Oryctolagus_cuniculus Locus ENSOCUG00000003631
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000003631
Oryctolagus_cuniculus
ENSOCUG00000003631
GeneScaffold_5950
SNORD70
1159..1245
40352
GAGAGAGAGAGAGAGAGGTTGATCTTCCATCAGCTGGTTCACTCCCCAATTGGCTACAA
CGGCCAGAGCTGTGCCAATCTGAAGCCAGGAGCCAGGAGCTTCTTCCAGGTTTCCCACGT
GTGTACAGGGGCCCAAGGATTTAGGCCATCTTCCACTGTTTTCCCAGGCCACAGCAGAGA
GCTGGATTGGAAGTGGAGCAGCCGCAACTTGAACCTGCGCCCATATGAGTTAGTGGCACT
GCAGGCGGCGGCTTTAACCGCTTTGCCACAGCGCCGGCCCCAATAAGCTTATTTTTAAAA
ATGACATTTGTATTGGGTAGAAAGTGAATGCCAGGGGCTGCCAGTGTGGCATAGCTGGTA
AAGCTATCATCTGTGATGCTGACAGCCCTTTTGGGTGTTTTCCTGAATGCTTCACTTCCA
GTCCAGTTCTCTGCTAATGGCCTGGGAAAAGTAGCAGAAGATGGCCCAAGTGGTTGGTTC
CCTGCCTACATGGGAGACCTGAAAGAAGCTCGTAGCTCCTGGCTTTGGCTTGGCCCAGCC
CTGGCCATTGCAGCCATCTGGGGAGTTAATCAGTAGATCTCTCTTTGTTTCTCCCTCTCT
CTTTCAAATAAGTAAATTTTAAAAATAGGACATGGTATTTAAAAAAAAGAAAGAAAGTGA
ATGCCATGAGATTCCTAACCTCAGGGGCTTAAGTAATTTTTCTTGGGTGAATTTTATGTT
ATATTTTAAAACTCATCTATATCCTCTTTACCATTGGCCTAAGTTACCCTCAAAGCCTGC
AACTTTATGCTTCTTGAAGCATTAGTAGCCCAACATTTGGAAAATCTGGTCATTTCATGA
AAAATATGTTACTGCCCTCATACCCTGATGACAGGCAAGTTTCTTTTTATCGATTTGTGC
CTTGAAAACATTCAACATTTGTTTTTCAGCTAGGTAGCTTTTGCAGAAACAATGTGTGTG
CCCGTAACTTGGTTCTTTTCTTCTCTTTTTTTAATTTTAGAGTAAAGCTAAAACATTTTG
AGAAATTTCAGGATACAGCTGAAGCATTAGCAGGTAAAGTTAAAGACTGGAAGCTTGCTT
TTTTTTTTCTTGCTCTTAATATTGGCAATTAATTTTCCTTATTAAATGGTGTTTGATTCA
GTTACCTGAGTTAACCTTACTTGATGTTGTCAATGATGCATTCTTAATGGAACTGAATTT
AAGTGATCTGACTCAAATTCGTCACTACCACTGAGACAACATTGAGTTAGCTTTTTTCAC
CATAGGGCTTGTTTTCCCTCATGTGATGAGAGGTGAGAGAAGTTAAATTGATCTCCCTGT
GGAAACCAACAGCATAATGCTGAAGCACAATTCAGTAAAAGCTGTTCTACAAGGGACCAA
GGTAATGTGGTCAAGTGCATTGTAGTCCAAGTGTAAAACTTGAGAATGGCTAGGATTCAC
AGTTGGTAAAATAATAAGCACTCCAAGAGAATACTTTTTAGCTCAGAAAAATCTAGTGAA
AGTTAGGGAAAGCAAAAGAAGTGATTTGGTTGGTTGGCTGTTTGTTTTAATACAGAGCTG
CAGAAAAGCTCAAAGTGTTATGTTTAAGGAGGGTGTAATTTTTTTTTTTTTTTTTTTAAA
GATTGAGAGGAATGGATGACTTGTCTTTCAGCTAGACCTATAATTGACTTCGGTAGGTCA
AGTGTTAGGTAAAATAGAAAGGGCAGATGTAAAACCCAAATCAGTTTTTTGATTTCTTAA
ATTCTGCATGACAAATCAGTCAACTACTTGGTGGCGTAACTTGAAAATGAAGGACTATAA
GGAAGACTTCTTGTAAAATTAGGCAAGGATTTGACACATGTAAGTTAATGTCTTCTTAAT
CAGCCACAAGAAAGGTATAGTTTCCAGTGTGAAGACTGGGACTCCCACCAGACTTGCCAC
CTTAACCTTAGCAGAGGGGTCAGCTGAAAAGAAACACCAACAATGGAGCTAGTTTTCTCT
AGTCTTTACAAAAAATGTTCTACGGTTCCTTCATCATCGCATCAGTATTTAGAACCACAT
ACAAGCAAAAAGTATGGTAAAATTTGGATGTAATTCCAAGAAAGATTGTGTTAGCAATCT
TCAGCTTTAGGGGGTATTGTCTACATGGTAAGAATAGCTGGAATTTTGAAGAGTGGCAGC
TCTGATCATTGGACTCTTCTGAATTCCTGTTCATATACACTTTTTCATCTGTATGGATTT
TTTTTTCTTTAAAGGTTTATTTATTTGAAAGGCAGAGTGACAGAGGGAGTGACAGGTAAA
GAGATCTTTCATATGCTGGATCACTCCCCAAATGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCATTGGAGGGGGAACCAACGGCAAAGGAAGACCTTTCTCT
GTCTCCCTTTCTCTCACTGTCCACTCTGTAAAAAAAAAAAAAAAGCTGTTCCAAGCACCT
GCCCCAAGTTACTATAAATAGCTAATGCATCAAACACATAATGTTGTCAGATTTGTGCTC
ATCACTTCAAAATTGTCATTCAGTCCTTGAAATAATCCCATGAAATTTGAAACTCAAAAT
ATCTTTGAATTCTTCTATGTGACTTCTTTGTATTTGAAATAATTAAACGGGAAAAATGCA
TACTAGGTGAGGATTTAAAGTCAATTCTCGGGACTGGCTCTATGGTGTAACAGGTAAAGC
CACCCTGCCTGCAGTGCCAGCATCACATATGGGCGCCAGTTCAAGTCTTGGCTGCTCCAC
TTCCAATCCAGTTCTCTGCTATGGCCTGGGAAAGCAGTGGAATATGGCCCAAGTCCTTGG
GTCCCTGCACCCGCATGGGAGAACCGGAGGGAGCTCCTGGCTTTGGATCAGTGCAGCTCC
AGCCGTTGCAGACAGTTGGAGAGTGAACCAGTGTGTCTGTCTCTGCCTCTGCCTCTCTGT
AACTCTGCCTTTCAAATAAATAAATAAATCTTTAAAAAAATAAAGTCAATTCTTTCCTTT
TTAAGTTTCTTTTAGACAGAGATGTCCTTCACTGTCAAATTGTTAGCTTCTCTAACAGAA
TCAAATGTTTATAATGAATGTTTTTGGGTAAACGAATGAATGAAAGTACTGGGTTCTTCA
GGAGCCTAATCATAGAAACCTACAGTGTCTTTTCCTATTTTATCAGAAAATTGAACATCG
CCTTATTACTAAAAGAGCAGACTCCTTTCACAGGAATCAACTTCCATCTCCTCCGTAAGG
CAATTGGAACATGATAAAACCAAGCGGCTGTATATGGCACAGTGTGTGCCTTCAACCGTA
TAGTTTCGGGAAGAGTCTGGTAGAGTATAGTGTAATGTGAAGAATCAGTCTCAGTGGCAG
AAAGTCATATGGCACTTGTGTGGAGAGGCTTATTTTCACTCTCCATTCCATTTATTTTTA
TTTTTCATTTATTTATTTATTTTGACAGGCAGAGTGGACAGTGAGAGAGAGAGAGACAGA
CAGAGAGAAAGGTCTTCCTTTTGCCGTTGGTTCACCCTCCAATGGCCGCCGCGGCCGGCG
CACCGCGCTGATCCGATGGCAGGAGCCAGGTGCTTCTCCTGGTCTCCCATGTGGATGCAG
GGCCATCCTCCACTGCACTCCTGGGCCACAGCAGAGAGCTGGCCTGGAAGAGGGGCAACC
GGGACAGAATCTGGCACCCCGACCGGGACTAGAACCCGGTGCGCCAGCATCGCAAGGCGG
AGGATTAGCCTAGTGAGCCGTGGCGCCAGCCTCTCCATTCCATTTATATTATGTACCGTA
ATTAACAAATTATTCTTTTTAAAAAAATATGTTTATTTACCATCTCAGTTCAAAAATAAG
CTTTTCTCAGGGCTGTCTTTGGCAACTTGATGTCAAAAAATTTCTTTATGAAGGAAAGAT
AAGTGTAAATGTTAGAATAGATCCAGAGTAGAAATTTTACTTTTTAGAAATACATTTTGA
ATAAGAGAGAGACTAGGATAAAATTAAAGGTACGCCAGGTTACANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAAAAGCAAATATTAAAAAATTAATTTTTTGAAGAGGAGTTTT
AAAAAAGATTTTTTATTTATTTGAAAGAGTTACATAGAGAGAGGAAGAGACAGATCTTCC
ATCCGCTGGCTCACTTCCCAATTGGTTGTAATGGCCAGGGTTGGGCCAGAGTGAAGCCAA
GAGCTTCTTCCAGGTCTCCGAAATGGGTGCAGGGACCCAAGCACTTGGGCCATCTTCTGC
TGCCTTTTCCCAGGTGCGTTAGCAGGGAACTGGATCAGAGGTGGAGCAGCTGGAACTCAA
ACCGGCGCTCACGTGGGAAGCCAGAGTCACAGGTGGTAGCTTTACCTGCTTCACCATAAC
GACAGCCCCTGAAGAGCATTTTTAAAACTTGGAAAGAACAAAAGGAGAATGATTAGAAAG
ATAGATCATAGGGAACCAATGTTGTAAACAAGTAAAATGTTAGAATCCCACAAAAGAGCC
TAAATCCTAATATCTTCGACTGTACAATTCTCCTTCAAGAGCAGTGTGGCAGCCAGATTT
TTTTTTTTTTTTTTTTTTTTTTTTAAGATTTATTTATGTGAAAGTCAGAGAAAGAGAGGC
AGAGAGAGAGGCTTCATCCACTGGTTCACTCCCCAATTGGCCGCAACGGCCGGAGCTGCT
CTGATCCAAAGCCAGGAGCTTCCTCCAGATCTCCCATGTGGGTGCAGGGGCTTGAGAACT
TGGGCCATCTTCTGCTTTCCCAGGCCATGCAGAGAGCTGGATCGGAAGTGGAGCAGCTGG
GACTTGAACCAGAGCCCATATGGGATGCTGGCCCTATAGGCAGTGGCTTTACCCACTACG
TCGTAGCACTGGCCCCGCCAGATGCTTTTGTCCTCAGATTTCATCTGCCCAGATAACAGA
TGGAATGGACTTAATTCTGATGACTGAAGATGGGATCTGGAGAGAAAAGCAAGTATCTGG
CTTACAAAGCACAAATTATCTGACCTTAGAAACCGACTTTTGTTCCTGCCAGGCATACTG
TAACCTAAGCCAGAAGCCAACCAAATGTTAACCCCAGATGTGAGTCTAGAAAATGGAAGA
GTTGGTCTAAGGAAGAATGAGAGTTAGAAATTAGGAGATTTAAGATTTCACAAAAATGGG
AGCATTGCCATTCAGTAGGAATTTGTTGATCAATCACTGGAGGTTTATAAGCAGAGACCT
TAGGACACATCTTGGTTGGAGATTAGTAAAGCTTGGACCTACAGAGATTTCAAAATGCTC
ACACTCCTTTTTGATGATATTGACGTTTTAGGATGTTTCATAGTCTAGAGCATCAAGCCT
GTCTTATCTGAAGAGAGACAGGAGAGCAAATCTATTTGTCTTCTCAAAACAGATGGTGTT
TTAAGATTTCAGGATTCTCTGAGTTCATGAGAGGTTTTGTTTAACCTAGGGGAATGAACT
CTGAACCTGGTTTCCCTCCCGGCTCTGGTGCGGAAACAAGGGAAGATCAGATCAGATGAG
ATTGTGCAATGTATAACTTTGCCCTTATAGTTTGAAAGTAAATTATAAGTCTAAAGTTAT
GGTAAATTCAGGCTTTTTGAAAGGGAGTGTTTGTTTTGCTTCATTTTTCAAAAAAAAAAA
AATTAAGGTAAGTCCTCACAGTTAAAAAATGAGTTAACTCCTTTGTATTTCTTTTTCCTG
AAAAGCATTCACAGCTCTGATGGAGGGCAAAATCAATAAGCAGCTGAAGAAAGTTCTGAA
GAAAATAGTAAAAGAAGCTCACGAACCTCTGGCTGTAGCTGATGCTAAACTAGGAGGGGT
CATAAAGGTAAAGTCCTGGTTCTTCTGCTGGTCAGATCTCGTGTATGACTGACTTAAAAG
CCTTCTCTTTGTAATGTAATAAGTTGCTGTCATAAACCCTTATCCTTGGTCCTTTTTACC
TTAAGGCTACACAATAGTTGATTTCTGTGAGGGTTAGCAGAACCAAGCATGTTAATACAC
ATGCCTATTCATTTTAGAAAATAGGGGAAAACAAAAGATGATTTTAAAAACTAGCTTTAA
CTCTGCTGCTCATATTGTCTATTAACACCATATTTATATCATGCCGTGTTTTTGTTTAGA
CACATTTTTTCTTCCAACAAAAATCAAATTGTGTCTTTAAAAAACATCACTGAGATTTTT
ATTTTTTTATTTTATTTTATTTTTTTATTTTTTTGACAGGCAGAGTGGACAGTGAGAGAG
AGAGACAGAGAGAAAGGTCTTCCTTTTGCCGTTGGTTCACCCACTAATGGCCGCCGCGGC
CAGCGCGCTGCGGCTGGCGCACCGCGCTGATCCGATGGCAGGAGCCAGGAGCCAGGTGCT
TTTCCTGGTCTCCCATGGGGTACAGGGCCCAAGCACCTGGGCCATCCTCCACTGCACTCC
CTGGCCACAGCAGAGAGCCGGCCTGGAAGAGGGGCAACCGGGACAGAATCCGGCGCCCCG
ACCGGGACTAGAACCCGGTGTGCCGGCGCCGCTAGGCGGAGGATTAGCCTAGTGAGCCGC
GGCGCCGGCCGAGATTTTTATTTACTTATTTATTTTAAAAGCCACTCTAAATTTGCTCTG
TAAATGGCTGCGACAGTCAGGGATGGGCCAACCCAAAGCCAAGAGCCAGGAGCTCCATCT
GCATCTCCCGTGTGGGTAGCAGGGACCTAAGTACTCAATACTGCCTCCTAGGGTTTGCAT
TAGCAGGAAGCTGGATTGGAAGCAGTACTGAAACCAGGAACTTGATGTGGGCATCTTTTA
AGCTACATTTAAACTATTGTGGCTGATGCCCGCCCTTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTAATATGTATATTAAGTATCTATTAT
AATATTTATTGCATCTACTGAAGATGAGAGAAGAGATCATCTACACTGCTGTCACTCTCC
AGATGCTACACAGCCAGGGCTGAGCCATCGGAAGTCAGAATCTGAACTCCATGCAAGTCT
TCCATTGGTTGATAGGGTCTCAGACCGTAAGCCATTGTCTGCTGCCAGCCAGTATGCATT
ATTAGGAAGTTAGATTGGAAGTGAAAGAGCTGAGACTGGAACCAACACACCAATATGAGA
TGTGGGCATCCCAGGTGGAAGCTTGAACCATTGCACCACAACAACCTGCCGCCTTGTATT
TTTTATTAAAATGCTGTACTTAACGTAAAGTAGTAAAAGATGCCCTCAAACCAACAAACA
AGGACGAAACTATTAAATCAAGTTGCTTTTATCTTTTATAGCTTTTGGTTCATACACTCA
AGCTGTCTTTCAGGAAGCTTATATCATAATTGACTTCTACCATAAATGTGTAGAAGGTTT
TTTACACAAACCCATTAGAGGCTACACTTGTCAGACTGAGAAATTCATGTTTAATATTTG
AGAAATAGATTCAGTAAAGCTTTCTTAAAGACATTTGTTCTTGTTCCTCTAGGAAAAGTT
GAATCTCAGCTGTATTCACAGCCCTGTTGTTAATGAGCTTATGAGAGGAATCCGCTCACA
GATGGATGGATTAATCCCTGGGGTAGAGCCACGTGAAATGGCAGCTATGTGTCTTGGATT
GGCCCACAGGTGAGAATCACTAGAAAATACAATCAGTTTGTTTTGGTTCAATAAATGTAA
TAGCATTGGACTAAAAATGGTACAAGGACTAATTAAGTCTTATGAGGAAGATGATGTCCA
AGATGGACATAAATGTGGTAGGGTATATTCATACATGCCAAGTTGTGATAGGATGTATAC
TTTCATTTTTTGAAAAAGATTTATTTACTTATATGAAAGGCAGAGTTACAGAGAGGCAGA
GACAGAGAGGTCTTCCATCTGCTGGTTCACTCCCCAGATGACCTCAATGGCCAGAGCTGG
GCTGATCTGAAGCCATGAGCCAGGAGCTTCTTCCTGGTTTCCCAAGAGGTATGGGGTCCA
AGGACTTGGACCATCATCTACTGTTTTCCCAGGCCATAGCAGAGAGCTGGATTGGAAGTG
GAACAGTCGGGACTTGAACCAGCGCCCGTATGGGATGCAGGCACTGCAAGCAGTGGCTTT
TCCCGCTATGCCACAGCACCAGTCCCAGGATGTATACTTTCTGATCTTGGCATAATACTT
CTTCTTATTTATTTATTTGGCAAGCAGAGTTAGTGAGTGAGAGAGAGAGAAAGGTCTTCC
TTCCGTTGGTTCACCCCCAAATGGCTGCTACGGCCGGCGCGCTGCACCGATCCGAAGCCA
AGAGCCAGGTGCTTCCTCCTGGTCTACCATTGGGGTGCAAGGCCCAAGCACTTGGACCAT
CCTCCACTGCACTCCCAGGCCACAGCAGAGAGCTGGACTAGAAGAGGAGCGACCGTGACA
GAATCCGGCGCCCCAACCGGGACTAGAATCCGGGGTGCTGTCACGGAAGGCGGAGGATTA
GCCAAGTGAGCCGTGGCGCCGGCACTTCTTCCTATTTATAATGGATCTTCCTATTTAGAA
AAATTAACCCAGCATAGCTTTTTAAAATTTTTTATTTGAAAGGCAGAGACCCATATTTCA
TTCCCCTAAAGACTAAATAACAGAGCTAGGACTCAAACCTGGGCACTTGGATATGGGTTG
TGTGCATCCCCAACACTGACAAATGCCCATCTACAGCATAGCTTTGAAGAGAGGGATCTG
GGTTTTAAAAAATACAACATTTTTTTTTAAAGTTAATTTAAAATGCTTTTCCTAGATGCT
ATCTTACTAACTTGTTTTCTCTTTTCAGCCTATCTCGATATAGATTGAAATTTAGTGCTG
ATAAAGTGGACACAATGATTGTTCAGGCTATTTGTAAGTATAGCACATGACAAAATCTAA
TCAGCTTGTCCATTCACCATATTTTCCTACTCATAAAGTTGTAACTTTTAAGATTTTGCT
AAGAAAGAATCAGGAGGTCAGCTAGAATATCTCATATGTAAAGGAGGTAAATTGGAAACA
AGGGTGCTGACACTGTGACGTAGCGGGTGAAGTTGACACCTGCAGTGCCAGCATCCCATA
TGGATGCAGGTTCGACTCCCGGCTGCTCCACTTCCGATCCAGCTCTCAGCTGTAGCCTGG
GAAAGCAGTAGAAGATGTCCTTGGGCCTTCAGACCTGAGTGGGAGACAGATTAAGCCCCT
GGCTCCTCGCTTCAGATCGGCACAGCTCTGGCTATTGGTGGCCAATCAGAAGGAACCAGC
AGATGAATAACCTCTCTCTCTCTCTCTCTCTGCCTCTCCTCTCTCTGTATAACTCTGCCT
TTCAAATAAATTGTTTTTAAAAAATAGGAAAAAACAGGCCGGTGTCGCAGCTTACTTGGG
TAATCCTCCACCTGCGGCGCCAGCACCCCGGGTTCTTGTCCCGGTTGGGGCGCTGGTTCT
GTCCTGATTGCAAGTTAAAGCCCTGGCCTGTAGCACGGGCATCCCATGTGGCCATTGGTT
TGAGTCCCAGCTGCTCCACTTTTGATCTAGCTCTCTGCTATGGCCTGGGAAAGCAGTAGA
AGATGACTCAAGTCCTTGGGCTCATGCACCTGCATGGGAAACCCGGAGGAAGCTGTCTCC
TTGCTTCAAATCAACCCAGCTCCAGCTGATGCAGTCATTTGGGGGAGTGAACAGGGAGAT
GGAGGATACCTCTCTCTCTTTGCCTCTACCCCTCTGTAACTGCCTTCCAAATAAATAATA
AATTAATCTTTTTAGACAAAAGGGACAAAACCTTGAAAGCATCCTAAGTGAAATAAGCCC
TCGAAAAGGGCTTATATTGTATGATTCCTTGGTTTTTTAAGATTTATTTATTTGAAAGGT
AGAAACAGAAGTCTTTGATACGCTAGTTCACTCCTCAGATGTTTGCAATGGCCAGGGCTG
GGCCAGGCTAAGGCTAGGAGGGCCTCAAATACTCGTGCCATCTTCTGATGCTTCCCCAAG
CACATTAGCAGGGAGCTAGACTGTAATTAGGGCAGCCAGAATTCGAACCGGTACCCACTA
GGGATACTGGCACTGCAAATAGTGGCTTTACCCATGGTACCACAATGTCGGCCCCATGAT
TCCATGTTTATAAAGTACCTGAAGTGAACAGATTCATAGAGGAGACAGCCAGTCTCTGAA
TTGGAGGCAGTGGAAATAGGGAATTATTTTATCATTTTTTCTTTTTAAAGACTATTTTTT
AAAGATATATTTATTTATTTGAAAGGCAGAATTACAGAGAGGCAGAGGCAGAGAGAGAGA
GAGGTCTTCCATCCACTGGTTTACTCCCCAGATGACCATAATGACAGGAGCCTGGAGCAT
CATCTGGGTCTCCCACATTCATGCAGGAGCCCAAGAACTTGGGCCATTTTCTGTTGCTTT
ACCAGGCTATAGCAGAGAGCTGGATTGGAGGTGGAGCAGCCAGGACTCAAACTGGTGCCC
ATAAGGGGTGCCAGCACTGCAGGAGGCAGCTGCACCAGCCAGCTATGCCACAGCGCCAGC
CCAGATTATTTATTTATTTGAAAGGCAATTACAGAGAGAGAGATCTCCCAAATGGCCACT
ACACTGGGTTTGGGCCAGGCTGCCACCAGGAGCCTAGAAACTCCATCATGGTCTTTCATG
TGGGTTCAGGGACCCAAGCACTTGGGCCATCTTCTGCTGCTTTCCCAAACTCATTAGCTG
GGAGCTGGATCAGAAGTTGAGAACCTAGGACTCAAACCAACATCTTTATGGGATGCCAAC
ATTGTAGTGGTAGCTTAACCTGCTGTACCATGATGCCACCCCAGAAATTATTTTCTAGTA
TGTGTCAAGTTTTCAGTTTATGATGATGAAAATATTCTGGAAATGAGCAGTGATAATGGT
TGCCCAACATTGTGTATGTAATTGATGCCCATTGTTATTGTGCGCTTGAAAATGGTGTTA
AGAGGTAAATTTTATGTTTACATTTTACTACAGTAAATCCCTCTTAAGCTCCTCTTACTT
TAACCTGCAGCCTTGTTAGATGACTTGGATAAAGAACTGAACAACTACATTATGCGATGT
AGAGAGTGGTATGGCTGGCACTTCCCTGAACTAGGAAAAATTATTTCAGATAACTTGACA
TACTGCAAGTGTCTACAGAAAGTTGGTAAGTAATGTGCTTGTCTTTTTAAGGTATTGATG
GAGGGAGATGTGGGTGAAAATTTTATCTCTAAAGGAAAGCCTTTATTTATATAAGGAAAC
TACTAGGTCAAACTTGTGCATATTTATATAAGGAAACTACTAGGTCAAACTTGTGCACTT
TTTGTTTTGTTTAGGCATCATTTTCATTGGCTTATCTCTACCTTTTCTTTTGACTGTTTT
GGTGGATTTTATATAATTTGTTGAAGAGTGATTCTCCCTCATCCTCTGCAAACACTCCAC
AGGCGACAGGAAGAACTATGCCTCTGCCACACTCTCCGAACTACTGCCAGAAGAGGTTGA
AGCAGAAGTGAAAGCAGCTGCAGAAATATCTATGGGAACAGAAGTTTCAGAAGAAGATAT
TTGCAACATTCTGCATCTTTGCACTCAGGTGTGTTATCCCTATAGAAAATCTAGGTGTGG
TACCAGCTGTAGAATACTAATTTTCTGATGGCGATGATGATGCTTACACTTCGGTTCACC
TGATAACATAACATGAGGGTGTTCAGTCACTACCTCATCTGATGCCATTTTGATTTCAAG
TACACATGAACAGGGAGATAAATACTAAAATGATGTAATTTGTGTTCTTAGCATCAGCTG
ATAATTAACCAAGAATCTATTAACATTCAGGGAAGTGTGACTTCATTTATGTTTATAGAC
TGTGGTTTTTCTCTGCCCTGAATTTGAAGATAGCTATGCAAGAATCACAGGATAACACAA
TGTCTAACCCCTTGGAATTTTGAAACATAAGAATAATATTGGTGAAAAACATTTTCAAGC
AGTGTCCTAAGTGATTTACATACATTAGCTAACAAAATCTACAAAACAACCATTTTATGG
AATACTGACGTCAGGAGTAAATTTGAATGTCTGGTCTTTGATAAATCAGGACTCCAGTAT
TGACAGCATGTGAATTTGACACTGTTTCTTCCTAAAAGGTATTTGTGACTTATTTATTCC
GTATATTAGGTGATTGAAATCTCTGAATATAGAACCCAGCTCTATGAATATCTACAGAAT
CGCATGATGGCCATTGCACCTAATGTTACAGTCATGGTCGGGGAATTAGTTGGAGCACGG
CTTATTGCTCATGCAGGTGACAGTTTTCATGTTATTTATAAACCTAAGTGTTTGTTTTCT
CGCCAAGGTTTTATGTCTTTGAAGTAGTTATTAAACATTTTATGTGATAAAAGCAGATAA
GTGGCATGTGGGTATGGGCTAAGGGGCCAAGTGTTCAATGATGACATTTATTTTTTTGCC
TGATTTCCTTTTGGATAATGAAGGCATCTTTAGTCACTACCTCTTCTGAGACACTTGTGG
TCCATTGTCAGAAGTTTGTTATAGTTAATTGGAATAATCAGATAAATGCAGTAGGATATA
ATGAGTTAAATTTTCTATCACTAGTGCTGTTGTTATACCCTGTTCTATAAAATCTTAAGT
ATCATCTAGATGGAAGTGTTTAAAACTAGAGTAACTGCTTTAGCTGTATCATTTTATCAG
ACAAATATCCCATTGATCTATCCTAGGATATAAGGTTAGAATCATTTGCTTTGGGGTTCT
GGCATTGTGGCATAGATGCTGTCATCCCCTATTGGCACTGGTTCCTGTCCTGACTGCTCC
ACTTCCCATCCCGGTCTCTGCTAATGGCCTGGAAACTGGGAAGCAGCAAAAGATGGTTCA
AGTACTTGGGTCACTACCACCCATGTGGGAGACCTGGAAGTAGCTCCTGGCTTGAGCTTG
GCACAGCCCAGGCTGTTGCAGCCTTTTGGGGAGTGTACCAGTGGATGGAAGATCTCTCTC
TCTAACTCTGCCTTTCAAATAATTAAGTAACTCTTTTAAACAGAAAAATAATTTGATTTG
GTTTCTTTATCTTTAGCCACATTTCATAGCTGTAGCTAAGTTTTAGCAGTGTGAGATGCA
GAGTTTTAACAGAAGTGTGTTTGCACTTTAATCTTGTCTAGTGCTTGAATTTGTAGCCTT
AATGTTGAATGTGTTTTCCTTTTAAAAAAAAAAGATTTATTTATTTATTTAATTGAAAGG
CAGAATTACAGAGAGAGCGAGCTTCTATCCACTGGTTCACTCCTGAAATGGCCACATTGA
CCGTAGCTGGGCTAGGCCTAAGCCAGGAACGAGCTTCTGGCAGGTCTCCCATATGGGTAC
ATGGGGCCCAAGCACTTGGGCCATCTTCTTCTGCTTTCCCAGGAGCATTAGCAGGGAGCT
GGATCAGAAGCGGAGCAGCTGGGACTCAAACTGGTGCTCATACGGGCTCCTGGTGTCCCA
GACCGCGGATTCCCGCTGCCCCGCAGCGCCAGACCTGGAATGTGTTTTCTGACAGAATAT
ATTCCATGCAACAAACCCAACAAAGCCATCTCTTGCTGATGAGTATAGTGTAGACACAGT
TCTTCTGAATCTATATCTGAAATAAGCATAAGTAAAGTATGGGTGATTGATCAGGTACTG
CTGAAGTATCTAATAAATCTGGTTATTTGTATTCATATTCATATCTGAAATAATATTTAT
TTATTTAAAGTCCCAAATCTCAGAAAATCAGGATTAGATTGGTTTATGTGTGGATAAATA
TGTGTGTGTGTGTTTCTATATTTATATCACCCTTGTGTTGTGTTCATGGAATGTAGAATA
GTAGTAATACCACCCTTTAGGAAAATAAATAATATCATTATCACAGGCATGTATCACAAA
AAGCCTTAGCTTATGTTAATGAGAGTCACAAATGAGAGAACTTTCAGTGAATTCTGTATT
ACAGAATCCTGAATTGTTTGTATTTTATTATTAGTATGATAGCTGTGTAAATAGAGCGGA
AAGCTAATGCTTAGCATGTGGAACTTCTGAATGCTTGCAAGTACACTCTTTCTACCTACA
TACTTTTTTTCTTTTGTAGGTTCTCTTTTGAATTTAGCCAAGCATGCAGCTTCAACAGTT
CAGATTCTTGGAGCAGAAAAGGCACTCTTCAGAGCCCTCAAGTCAAGACGGGACACCCCG
AAGTACGGTCTCATTTATCATGCTTCTCTTGTGGGTCAGACAAGTCCTAAACACAAAGGG
AAGGTGAGCTACAATTTTTCTGAAGTTGGACTTCTTTTTCCCAGACAATAAGCTTTTTCC
CTGTCTTTACTGCATGTAAACTTTTTGTTGTCTTTTAGTAAATAGGGAATGATGTGTTCT
TTAATAAACACTTTTTTGTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATAAATTAAT
AAACTAATTAAAATATAGTTCTTCAGAGAACTATTCAAAGGATGTGGTGGGGGACAGGAT
TATCTGTTTTTTTTTTTTTAACAGGCAGAGTGGACAGTGAAAGAGAGAGAGACAGAGAGA
AAGGTCTTCCTTTTGCCATTGGATCACCCTCCAATGGCCGCCGCGGCCGGCGCACCGCGC
TGATCCGATGCCAGGAGCCAGGTGCTTCTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGC
ACCTGGGCCATCCTCCACTGCACTCCCTGGCCACAGCAGTGGGCTGGCCTGGAAGAGGGG
CAACCGGGACAGAATCCGGCGCCGCTAGGCAGAGGATTAGCCTAGTGAGCCGCGGCGCCG
GCCCAATTTTTTTTCTTTTTTAAGATTTATTTCTTTATTTGAAAGAGCTACACCGAGGAG
GAGAGGTAGAAAGAGAGCTGGATCAGAAGTGGTGCAGCCGGGTCTCTACCCAGCGCACAT
GAGATGTCAGCACCGCAGGCAGCAGCCCTACCCACTATACCACAGCACCGACTCCTGGAC
TTGTTTTTGAATGGCCTTAAGGAGTATCACTGGTGTCTGGAGTAGAAACTAAAGGAAAAC
ACTGGAATAATAGTTTGAGCTGCTTTCAGATATGAACTGCTGCTATAAGAGCTCATTCAC
TGAACCATTGACAATGGAGAATAACTAGTTAGCTATCACTTGCAAGATGCGAGTAGACCC
ATGATAGGTGACCTGACTCGTGTGACTCATACAAATCCTAGAATAAATGTGATGATTTTC
TTCTACTTTCCCATGAATAAATTATTGAGATTTTTATATCTGTCTTCATAATATACTTGA
CTGCCTGAAACTTATATGTTTTCTATTAGATTTCTCGAATGCTGGCAGCCAAAACTGTTT
TGGCTATACGTTATGATGCTTTTGGTGAGGACTCCAGTTCTGCGATGGGAGTTGAAAATA
GAGCTAAGTTAGAGGCCAGGTTGAGAACTCTGGAAGATAGAGGGGTAAGAACCACATCCT
GATGTTTGCAGAATGTTACCTGTAAAAAGTGAATGAACTATTCATCATTTTATATACTCT
ACCTGCTAAAAATAATACATGATTATGCATTATAGTATGCATAATATATTTTCTGTGTGC
CTGCTAATAACAATTTCTTTTACTTACCAAGAAATATGTATTAAACAGTGTTCAGCATTA
AGATATGCTGTGCAAAGGAACAAAAGAAAATTGGCAGCTGTTGCTGCTTGCTGGCCCAGT
GATTTTCTAGACAATGTATTATAAAAAGATTATGACTTAGAATTTCATGAGTAATTTCCC
ATTTTCTTTTTAGATAAGAAAAATAAGTGGAACAGGGAAGGCATTAGCAAAAGCAGAAAA
ATATGAATACAAAAGGTGAGTATAGTTAGGGAGGGTGAATGAATAGTTTTTATGTAAGTG
TTCATTGTTAACAGCAATTTTGAAATTTTTTAATTACCAAGTAACATTGTTTATATTTAT
GTACCTGTTTTGATAAATATGCATTTTGGAATGGCTAAATTGAGCTAATAGGCATACAAA
TTGTCATCCTTTGTGGTCAGAACACTTAAGTCACCATTTTATACACCCTAATTTTCCTTA
CTATGTAATTTTCCATACTCACTTCCAGTTTTTAATTACACACCCATAATAATTTCTAGA
TTCTGTTAATAATTTTTCCTTTCTTAAAATTTTCTTTAAGAGTTATTTATTTGAAAAGCA
GAGAGAGGAAGAAGAAGGAACAGATCTTTTTTTTTTTTTTTTTTTTTTTTAACAGGCAGA
GTTAGACAGTGAGAGACAGAGAGAAATGTCTTCCTTCCGTTGGTTCAGCCAGTGCTGCGC
CGATCCAAAGTCAGGAGCCAGGTGCTTCCTCCTGGTCTCCCATGCGCATGCAGGGCCCAA
GCACCTGAGCCATCCTCCACTGCCTTCCTGGGCCACAGCAGAGAGCTGGACTGTAAGAGG
AGTGACTGGGACAGAACCGGTGCCACAACCGGGAATAGAACCTGGGGTGCCAGCGCCACA
GGCGGAGGATTAGCCTAGTGAGCCACGGCACCGGCCAGGAATGGATCTTCCATCTGCTGG
TTTACTCCCCAGATAACAGCAACCACCAAGTCTGGGCCAAGCCAAAGCCAAGAGCCAGGA
GCTCCATCCTGGTGTCCCACATAAATGGCAGGAGCCCAAGCATTTGAACCATTTTCCTCT
ACTTTGCTGGGTGCAGGCATCTGGATCAGAAGTGGAGCATCTGTGACTTGAACTGGCACT
CTGATGTAGGATGCTGGTGTCTCAAGCAGCAGCTTAATCTGCTGTACTGCAGCACAGCCC
CCAATAGTAATTATTTTTAATTTGAAGTTTCCCTGTAGCATGACGTTATCATAAAGATAA
TGTTCAGAGTTGATGCACAATGAATTTTAAAAAAAGACTGAAGACAAGTGTAAAATGGCT
CCTAGGTGTGAAGTAGTTAAACCTCCCTGTCAGATTAACAAAAGATTTGTGTGTGGAGTT
CCTTTGGTTATTAGTTATTAGTTGTTCAGTACTGGTGAGATTGTGATGAGAGTGTGGTGC
AGCTCTTCTGGGAAACTGATGTGTGTCCAGCTCCTTAAAAATGTGCTAGTCGTTAACCCA
ATAAATTCTACTTTTAGGACTTTGAAAATCCTTTAAGAAATGTAGCAGTAAAGTCTTGTG
GGTGGAGGGAGTGATATACAAAAACACGTCAGTTGTTAAAGTGCATTATATGAGGACAGT
AACATCTGTATACCCAAGAGATGTTTCCTACATTCTGGAAAGACTAAATATAATCATTAT
GGGCATTTGTAGTTTGCTGCTTTTTCCCTTCAAGTTTTCTGTAACTGCCATATATTCTAT
AATTTTTAAGGTCTATAATTTGCTGTCTTTAGTTGAAAAATATGGATCTTTGATCTTACT
TATAAATGTTTTTAACCTATAAAATTTATATACACAATTCATAAGTCACCTACAAGGCCA
CATAAGAAAATAATCTGCAGTACTTTTTTTTCTTTTCCAATTTTGTATGAAAGGCAGAGA
ATGCCTGCAGCAGCCAGGGATGTGCCAGGTAAAAGCCTGGAACTCTATCCAGGTCTCCCA
CGTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCTTTTGGGTTAGTCCAGCTGTAAAAGGAA
TTTCTCCATTTGTTTTCCGTACCATAGTAACCACATTGATTACTAAATCAAAATTCACAT
AGCTCACCACTTCTTGAAAGTGATTGACCTACTTGAAAAATATTAATACCTTTATCTTTT
GGAAACTATTAGTCTTCATAAACTACCCCAAAGCTACTAAAATGAAACAACATTGTATGC
TTATGTAAGTATTACCTAATGACATTTTCTTTACATCTCTTGAGAATTATTTCAGTTGCA
GATGTGTGTAGAGATTTTCTAAAACTCTGACTCTTTCAGTGAAGTGAAGACTTACGATCC
TTCTGGTGATTCTACACTTCCAACCTGTTCTAAGAAGCGCAAAATAGAACAAGTAGATAA
TGCGGATGAAATTACTGAAAAGAAAGCAAAAAAAGCCAAGATTAAAATTAAAGGTTAGTT
TAGTTTTTTGTAATGCCCTTTAATTCTTTACTTGTGTGATTACTCCCACATATATACCAT
TTGACTCATGCTGAAAGCTAAAGCTGCTTTGATCAGCTGTTATGTTCTCTGGGAATCTTT
AGGATATTGTTAAATTTGTCAGACTTCACAGAGCAATGTGAACATTCTTGAATATAGTAC
TATACTACATGTACCAAAATTCAGTGTTACTATAAGCAATATTTTGAGAATGAGAGTAGA
AGAAACACGAGTACGTGCTTTCTCGATTGGTTCACTGAAAACTTGATAGATTTCTCAATT
TTCGTTAAGAATGAGTATAGAAATGGTGTAGTGGTTTTCTTTGTTGTTCCTCTCACAGGG
AATGGACTAAAGAGAAACATACTCAGTAGCCTGCCCTTGTGGTAATGATGTTGGATAGTT
GCTCACCAGTGAATGAGGCTGGCTGTTGAAGAGTCATACCTCTGTTTATTTAGCATCTTC
ACATTACTCTAGCAAAAGTGAAGCATTAAAGCATTGATTGATTCACTTGGTTTCTGAATA
ACTTAGGGGTCAAAAGTAGACTGTTACCAAATAAGTGCTCTTGCCCCAAGAAGAGAATAT
ATAAACAAATCATTTAACTTCTCTGATTCCAGTTACCTACTAAAAAGCAATGAGATTGCT
AAAAGCATTAGTGGCATTTGAAATGCCAAATTCTAGATTTATATCATATATGCAATTAGC
TTTTCAAACAGGCCTGGGTCCTTGCTACCCCCAATCTGCCATCCCAGTTTTCCGTCTCAG
AAATGACATTTCCAGTTGCTTTTGCCATCAGCCTTCGCATTCTTTTCATGACCCAAATCT
ATTTTGGCTGCAGATCCTCTCAGTTCTGTTTTGAAAGCATGTAGTAACCACGGAGGCACC
CCGGTACCCCTTTGATCTCTGTTAAATTTGTTTCTTGCTCACTCTGCCCTAGTCACACTG
GCCTGCGTAGCTGTTCCTTAAGTCTGCCAACCAGCTTTCAACCACCACAACCCCCACCCC
CCAAAAAAGAAAAAAAAAAAAAAACACCTTGGGATGTTAGCATTTATGCTTTCTATCTGG
AATATTTCTCCTCTGGATAAAATGCATCCTTCACTTCCTCGCCTCTCTTGGACGTTTTCC
TGACCAGTCTGTCTCATGTCCATACGTACTGCCATTCCCCTACATTCCCTTTCCTGCATT
GGTAATCCTTAGCACTGATTATTTGTTTACTAACTCAGTTCTCCCATTCAATGCAATATA
AATAAAGCAGGGACTTTAAATCCCAACAATCTAATGAGACAGATGTGCTTAAATGTTATA
GATGAGGATATGGAGGTTTACAAAGTTAGAGGGATTAGGGTAAGCATGAGAGACCTTTCC
AGTTATAAAAATGAACATAATACATTATATAGTTGACCAGAATGGCAGAAAAAAACAGGG
TTTGGAGGAGTAATGGGTGATGTTGATTGTTATGTCTTTGTACTTAAACCTTTAGTTGAA
GAAGAGGAGGAGGAGGAGGAAGACAAAGTATTAGTGGTCGAAGAGGAAACTCCTGTGAAG
AAGAAGAAGAAAAAGGATAAAAAGAAACACATTAAGGAAGAACCCGTTTCTGAGGAAGAG
CCATGCACCAGCACCGCAGTTCCTGTATGTCTGCTTTCAGGACTGGTACTTACTGCAGGC
CAGGGCAGGGTCTCCCCGTTCAAATCCACTCTCATCAGAAGTGATCAGGCATTTTTAAAA
ATGTTTGTGTTGGTGGAGAAGCTTAATTTATTTACATACTGCGTTTATATTATGTAAGGC
TATTTCTCACATTTATAGCCGTATTACAAAAGATGGTTTACTTTGAGAGAGGAAGAGAAT
ATTTTTAGATTTCGGCCTTTGCCCCATTTGTTTTCAGGAACAAAAGACTGCATTTTATAA
GAAAAGGTTACTATCCAGAGAATTGGCAGCTTTTTGACAGTGTTCTTGTTGCTTACTTTC
AGAGTCCAGAGAAAAAGAAGAAAAAGAAAAAAAAGAAAGATAATGACAACTAATAGAAGG
GAACTGTTATTCTCTGACCAGGACACATCAGCTTCAGTTGGGAGTGTACCAGAGATGTCA
TCTACAGTAACCGAGAGGTGGTTGAGTAAAACAAAGCGAATCATCCATCGATAGCTTTTC
AAACCAATTTGTGTCTTGACATCAACTCTGTTAACCTTGTTATATCATTTCTTAGAGTCT
TTGATAAACAAATAAAAATATTTTATTTGTATTAAAGCATTTCTGTGATCTATTTTAGGT
AGAGAATCTGTGGGCTGACCCTTATTTGGCACCTCATGATTGATTTGAACGTTGTAGCTA
AAGTGAGAGTTGTTGGTGGTTAATTTGAAAGTTGGCCTTCTGGAAGGCAATGATTGGGTA
GACCAATTTAAGAGTCTTTCTATTGGGTTTCTCTTGCCTTTTTTGAACATTATTCTTTTC
CCTCCTTTTATCTTTCTGCCTTTTTACTTAAAGATTTGCTTCTTATTCAAATTTTGAAAT
TAGGTGAGCAGAATTTTTTGGTATCTTAACAAAGGAAGAAAACAAGTCTATAACTCTGTA
ATTCTAGAAGGTATAGCAAAAATGTGACTTTAAAATGTAATAAGATATTATAAGATTATC
TTAAACAATAGGGAATAAAAGGAAGAACAAGATGAGAAAAAGCAAAATGTTGACAAAAAT
TGGGTGTAAATCAGTACCTGGAGTAGCCACGAGAATTTTGTTTCTGAGATAGTGTTTCAT
ATGCAAACAGAAACATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1052, 21605..21726, 25972..26108, 27268..27332, 29470..29604, 29882..30027, 30609..30735, 32539..32702, 34169..34303, 34633..34694, 37179..37312, 38815..38963, 39302..39352
1001..1052, 21605..21726, 25972..26108, 27268..27332, 29470..29604, 29882..30027, 30609..30735, 32539..32702, 34169..34303, 34633..34694, 37179..37312, 38815..38963, 39302..39349
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved