCAGGGGCTGAG
GAGCAGCAGGAGGGGGGAGGGGAGGGAGCCAAGGGATGGACATCTTGTCATTTTTTTCTT
TTTTTTTTCTTTGAATAAATGTCACTTTTTGAGGCAAAAGAAGGAACCGTGACCATTTTA
GAAACCCTTTTCTTTGGGGTAGGCTCTTGCCCCAGGCGCCGTCTCCTCCCAAAAAACAAA
ACAAAAAACACTAATCCATTTCCCTAACCTAGTCACCTCCAGGTCCCAGAGGCTCTCCCA
CCCCAGCTGAATCCCTCCGAACTTGATTCAGGGGCCGAAAACAAGTCACTCAACCTCATG
TGCCGGACCAAACATGCAAGGAGCAGCCCCTAGTGAGGTTGCCCAGTGATTGAACCCAGC
TGGGGGAGCAGGGGAGAGAAAGTGGTAGCCATTTTTACATTGTTTTGTATAGTATTTATT
GATTCAGGAAGCAAACACGAAATTCTGAATAAAATGACTTGGAAACTGCCTGTTGGGCTT
CTCATTTCTTCCTTCCCTCCTACCTGCTACTGGGTATGTCAGCTACCTTAACTACCTAGA
AGTTACCAGAAGAAGCCATTTTCTAGGTCCAGAAAGTTGTAATAGGATAATAGGAGCCAC
TGAGGGCTTGGGTGTGTGCTGTCATAAGTGGTCACATGTCTCGCTAGGAGGAAGTCATGA
AGCATGGTGTGTGGAAAGGGGCTGGCCAGAGGAGGGGCCTGCTGGCTATAGGGGCTGGTT
AGAACCACTGGCCCTAACTGCCTAGTGAGGTTTGCTAAGGGTGACAAACGGGCCCCACCA
ATCAACTGCCTCACGGCTCCATCATTCTGTAGTCATGGGACAGCCTTGACTTTGGCCCTG
ACACCTCCCACTCGTGAGCTGGGGCCAATAGTCCCCTAACAAATGACTAGTGACTAAGAG
ATTGGTGGCTGGAGCCCGTGGTGCTTGAGTCAGCCTGGGGGTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 2405..2453, 2873..3005, 3453..3592, 4235..4403, 4751..4778, 4780..4858, 5154..5297, 5554..5561, 5563..5692, 5776..5865, 6106..6185, 6281..6425
1001..1023, 2405..2453, 2873..3005, 3453..3592, 4235..4403, 4751..4778, 4780..4858, 5154..5297, 5554..5561, 5563..5692, 5776..5865, 6106..6185, 6281..6422
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved