Oryctolagus_cuniculus Locus RHBDF2
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus RHBDF2
Oryctolagus_cuniculus
RHBDF2
GeneScaffold_5688
SNORA28
29644..29761
32437
GGTGGGAGGTTGAGGGCCTCCCAGACTATGCAAATGAAGGGCAGGCTGGTCCTGGGCTT
TGTGTCAGAGTTCGGTTTGAAGCAGCTTTAGACAGATTTGTTCTCGGACGGGGCTGCCTA
CCCTGCCACAAGTCACCCACCACCCGTGGGGTCGTGCCACCTCTCCCTGTCTCATTCCAG
CCCCCTGCCCAGCATGGCATCTGCTGATGAGAATGGCGGGAGACTCTCCTCCGTGTCCAG
CAGCCGCCTGCAAAGCCGGAAGCCGCCTAACCTGTCCATCACCATCCCACCACCCGAGAC
ACAGCCCCCGGGGGAGCAGGACAGCATGCTGCCGGAGGTGAGGGCCCGGCCTGGGGGTCT
GCTGCCCCGCCACTGGCCACAGGTGTGCCCAGACGACACCCCTCGGGTGGTTTCACTTCC
CCCAGAGCCACTGCTCGGAAAGCTCACACCTCCCCCTCCCCCTTCCTGGTCTGCAGTGGG
CCCCTGAACTCAGGCTGGGTGGCGTGGTGGTCAGGGGCAGACAGGAAGTACTGTCCTCCA
CCTGGCGCTGGCCGTTTGCTGTTCGCCGCGCAGGCTCACTGCCTCGTCTGAGGGCTGGGC
TGTCACCCAGAGCTGCCCGTGCAGCGCCCACTTCCCGGGGGAGGCCGAGAAGTGTCAGAG
CTTCCCCGCTTCCAGCCCGCAGGACCGACTGGGGCCGCATAAAGAGCTCATTGAACACAC
AAAGGGGAGCTGTGTGCGCCGGCCGCCCGCCCAGGCACCGCCCGCCCAGGCACCGAAGCA
GGCCGGGCGGGCGCGGGCGGGGAGCTGGAAACCTCGGGAAGGGGCCGATTAGAACGTGGA
CTGACAGTCTCTTCCCAGCAGGGGCTGAGGCAGAGGCAGCCTGCGGTGTGGGCCCCGCAC
ATCGCCGCCCTCTCTTTCCCTTGTGCCCGCAGAGGCTCAAGAACCCAGCCTACCTGAAGA
GCATCAGCCTCCAGGAGCCGCGGGGCCGATGGCAGGAGGGCGCGGAGAAGCGGCCCGGCT
TCCGCCGCCAGGCCTCCCTGTCCCAGAGCATCCGCAAGTGAGCGCCCCGAGGCCCGGCCC
TGCTCCGGCCAGGCCCCTGCAGAGAGCCGAGAGCGGGCGGGTGTCGGGTCCCCCTGCCCA
GCGCAGCAATGGTGGAGGTGGAGAGAGCTCCAGGGGCCGGGCCCTCCCAGCCGGCACCCC
GGGTCCTTGGGTTCCATGGGGGCTGGAAGGCTGATCTGCTCCCCACCTGTGCCGTGGGCA
TCACCTCCCCGCACGCGCACTCGGTGCACACGCGCCGTCACCCTCACACACGCCCACCTC
CTCTGCTCCCGCAGGGGCACAGCCCAGTGGTTCGGGGTAAGCGGCGACTGGGAGGGCAAG
CGGCAGCACTGGCAGCACCGCAGCCTGCACCACTGCAGCGTGCGCTACGGCCGCCTCAAG
GCCTCCTGCCAGAGGGAGCTGGAGCTGCCCAGCCAGGAGGTGCCGTCCTTCCAGGGCACC
GAGTCCCCCAAACCCTGCAAGCTGCCCAAGGTGGGCTCCAGGAGGCGCGCGCCGGCCCGG
GGGTGGGGTGGGGGCGGCTTCCCCGGGGGGGCTCTGCTCACCGCTTCCGTCCCGTCCAGA
TCGTGGATCCACTGGCCCGCGGCCGGGCCTTCCGCCACCCGGACGAGGTGGACCGGGCCC
ACGCGCCGCACCCGCCGCTCACGCCCGGGGTGCTGTCCCTCACCTCCTTCAGCAGTGTGC
GCTCCGGCCTCTCCCACCTGCCCCGGCGCAAGAGGATGTCTGTGGCCCACATGAGCTTCC
AGGCCGCTGCCGCCCTGCTCAAAGTGAGCCCCTGGCCCAGGCTGCTTGCTCGCCCAGAGC
ACGTGCCGGGACCCCGAAGCCCAGCGCCAGTTCCCTCGGGAGTCCTCCCCTGCCTCTCGC
TCTGCAGGGGCTCCCGAGCTGGGGGGTGGCGAGTGGGCGTGTGCTGGCCACTCACGCCCC
TGTGGACGCTGGCACGGGCGGTGGGGGTGGGATGGGGGGAGGGAGGGCTGCGGGGCCAGA
GGTGCAGGTGTCAGCCGTCCGAGCAGGAAAGGTGTGGGGCTGAGCCGAGAAAAACGAGGC
AGGTGCACCAGGACGGGCAGGCGTCCTCAGCAGAGGGAGTGGCCTGTGCAGAGCCCGGAG
GTGGAGAGCAGGAGCAGGGGGCTTCCGTGGGGGCTGGAGGTGGGGTCTGCTGTGCCGTGC
CGGGAAATTGGACAGGAGGACGTGGCTGGAGCCTCGGCAGCGAGGGTGTGAATCCTGTGC
TGCTCTGAGCGCTGGGCCAGCTGCCCACACCAGAGGGCTGGGAGGTTGCCAGGGAAGAGC
TGACCCCAGGCCGTGGTGAAAGCCCACGTCCTGGCCTCTCTCCACCCCCCACCCCGGGGG
CTGCCTCTCCCTGGGCAGATCTTAGACATCGCATGAGTCCTTTGGTGCTGGAGGGCTGGG
GACCTGGTGCTGGACCCCAGTCCTGATGCCCGTGCCCCCGCCCCTGCACAGGGGCGCTCG
GTGCTGGAAGCCACGGGCCAGCGCTGCCGGGTGGTCAAGCGCAGCTTTGCTTACCCCAGC
TCCCTGGAAGAGGACGCGGTCGATGGGGCAGACACCTTCGACTCCTCGTTTTTTAGTAAG
GCAAGCATGGGGTGTGGGCCCTCAGGGACCCGGGCGGGGGGCGGGCGTTGGCCTTGATCG
TGTTCTGCCGGGTCCCAGGAGACACAGAGACTCGTGGGCGGGATGGGTGTTCCCTGCGTG
GAGCTGCCGCGACCCAGTGCGTGAGGACCCAGGCTGGGGATGGCCCCTGCTAGGAAGTCT
CCCCGCCCAGGGCTGACGGGGGCCAGTCTCTGTGACAGTGAAATCCTGACGCCGCGTCTC
TCGTGTCCCCCACCCAGGAAGAGATGAGCTCCATGCCCGATGATGTGTTCGAGTCTCCCC
CACTCTCTGCCAACTACTTCCGCGCCGGCCCTCGCTCGGCCTCCCCGGTGTCCCCGGAGA
GGGTGCAGATCCCTCTGTGAGTGTGGGGCTGGCTTCCCCGCCGCCCCCCCGCCCCGTTGT
CTCAGCCCAGCCCCCACGCTTGCCAGGGCCAGTGCACCAGCTGCTGCCTGGCTGAGAGCC
GCTGTCCTCTCCAGGAAGGAGTACGGCCGAGCCCACGGGCCCTCGTGACCAACCGAATCG
TGCATCGTCGTCCACTGTGAAGCACTTTTGCCCTCGACTCGGGAAGAGCGCACTACGGGC
TGGCGTGGTGGGCAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCAGGACCCCAGGTA
GGGGCTCGTGCGACCCCGCCCCGTCAGTGGCAGGTGGGTGCGAACCTAGAGATGCCACGA
CCCCTCACTTTGCCCAGTCTGGCCTCTGCCTCCCAGGACTGCGAGGAACCGGCCTCCAGC
GAGTGCCCACATCTAGGCCTGACGATATCACCAAGTGGCCGGTGAGAGAGCGCCCCTGGA
GCAGAGAGAGAGTCTGAGAAGAGCAGAGGTGGAGAGCTGTCCCGCCCTCCGGGCCCCCAC
TCCCGTCGGCGTCTGCCCCTCTGCAGATCTGCACGGAGCAGGCCGAGAGCAACCACACCA
GCTTCCCGCACATGGACTGTGAGATCAAGGGCCGCCCCTGCTGCATCGGCACCAAGGGCA
GGTGAGCCGGCGGTGCCCCTCGCCAGGGCCACGCTTCCCATGCTGCCGCACCCCGTCCTG
CGCCGAGCCAGTACCCTCCGACGCTGCTCCCCGGTGCCCCATGGGGGCAGCCCACAGCAT
GAGGGAGAGGGCGGGGGGCCTCCGGGCTGAGGTCTCTGCCAGCGACGCCTGCTGGTCCCA
CACGGGGCTGCGGGCGAGGTGACGCGATGTGCCCTCGCCGCCTGTCCCCAGCTGCGAGAT
CACCACGCGGGAGTACTGTGAATTCATGCAGGGCTACTTCCACGAAGAAGCAACGCTCTG
CTCGCAGGTGAGGCGAGGCGGCAGGGAACGGCCGGGGCTCCTGCGTTCCCTGCAGCCCGC
GGGCCTGACCGCCACGCCGGCCCACCAGGTACACTGCCTGAACAAGGTGTGCGGGCTGCT
GCCGTTCCTCAACCCCGAGGTCCCGGATCAGTTCTACCGGCTCTGGCTGTCTCTGTTCCT
GCACGCTGGGTGAGAGGCCCCGGGACGGCTGCCCACCCGCACCCCAGAGGCAGGCCCCCT
GCCAGACCCCAGTGACCCAGAGACACGGCCCCCACCCTGCCAGCCCCCAGTGCTCCCAGA
GACAGAGCTCTCCAGAGACAGAGCCCCGGAGAGATNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGCCGCGGGCTAAGCCACCACGCGGGCACCGAATCTGG
ACGAGATCCAAATCCAGTTCCAGCTCCTCTGCTCCCCTCTCACCACGTTGTTGTTGTTGT
TGTTTAAGATCTATTTTTGTTTATTTGAGAGGCACAGTTACAGAGAGAGAAAGGGAGAGA
GAGATCTTCCATCCTCTGGTTCACTCTCCAGATGGCCACAATGACCAGGGCTGGGCCGGG
CCGAAGCCAGGAGCCAGGAGCTTCTTCTTCCAGGTCTCCCACGCGGGTGCAGGGACCCAA
GCACTTGGGCCATCTTCCGCTGCTTTCCCAGGCCATAGCAGGGAGCTGGATCGGAAGAGG
AGTAGCCGGGACTAGAACCTGCGCCCACATGGGAGGCCGACGCTGCAGGTGGTGGCTTTA
CCCACTCCGCCACAGCGCCGGCCCCCTCTCTGAATTCTGACAGTAACACACACACACACA
GGGTGTTCAAGAAAACGCGCACCTCTCTCCTCCCCCAATTTGCCCCATGCCCACCCCTCT
GTCGGAAACTTTGTGGACGACCAGTGTGCACCCTGTTTAAAGGTGGGCGAGTGGGGCTGC
CCTCCCGTGCCCGGCTCCTTTTCGCTGAGTGTGCCTTGGCGATAACCCGTATCAGCTTTT
CACAGCTGCACTGACAGCAAACCACACCCCTGTCTCTCTGGAGGGAAAGGTATCGCTGTG
GCGGCCAAGGCTGGGTCAGCATCTTTGCACCTGCATGGCCGGGCAGCTGGCCACCCTCCT
AGGGGACGAGTCCCTGACGTCAGCCGAAACACCACCAGGCGCCCCGCCCCTCCCGGGGGC
TTTCCCTGGAGCTGGCTCGGGTGTGGCAGTTCGAAGGTCAGGCTGTGAATGGGCTCCCTC
TCTCTGCCTCACTTTCCCCATCCCTAAAATGGGGTGGTAACAGCGGCGTCAGTTCCTGGC
GCTGTGCCAGGGCTCGGATGGCGCAAGACTGAGGCAGTCAGCAGGAAGGGTCCGGAATGG
CCCGCCGCCCTCCCCCTTCCTGTCACGCGCTGGCTTCTCCCTTCCCCCTGGCGGAGCGCC
AGACTTTGCCCACGCGCCCTGGTGGCGTCCCCATCTGCCCAGAACCCCAGGACATGCTGG
GGGCAAAGCCAACGGCCGCTGTCTGTGACGGAGGAGCACCCCCAGCTTCGGGCCGAGCCC
CCCCCAGCCTGCGTCCTCTCTGTGGGGTCGGGGGTGCCTGCGCCTCTCTCTGGGTCATCT
CAGCAGCCGGGAGCACCTTCTTCCCTTCTCAACGCCAGAGCCCCGCCCAGGTCACTCCTG
AAACGAGACACACACACACCCCCCGGCCAGAGCCCCGTCCAAACTGCCCGTCTCTGCTGG
GCCAGGCCTCTGGGGGGGGCAGGGCCCCAGATGAGGAGCTCTTCCATCTCATTTGGACTG
GGAATCCACCTCACTGCCGATGTTGTGGGCCCGGACTGATTAATCTGTCGAGCGATTATA
AGGTGTTAGAGCCCCAGGATGGGTTTCGAGTTATAAATAATGTTACTGTAATCCTGCGTG
GTAATTACCAAAGGATCCCCTCTTTGGTAGTTAATGGGAACGAGTTTTTGGATATAATAT
CTTGACCATTAGCAAATAAGAGTATGAGGGATCTATGGATATTGATAAGAAATGTGACTC
TCTAGGTTTTTAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTTTCAGAGCAGGGGGGTGGGGGG
GCCGGGGGATTTGGGGCAGTGTCAGGAGGACTGAGTGTTGTCGCCACCCGTGTGTGATGG
CGGAGGCCGGGGGCGCTGCCACGCACCCAGCCGCTGCGCGGGACAGGCCCCCGGGAATTA
GCCAGCCTGGGCCGCCACCACCGAGTCGCTCTCCACCTGTTCGTCCTCCCTGCCTGGGTC
TCCCCAGTAGTTAGGGGAGGAACTCGGGAATAAACCCAACTGAGCTGGGCATGAGGAGGT
GCGAAGGCGGCTGCTGCCCTGGCGAGAGTCCTCCACGGGGCCTGAGCCGTCCGGGTCCCA
CCAGGCAGCGGGTCCGGGTGCCGTGGAGGAGGGGCTGGAGCAGGGGCCCTGGCTTCACCC
AGGCTGGAGTCCTGGTCCCACCAGGCAGCGGGTCCGGGTGCCGTGGAGGAGGGGCTGGAG
CAGGGGCCCTGGTTCTGCTCAGGCTGGAGTCCTGGTCCCACCAGGCAGTGGGTCCGGGTG
CCGTGGAGGAGGGGCTGGAGCAGGGGCCCTGGCCCCGCTCAGCCTGGAGTCCGGGTCCCT
CCAGGCATTGGGTCCGGGTGCCGTGGAGGAGGGGCTGGAACAGGGGTCCTGGCTTCACCC
AGGCTGGAGTCCTGGTCCCACCAGGCACTGGGTCTGGTGCTGTGGAGGAGGGGCTGGAGC
AGGGGCCCTGGCCCCGCTCAGGCTGGAGTCCTGGTCCCACCAGGCAGTGGGTCCGGGTGC
CGTGGAGGAGGGGCTGGAGCAGGGGCCCTGGCCCCGCTCAGCCTGGAGTCCGGGTCCCTC
CAGGCATTGGGTCCGGGTGCCGTGGAGGAGGGGCTGGAGCAGGGGCCCTGGCCCCGCTCA
GCCTGGAGTCCGGGTCCCTCCAGGCATTGGGTCCGGGTGCCGTGGAGGAGGGGCTGGAAC
AGGGGTCCTGGCTTCACCCAGGCTGGAGTCCTGGTCCCACCAGGCAGCGGGTTCAGGTGC
CGTGGAGGAGGGGCTGGAGCAGGGGCCCTGGCCCCGCTCAGGCTGGAGTCCTTGGTCCCA
AGGACGGCTTCCTGTGTAGGGCAGTGCAGGCAGCCTGGAGCTCAAATATCCCTGGGAGTG
GAGGAGGGGCAGGGCTGAGTTCTGCCCCATAGATTCCCTCCCAGCCGGGTGGCCGAGGCC
GGTGCGGATGCCTCCTGCCACGTGATCTGGAATTTTCCTCCGATCAGACACGGAGCTATC
CTGGTATTTTACACCTTGGAAGCAACCTCCGAGCGGTGTCAGGGCCCCTGACTCCTTGCG
GCCCCCCGTCTTCCCTCCGTGCGGCCGTGGGAACCCTGCTTGGCTGAGGCCCAGCGTGGT
ACCCGCTGCTGGAGGAGTGAGGCTCCCCCGCCCCTGGTGTTTAGCCAGGCAGAGGTGACA
GTGGGAGGACTGTCAGAGCTGCAGTCATTCAAATTGGGCTCAAGGAATGTGCTGTCAGTT
TCCTGGGAACCAGGAGGGGGCAGCTACCTCCCGGCCCTCCCTCCCCACTTTCCTACAGGA
TCTGTTACTGCTGTCCTGTTCTTACTTAAAAAAAAAAAAAATGCTGTATCTACTTGGAGA
GCAGAGTGACAGGGAGAGTATGGAGAGAGAGAGCTCTTCTGTCTGCTGATTCACTCTCCA
AAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTAGTGGAGCAGCTGGGACATGAA
CTGGCGCCCGTATGGGATGCCGGTGTCACAGGCAGCAGCTTTACTTGCTATGCTGCAATG
CTGGCCCTGTATCATATTACATTAGGAACTTGGGTACCTGAGGCAATACTCAAACCAACA
TACTAAACAATGACCACACATTCAAGTTTGCATACTGTAGATGAAAGGTAGGGAACTTTT
TTCTGCCAAGGGCCACTTGGATATTTATTCATAACGCGGCCATACAAAATCATCAACTTA
AAAACTAACCTGCTATAGATTTACTGAATTTCAAGTCTGTCTGCGGTTGCCTTGGCAGGC
CCAGAAGAAACAGATTTCGTGGGTTTTATAAGGCTTGCAGGCCAGACATTCCCGACCCCT
GCAACACACAACAGGGGCAGACGACTGGAGCAGGGGTGAAGATGCTGGCTGGGTGCCCAC
GTCCCATACTGGAGTGTCTGGGTTCAAGTTCTGGCTCTACCAACCAGGCTCCTGCTAATA
CACACTTCGGGAGGCAGCAAGTGATGGCTCAAGTTCTTGGGTCCCCACCACCCACACAGG
AGACCTGGGTGAGTCCGACTGAGTTTCTGGCTCCTGGCTTTGGCCTGGTCCAGCCCTGGC
TGTGTGAGTCTTTAGGGAGCCAATCGGCAGACAGACCTCTGTCTCAGTCTGTCTCTCTGC
CACTGTAATAAAGGACATCCCAACCTCCTGGCTCTTGGCCTGCATTACCAGCTTTTCCCC
CACAAAGCAGGAGCTTCTGTCCATCTTGTTTCTGGGGGGAGCCCACAGGGACCTGCCTGA
GGCTGGCCAGCGACCCCCGAGTTTGGGGTCACTTCCTACTATCATTCAATTTTTACCAAA
GCCCTTCCAAGTGGACTAAACTAAAATTATTTTATTCATTAAGTATATTTGAAAAATTTT
AAAAAACATTTAACACTGTTATAGGTTTTATTTTCCACTCTTACATAGGGACTAAGGGCC
GGTGGGTTCAGATGTGACCATAGCCGACTCGATATGGGGAGACTTGGAGATTTATTTTCT
AGTGGGCTCTCCACAAGCTCCTGTTGAGCTTCAAAGCAGACCTTGTGGGCTGCACACTGT
CTGTGGAGACAAAACAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTT
TTTTTTTTTTTTTTTGACAGGCAGAGTGGACATTGAGAGAGAGAGACAGAGAGAAAGGTC
TTCCTTTGCCGTTGGTTCACCCTCCAATGGCCACTGCGGCCGGCGCACCATGCTGATCTG
ATGGCAGGAGCCAGGTGCTTATCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCACTTGGG
CCATCCTCCACTGCACTCCCTGGCCACAGCAGAAAGCTGGCCTGGAAGAGGGGCAACCAG
GACAGAATCCGGTGCCCCGACCGGGACTAGAACCCGGTGTGCCGGCGCCGCAAGGTGGAG
GATTAGCCTAGTGAGCCGCGGCGCCGGCCACCAAATCTTTTAAGAAAAAGAATCAATGTA
TGTGCCAATAGGGGCACCAGTTTTGCAAATCCTGACATATTAACTGAAATTAATTGGGTG
TCCTTAAAATTATGGGACGTAGGGGTGGGCATTTAGTGCAGTGGCTAAGACGCCACCTGT
GACGCCCAGTGATGCCTCGATGGAAAACATGCTCAGGTATCTGCAGGCACGGAGCCCACG
GCCAGCTCTCGAGCAGTCCACGTCCCCGGGCTTTCCAGCGGGCTCTTCAGCTCTCACAAC
CCAACCTCTGTCTCGGGGCTCATACTTTCATGTCGAGACCCGGATCTTCTTTCAGCTGAG
AACCAACATTACTGTCTTTGAGACACCGGCTAGCACCTGATACTCATGGTCTCCTACGTG
ACTCTTTCAAGCAAACAGAAAGCCTCAGGGACAGACTGACTGGTGCGTCGGGAAATATTC
TTTCGGCTGCATCCTGAATCCTCCCGCCAGACCAGCCGTCCACCCAGCAGACTGCTCCCC
TGCAGCTCTCCCGTCGCCCTGCGGCACCGCAGCCTGCTCTGGGTGTGGGCTGGCGCGCAG
GCAGCACGCACTCCTCCATCCTGTCTCTCAATGGCACTTTCTGAGGAGTCATCCTCTGCC
TCCTTCAAGCGTAAGGAGAACACGTCTCAGCACATTAAGCTGCATGCTTTCCCCCAGTAG
GAAAAAAAGCGGTGTCACAACCAAGCTGTGCTTTTTTTCTCGTCTGCCTCCGAGCAAGTT
TGGTTCAAATCCAAGTTTCCTCAAAAGCTAATCCAAATATTCTCCCTTCGTTGGTATCAG
CCTCCTGTGCCCGGCATGCATTTCTGTTGTTTCTGAGTTGTCTGCCTCTATCCTAAGAAC
ACCCTATGTACTTCTTTTTTTTTTTTTTTTTTTGACAGGCAGAGTGGACAGTGAGAGAGA
GAGACAGAGAGAAAGGTCTTCCTTTGCCGTTGGTTCACCCTCCAATGGCCGCTGCGGCCA
GCGTGCTGTGGCTGGCACACCACGCTGATCCGATGGCAGGAGCCAGGTACTTCTCCTGGT
CTCCCATGGGATGCAGGGCCCAAGGACCTGGGCCATCCTCCACTGCACTTCCCTGGCCAC
AGCAGAGAGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCCGGCACCCCGACCGGGAC
TAGAACCCGGTGTGCCGGCGCCGCAAGGTGGAGGATTAGCCTAGTGAGCCGTGGCGCCGG
CCCCTATGTACTTCTATGTCCTGCTTTCCTGCAGGACTCTGTGGTAACAGGGCTCAGGGC
CAGGGAGAATCACCCTAAGCTAAAACTGCTATCTACCACAGGAGCAAGCGCTTACGGACA
GGAGTGTTCCAAGTCTTTCATGGAAATGCAAGGGCCCTATTTCAAATATTTTGAAACTGA
ATCTTGGACACAGTAAGAAAACAAACTGGAAACAAATTTTTCTAAGGAGAAAAGGAAAAG
ACCAAGTGAATCAAGTACGACTTTTTAGGAAAAGGCACAGAGCCCCCTAAGGAGACACCT
GTCATTTTTTCTGCATTGTGGGCTGTGATAAACACATAAAGTTTGGCGATAATACTTTCT
TAACTGGGTCTTACCCGTAATCGATAATCATCCACAGTCCAGATTCGGCTTGCAAAATCA
TTGGAAGCTGCTAAGAGGTAAGAACCCTATAAAGAACAAAGAAAAGTGACTTTCAGCCAA
AAGAGAAAAATTCAGTCCACAGAACACCAATTTTCCAGTAACCAGGTCTAAGAAGGCTTA
GATGCCTAAACCAATTCTCAAAACCAATTACTATCACAGCAAACTCACCAAGTTCCTCCA
AGTTCAGACTTTTTGCTTGGACTCACTCAATTTCACCTGAATGTTTTGTGCTCAAGTACA
ACACAAAACTCAGCCCCCGCAGCCACGCCACTCACCATGCCAAAAAACAGCAAACACCAA
TTCTTTACATACTGCCCAAGCCAGAAACTCAAGTACCCACCTCACCCCTCATCTCCCCAC
AATGCCTGTCTAAGACTGTCCACCTCTAACACGTCCAGTGAGACCCTGACTCTCCAGCCC
TAACACCTCAGCCCCAGCTTGGCCAGTGATAATTAAAGCACAAGCCATGGCACGTATCCC
AGAATTGAATGCCACACCTGTCTTTAACAATCCTTAAAGGCCTCACCTCTTTGGACACCA
CACACACTGTAACCCCACACCAAACTTGCCAACCTTGTTTCCTTATCATTCTGCAATTAA
ATTCAAAGAGCAGTAAGAACATAGTAGTGTGGGCCACCATGCTGGGAGAACAAAGATGGT
TAACATACTGACTGTCTGCAAGGAGCTGGTTCTCAGATTAGCAACAGCAGCGCTCTGGTG
GTAACCCTTCCGAAGCAGGGTGCCCCGGCACTGTGTGAATGCAGCAGGACCACAGCCACC
CACAGATGTGGCAAAGGCTCCCCGGGATGACTGAACCTGAGTCTCTGCAGAACTGACAGA
GCGACCCTCAACCCACCCAGCTCTTACCTGCACACCAGCCACGGCACCAGTCCCGCCCAG
AAGCCTTTCTGCTTCCTCTGCCTGAGACTGACCTTCTGCACTGTCTCATCAGCTACCTCT
GTAGCAACATCCTGTTCTGGTCCCCAAGTCCTGACCAAAATGAAAAGCTCCTTCACTGGC
ATTTCCTCTCACACTCCCTCATACTGTGAGCACAGAGACCAGCACTTAAGTGCTTTCCCG
GGGCCAGTGTTGTGGCACAGCAGGCTACCTGCAGCGCTGGCATCCCATAGGGGCACTGGC
TCAAGTCTGGGCTGCTCCACTTCTGAGCCAGCTCCCTGTTAATGCACCTGGGAAAGCAGC
AGAGGATGGCCCAGGGCCTTGGGCCCCTCCCTAGCTTTGGCCTGGCCCAGCCCCAGCTCT
TGTGGCCATTTGGGGAGTGAACCAGCAGACAGAAGACCTCTGTGTATCTCCCTGTAACTC
TGCCTTTCAAATAAATAAATCTCTAAAAATAAATCTATGAATAAGTAAGTGCTTTCTCAC
TACTCCTGTTTAAATGGTGAATCTTTGAGTGTAAGGACCACACTGGCCTTGAGTACAGAA
TCTTAACACTCAAAAAGTGACCATGAAATGGAATCAAAGAGTACTAACACAGGCTAACGC
AGAATTGCAAACCCAAGATTTTAGCAAAGTTAATGTATCAATAATCCTACAATCTGCTTG
AACCTTTTTCTAACATGATTTGTTAGACACAGAACGGCAGAGAAATCAAATAAGTCACTT
TTCAATTTCAAGAACTGGATGCCTTGGCTGTCCCTCGGACCTCTGAACTCTAAAGCAGGA
GATACTTACAGCACTGTCGAATTCAATGCTGGTGATGCCAGCATTACTGCCAGACAGGGA
ACCCTTAAACTCACATTTGTCTGTATGAAAAAAAAGTGAGAGAAGACAGGAAGTTACATA
AAGTCAGTAAATGAGCTAAAATGGGTGCCAGGTACACTAGAAGCCAACTACATAGTCAAG
AACAGCTTCCTTTATTCAACATAATCAAGCAGCACGCAAATGCACTGACAGAATAATCTG
CTAAGACTCTAAGAATGAATGAGGATCCAGACGCTAGCCCTTTGCATGTTGAGTCCTTAA
GCTATTTTTAAGGAAAGTTAGTTAACAGTTCCCTTTACGATATGCTAGGGATTTAGGAAA
CTTGTCAGTGGAACCATTATCTAGTTGTCATCCCATCAAACTTTTCCAATATTAATAAAC
TTTTGCGTTTAATAAGTATTTGTGTGAACCACCACTTCTGTAGAAACTGACCATCAAAAT
TTCAGAATCCACAGAATAATTCTAAGGTCTGAAAAGCATTTTGGTTGTCACATTCAAACG
CCAGCAAAGCTATCTTGGAGTTACTGGAGTCTGTCCTCACTGCACCTCTGAGCCTGGCAA
GTGAACTGCCAGCCTCCCCTCCTCAGACAGCCGTGCTCCCCAACAGAGCCCACGGCACAG
AGTCTGTGGCCCGGCTGACAGCTCTGGCCACCCACCCACCTACCCGCCTGAATAATGCAA
TCACAAACTAGGAAGAGAAAGTCTCAACCTGAGTTCCTTTTCTGAAGCTTGCATTAAGGC
TGTTCTGAGTGCACAGTGGTAGAGGTAAGTTAGGAACTAGGGTACCAGTAGGATTATCTC
GATGCCCCTGAGCCACGGTCACTATTAGGGTGTCTGGCTGGTGAAGCTGGCATACACACC
CAGGGCAGGAGGCACTGAACCCTGGCTTGGGTCTATCAGTGAGGTACAGTACTCGAGGGC
CTTTCCCTAGAGCCTAGGTTTCATCAGATTTTCGAAAGAGCCGAAAAAGGCTAATATCCA
CTAGTGAAGGTCTTGCTTTATTTCAGATGTTTACAGAAAAATTTTTACTGCAAATCCTAA
TAAATACCTCTGTGGTTTAAGCCCAAAATATTGGTGTTATTTGTTTGGCATTTAGAAGAC
GACCAGCACTGTGGTATAGCAGGTAAAGCCGCTGCCTGCAGTGCCAGCATCCCATAGGGG
CGCTGGTTGTAGTCCTGGCTGCCCCACTTCTGATCCAGCTCTCTGCTGTGGCCTGGGAAA
ACAGAAGAAGATGGCCCAGGTCCTTGGGCCCCTGCACCCACATGGGAGACTCAGAAGAAG
TTCGTGGCTCCTGATCAGCCCAGCTCTGGCCGTTGTGGCCAATTGAGGAATGAACCAGCA
GATGGAAGACCTTTCTCTCTCCTTCTCTGTGTAACTCTGACTTTCAAATAAATAAATAAA
TCTTTCAAATAAATAAATAAAGATGACCAATCCAAGCTAACTCAAAAGGACACAGGTTTT
GTTAAAGTTCCTGTCTCTACACCCCCAGAAGCGGCTCCATCCACAGCACTGTATCACTTC
CCAGCGCAGCGTCCGCTTCCGAGAGAATGAGCAAGAACAGATGTCCCTGCTGGGCGGAAA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAGTAAAATTAAAAAACTATTTTGTGTTACTTCTACTTAATCTCAAGTGTGATTAA
AATAGATAATCTGCTTATATTTTATTAACCAAACCACTTAAAACTTGTTATTTTGAGATA
TTGATTTATGAGTGTTATTGTTTATAATTTTAGCCGTCATTATTCATAAATAAATGCAGT
GCTTGTGGGAAAAACAGGAAAGTTTTATGGGTTCCAGAGGGCTGTAACTACCAGGGATTG
AGGTACATAACCCATCTGCTCTGTAGGCTACTCTATTGAGCAGGGAAGTTGTTAGTGGAG
GACAAACACTGAACTTCAAGTCCCATGGACTAGACAGGTCCTAGCACCACTCCCTCAACA
TGGAATCACGTAGTCTGTGAGTCTTACTGTCTTCCATCTGTCAAACAGGGGCAACACTCA
CCTTTCTAAATTCCCAGGGCTATCACAAGGAGTAGAGGATTTACCATAGAAAATGTCATT
TGAGCTATTTATTATTTGACGGTGGTATCAGATGTACTACAGTTATGGGAGCCTTAACAG
TGGGGCTCTTTTTAAAATGTATGTATATATTTTTAAATTTACTTAAAAAAAGATTTTACT
TATTTGAAAGGCAGAGCTACAGAGAGAAAGAGATAGATCTGCCGTCTCCTGGTTCACTCC
CCCCAAAAGTTGCAATGGGCTGGCGGGGCCTGGCCGCTGCCTCTTCCCAGGCGCATTAGC
AGGGAGCTGGGTGGACAGGGGAGCAGCCAGCATGTGAACTGGTACCCTTATGGGATGCTG
GTGACAAGCGGCGACTTAACCTGTGATGCCACAACTCCAGCCCCTATATTATTATTATTT
TTTTTGCTTTTTTAAGAACCTATTTATTTGAAAGAAAGTGTTACATAGAGAAGGAGAAAG
AGAACTTCCATCCACTGGTTCGCTCCAGAAATGGATGCCAACAGCCAGGTGGAAGCCAGG
AGTGAGGAGCTTCTCCCACATGAGTACAGGAGGCCCAAGAACCCGGGCCATCTTCCACTG
CTTTTCCAGGTGTATTAAAAGGGGCCTGGATAGGAAGTAGAGATTATATGGGATGCAGCC
ATTGCAGGCAGCGACTTAATCTGCTGTGCCATAGCTCCAGGCCCCCCGATTTACTTATTT
GAAAGGCAGAGTTAATGGAGAGAGAGGGAGTGATCTTCTAACTACTGGTTCATTCCCAAA
TGGCCTCAACAGCCAGGGCTGGGCAAGGCTTAATCTAGGAGCATGAAACTCTATTTGGGT
CTCTCACAAAGGTAGCAGGGGTAAAGCCCTTGGTCATCCTCCAATGTCTCCCCAGGCACA
TCTGAAGATAGCTGGCTTGCAACTACAGCACCTGGAACGCCAACCAGCACTCACTTGGGA
CCCCTTCATCATAGGCAACAGCTTAACCTGCTGTGGAACAATGTTGGCCCCCAAACTGGT
TCTTCCAGTCTCTTAGCCTTACTCCGTGACTTCATTTTAGTAAAAACTGGGCTTCAGCAC
TCTGAGCAGTCTTGATCTGAGGAGACCTTAGGTGAGGTGTTTGCTCAATTACAGTTTCTG
GTTAACAACCCTCTTCCTCGCTAGCTGAGACATGACTGTGGTCATTTCTTTCCTAGGTAC
TGCACTGCCATAATTAAATGCATATACCACAGTTTGAGACGTAAGATTTCCCTTTTATAA
ATAGTATTTTTGCAAGATTAGTAAATATTTGAACATTTAACCAACAGATGTATCCATAAC
TTAACGGTTATGACTAGTATTTGCCAGTCACTATTGGAAGAACCAGAGAAAATACGCACT
CAGCTGCAGAGTAACTGAAATGGTTGTGCTACTTTGACTGGAGGATTCCTCACACAAAAT
GTGAGCACCTGAAGGCCAGGTGACCGTCACGGCTTCCTTCTGTGCACTCCCAGGGACTCT
CACCTCCAAACGCTTCCCAAAGCTTTACTTTCCGGTCCATGCCTCCTGTGGCCAGTAAGC
GGGAACCTGGACTGAACTGCACAGCGTTGACTTCCCCATCATGGGCATCCTGCAAGACAA
GTACTCTGTTACACACACACACACACACACACACACAAAATCATCATCACCCCAGGAGCC
CGAGACAAAGGACACTCCTTGTGCCCAACCTCAAGTGGATCCAATCGAGAACTGACTCAG
TCTTAGCCCAGGGTCTCCTGCGAGTCCCCACTCTCAGGAGCAATTATGTTTACTTCAACA
CAGTGCAACCTTCTCAGAAAGGATTCTATTTTTGTAGACTCTCAAGGCTGTTTTCACATT
AATTTAGTTACTTCTAAAAATAATAACATTTCAACTCACATGGATTTTAACAGCTTAAAA
TGTAAGCCTAACATTTAAGCCTCTTTTGGTCCCCCAAAAATATTCCTCATTAGGTGGTGG
TATTTAGCCTAATGGTTAAGAAACTGGTTAGACTACAAGCAACACTGTGGCAGACTGTCA
AAACCATCTGATGCAATCTGCACTTGCTATAGCAAGGAAGTCTAACCTACTCTGGTATTC
TCTCTTCTGTGAGACTAGCTGTTACTTAAGACAGCGTTAAAAAAAAAAAAAAGAAAGAAA
CTGGTCAGAATACCTACACCCCACAGCAGAATGCCCGGGTTTGATTCCAGGCTCCAGATT
CCTGGTAACGCAGACCTCGGGAAGCAAATGTTGATGGCTCAAGTAATTGGGGTTCTTGCC
CTCCCCCCGGGGAGATCTGGTCTGAGAGCCTGGCTCCTGGGCTGTTGCAGATTATATGAG
CAGAGAACCCAGTGGATGGGGAGATTCTATCTTACCCACCCAACAACTCCCGTCTCTGCC
TGTCATGGGGAAAATAATTACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGGGCAGAGGT
AGGGACGTGGGGACGGGACCCTCCGGGCCCAAAGCCGTGGTGCTCCCTGCCCCTGCCCAC
CCCCAGGTCTGGCAGGAGGACCCAGGGCCCCTCCCATACCAGGCTCAGCAGCAGGTGGAC
GGCTAAGCTCAGGGCTTAGCGCCCAGACCCTAATCCCGGCCATGGTGGCACTCTTGAGTC
AACTGAGGTCCCGCCCCCTGCCTGCTCAGATGTCACCTCCCGGGAGGCCTTGTGCACCGC
TTCGGCGCTCCGTGACCCTGCCTGAGACCGTGCCATCTGTCTGTGGGATTGGCGTCTCCA
GGCTGAGCCGTGTGACACTGCCACGACTCACCTTAACCCCTCATGGGCGTGCCCTCCCGC
CGCATGCTCCCCGGAGCAGGCCTGTCTGTCCAGCAAGCCGCATGGGGCGCGGCCACAGCC
GGCCAGCGGCGCCCCGAGAGGGCTGCGGGCTGCTGCTGGCTTTGGGCCGGCAGCTCGCGC
TGAGCCCAGCCCCTGAGCCTCGGGGTGCCCGGCTGCGCCCCGCCCCGTCTCCCCAGGTCG
GCCCGGCCGGCTCGCAGTTCGGCCTGCTCGCCTGCCTCTTCGTGGAGCTGTTCCAGAGCT
GGCAGCTGCTGGAGCGGCCCTGGAAGGCCTTCCTGAACCTGGCGGCCGTGGTGCTCTTCC
TGTTCGTGTGCGGCCTGCTGCCCTGGATCGACAACATCGCGCACATCTTCGGCTTCCTCA
GCGGCCTGCTGCTGGCTTTCGCCTTCCTGCCCTACATCACCTTCGGCACGAGCGACAAGT
ACCGCAAGCGCGCCCTCATCCTGGTGTCGCTGCTGGTCTTCGCCGGGCCTGTTCTCCTCG
CTGGTCCTCTGGCTCTACATCTACCCCATCAACTGGGCCCTGGATCGAGTACCTCACCTG
CTTCCCCTTCACCGGCCGCTTCTGCGAGAAGTACGAGCTGGACCACGTGCTGCACTGACC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1144, 1669..1725, 1728..1864, 2142..2337, 2427..2630, 3319..3458, 3716..3823, 3942..3972, 3976..3996, 3998..4012, 4014..4024, 4026..4035, 4038..4046, 4049..4137, 5381..5492, 5593..5667, 5768..5929, 7173..7270, 7273..7284, 7383..7408, 7410..7421, 7423..7448, 7554..7648, 7879..7954, 8036..8136, 31132..31285, 31824..32111, 32113..32161, 32163..32245
1001..1144, 1669..1725, 1728..1864, 2142..2337, 2427..2630, 3319..3458, 3716..3823, 3942..3972, 3976..3996, 3998..4012, 4014..4024, 4026..4035, 4038..4046, 4049..4137, 5381..5492, 5593..5667, 5768..5929, 7173..7270, 7273..7284, 7383..7408, 7410..7421, 7423..7448, 7554..7648, 7879..7954, 8036..8136, 31132..31285, 31824..32111, 32113..32161, 32163..32242
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved