Oryctolagus_cuniculus Locus ENSOCUG00000007011
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000007011
Oryctolagus_cuniculus
ENSOCUG00000007011
GeneScaffold_3659
SNORD73, SNORD73
2663..2740, 4692..4757
6309
CCTCACTGCCTTTCAAATGAATAAACAAATCTTTAAAAAACAATTTAAAGATGTTTATT
ATGGTGCAAAATTTTTTTTTGAAAGCCATGCAATTTCCCATGAACTTTTTGAGGGCTTCT
CCAGTGCATGCAATTCAAATGCTTTTTCTTTTTTTATTTATTTATTTATTTATTTTTTGA
CAGGCAGAGTGGACAGTGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTTGCCGTTGGT
TCACCCTCCAATGGCCGCCGCGGCCGGCGCACTGCGGCCGGCGCACCGCACCGATCCGAT
GGCAGGAGCCAGGAGCCAGGTGCTTTTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCAC
CTGGGCCATCCTCCACTGCGCACCTGGGCCATCCTCCACTGCACTCCCGGGCCACAGCAG
AGGGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCCGTTGCCCCGACCGGGACTAGAA
CCCGGTGTGCCGGCGCCGCTAGGCGGAGGATTAGCCTAGTGAGCCGCGGCGCCGGCTCAA
ATGCTTTTTCAACAAAATAAACTTATTCTTAAATTCCAGTTTCCCACCAACTTCGTGAAG
TACACGACACTGACGCGTAGAGCGTTTGCAAGGCTCAGTGGCGCCGAAACTCGCACTTGA
ACCAGGCTCTGTTGCTTGATTCCATACACTGGACGGCGAGTCCAGCCGGCGTCTCCTTCC
GCGGAAATTTACTTCACGTCACAGCCTCAGACACCGCCGGCAGCCATTCCCAAGGACCGA
AGGCCACCAGGCACCCGCCTCGCCACAGCACGGCCTCCGGACACACGAGGGCGCTGTCGC
AGCCTCAGTGGGCGGCCTGTCACTCGCTGTTGTCGCGATATTCTTGAGGCAGGAAGAAGA
AACGATCAAAGGTCACGTAAACGACGCGCCCCGCCCCGTTCTGTACGCCTAAGTTCTCGC
GCGAGTTGTACTTCCGCCCTTTTGGCTCTCTGAGCACCACCATGGCGGTCGGCAAGAACA
AGCGCCTTACGAAAGGCGGCAAAAAGGGAGCCAAGAAGAAAGTGTAAGTGGCGGCTGTTG
TGGAGACTTGCTTTCTGGGGTTCTGCTGGAGTGAGCGGGTGGGCCCTTGGTCGCGGCGTG
GGCCGGATGGCGAAGATGCCGGTTGGATTGCGCGGGCCGGGGGCAATTGGTGCACGGCAA
ACAGCGGCGGCCTGGCCGTGTTGGTTGCTGTGTCGTGGCGGGCTGGCTGCTCGTCGTAGC
TTTCGGGGCCTTGCGGACGCGGCGGTTGAGCCGTGTTGCTGGGGAGAGTTCGGCTGTCGG
GACTCGCGGGGCTGCCTGAGTTGCGTGGCAGCCCGTGGAGGAGCTGCGCTCCTAACTTCA
CTGTCGGACAAAGTTTAGCCCAGAATCAGATCGCCAGTTAGCCTCCTAACAAGTGGTACT
GGAAGGAAAAAGCTTAGAAAAGCAGTCGGAATTAGGTGATAATGCAGTGAATCTTAAAGG
TGTTTTTAAAATTCAGGGTGGACCCATTTTCTAAGAAAGATTGGTATGATGTGAAGGCAC
CTGCTATGTTCAACATACGAAATATTGGGAAAACACTGGTCACGAGGACCCAAGGAACCA
GTGAGTATCTTGTTCTGTTTCCTTACACGGGGGGCACGGGAACTGTAGCATGTTCTGCCA
TGAGTCCTGGCCGCGGAGACGCTAGGGAACTGTCAGCTCCTGGTTGCAGCTTCGGCACCG
CTGCTGTTTTACACGGTACTGAGATGTGCGGGTTATTTTGAATTTCTGATGAGCACTGTT
GATCATTCATCTAGATGGACATTTGTTAAAGCCAGGCATTGTAATTCTGTTACCTTAATG
TCTAACCTCAACTCGGTGCAAGACTTTGTAGGCTTGACTTTGCTTGTGTAGTTCCTAACG
CTAACAAGACTTTATTTAATGCTCGTTCTGTAGAAATTGCGTCTGATGGACTCAAGGGGC
GTGTTTTTGAAGTGAGTCTTGCTGACCTGCAGAACGATGAAGTTGCATTTAGAAAATTCA
AACTGATTACGGAGGATGTTCAGGGCAAAAACTGCCTGACTAACTTCCACGGCATGGATC
TTACCCGGGACAAAATGTGCTCCATGGTCAAAAAATGGCAGGTGAGACTAGAGGCCCCCT
GTGTGCCTGTGGTGCAGCGGGGTGCGTGACCCAGCATGTCAGGGTGTGCTGACAGAAAGG
AGCGAGTCGTGTAATTGGAACTTAGATTCGTTCTCAATTCCTGTTTTCCCAGTACTGTTG
AATGTTAATTCTGGGGTAGGCACCCCTGAGTTTGAGCATAAGTAGGCAAGCTATGGTTCT
TCTGATTACTAACCTGTTTATGAATTGAAGCCAAGATTTAATAATTTGGTTATCAGGAAA
GATTTTTTTGACTTGGTGAAGATCCGGGTGTCAGTGGGCAGCGTCGCCTTGTTTCAGAAT
ATCTCTGGATTTCAAAATCTGGGAGATTATAAGGAAAAAAAAGTGTCTTTGGCTACTTTG
GATTTACCTCTGGGGATATAGATAGATAGTGGGAGAGAACTGGTGTGCAGCAACGATCCA
TGTAAACATGATTAGCAAAAGTATCATTTCAGGTTATTAACTGTGTCTGGCTGATCATCC
ACCTTGGGGTATTTGCATATGGGAATGAATGATGACAAAATGTTTCGGTCCCAAATGATA
TTGATATACACTGATTATACCGTTACATTATTTCTGACATTCCCATAAGGTTTTATGGCT
CTCATTCTGGAAATGTTTTAAGGCCTCTTTGTATTGAAGTTCACTTTTTTATAAACTGAA
GTATGAAATCTGGAAAATGCAAAGAAGGAAATCAGTTTCTGTCACTGTTTAAGATAGTTC
TGCTTTTCAAATTCAGGTTATACAACCATGAACTTGGGTTTTTATTTTGATTTTAGCTAT
GAATTGAATATTGAATCCTTAACATGCTTCAGTTTGGACTTTACAGAGCATTTTTTAATG
TACACATATTGATATTACAGTAATGCTTCACCTATTCAGATCACATTTTAAAAAGCAAAC
CCTAAATGTAGGCCATCATGTTCCTTTTTTAACCTATTTTCATCTTGCATAGATGGGCCA
TTGTTAAATGCATACACGTATATGCAAAAGGTGTAAGGGTTAAGGTGTGTGCAGTAAACA
GTAACAGTGGACTTGAAGACAGCTGTTTGGACTATTAGATTAAAAAGGATAGTCAGAATT
GGGGTATCAGGGCTGGCGCCGCGGCTCAACAGGCTAATCCTCCGCCTTGCGGTGCCGGCA
CACCGGGTTCTAGTCCCGGTCGGGGTGCCGGATTCTGTCCCGGTTGCCCCTCTTCCAGGC
CAGCTCTCTGCTGTGGCCAGGGAGTGCAGTGGAGGATGGCCCAAGTGCTTGGGCCCTGCA
CCCCATGGGAGACCAGGATAAGTACCTGGCTCCTGCCATCGGATCAGCGCGGTGCGCCGG
CCGCAGCGGCCATTGGAGGGTGAACCAACAGCAAAAGGAAGACCTTTCTCTCTGTCTCTC
TCTCTCACTGTCCACTCTGCCTGTAAAAAAAAAAAAAAAAAAAGAATTGGGGTATCAGGT
CACATCTGCAGTTTGTTCTGTAAATTAGATGTTACTGTGATAGTTTATACTGCATTGAGT
GTTTAGCATTCCAACTTTTTAATGTTAAAAGAGTTGCTGTTTAATATCTGCCAGTATCTT
TTTTTTCCCTAGACCATGATTGAAGCTCATGTTGATGTCAAGACTACCGACGGCTATTTG
CTTCGTCTGTTCTGTGTTGGTTTTACCAAAAAACGCAACAATCAGATACGGAAGACTTCC
TATGCTCAGCACCAGCAGGTCCGCCAGATCCGGAAGAAGATGATGGAAATCATGACACGG
GAGGTGCAAACAAATGACTTGAAAGAAGTAGTCAATAAATTGTAAGTGTCTACTTTTTTC
TTTTTTACGATTGATTTATTTTACTTGGAAGTTAGTTACACAGAGAAGGAGAGGGAAAGA
GATAGATCCTCCATCTGCTGGTTCACTCCCTGATGGCCACAATGGCCAGAGCTGCACTGA
TCCGGAGCCAGGAGCTTCTTCCCAGGTCTTCCACACAGGTGCAGGGACCCAAGGACTTGG
GCCATTTTCTACTGCTTTCCCAGGCCAGCACAGAGAGCTGGATCGGAAGTGGAGCAGACG
GCGGCTTTACCTGCTACGCCACAGTGCCTGCCCCAAGTGTCTACTTTTTAAAGATCTTTT
TATTTCTGAGAGAGGGAGAAATCTTCATCCTTAGATGGCTACAGTGGCTAGCACTGGGGC
AGGCCAAAACCAGGAGCTTCATGTGGGTCTCTCACATGGATGGCAGGGACCCAAACACTT
AAGCTATCTTCTGCTCCTTTCCTAGGCCAGTGGCAGGGAGCTGGACACAAACTTGTGCCC
ATATGGGGTACTGATGTTGCAGGTAGTGGCTGCCCTGTGGCATCTTAACCGTGGCATGCT
AGATGAGATGGAGTCCGACCTCTTTAAATTTTCTCTGAATTCTTCTGGTAGTGTCCCTTT
TCGAGAAAGTGTTAAATGCTTTTTATGGACAGAGTTGTCTTAGCAGGAGAGGAGATTTAA
GGACAGGAAACTTTTTTGCCTCAATTAGGAAGTACACTGAATACATAAAATCTGTAGTTA
ATAATGTATGGGAATAAGTGATGAAAAAAGTTTCGGTCCCAGATGATGTCCGATGATAAA
TTACATTTTTCTGATATTCCCATTTGGTAGCCAGATACATGATTCAGGTAATTTATCCTT
TACCAATTTTACGTAAAGGTTTATATGGATTAAATGATGTAGACATCCCAGGACATGGCT
TATCCCTTTAAGTGTGTGAACCCAGGACGTTTATTCATCTGATCTGTCACTGCTGGTGGT
TTGCAGGATCCCAGACAGCATTGGGAAAGACATAGAGAAGGCTTGCCAATCTATTTATCC
TCTCCATGATGTCTTCGTTAGAAAAGTGAAGATGCTGAAGAAGCCCAAGTTTGAATGTAA
GTGAGAGCTCCTGGGATTCCTGAAAACCAGGGACACATGCATTGTCCTTTTTTTAAGGCC
AGATAAGGGTCCCCTTTGCGCATAGTACTGAAAATTATCAAACACGATGTGATGCGCTGT
AACCCATGGACTGTATTCTTTCTTTCAGTGGGAAAACTCATGGAGCTTCACGGAGAAGGT
AGCAGTTCTGGAAAAGCCACTGGGGATGAGACGGGTGCAAAAGTTGAACGAGCTGATGGC
TACGAACCACCCGTCCAAGAATCTGTTTAAAAATTAGACTTTAATAGTGACAAATAAAAT
GTCCTATTTGTGATGGTTTGCTTCAGAACATTCCTTTCAAATTTGATTCTACTTAAATGA
CTTTACTTTTGTCTTTCATAGGAAAATAAACTTGTGCCCAGGGAATATTTGAATCTTTAA
AGTTAACAAGGACCTTTTTGCTAAAAAACATGGCTGTTATAACAAAACTAACGCTTGTTT
TGAAAACACTTTGGCTGCTTTAGCATGTAAAGTGGAGTAACAGTGCTAATTATGAAACAG
CACACTAAGGGGAGAAATTGCTGGATTGGGTGGACCCGATATAATTATACAGGCTTTTAA
CTATGGGAAGTTGGGCTTAGATGAAGGGGGAAGAAGACAGTAAGCCAAGCAGAATGAGTG
GTTTCTAAAAGCTTTTGGCAAAAAGTTCTTTGTGACAACAGAGATGGGATACCTCATGGT
AATTCCATTTTGCACACAGAACAGCACTACCACTAATGAGTTTTTTTTCTTTATAGATTC
ATTTGAAAGAGTTTACAGAGAGTTCCTATCTGCTGGTTCACTCCCAAGATGGCTGCAAAG
GTTGGAGCTGGACTGGTCAGGAGCTAACAGCTGCTTAGGGTCTCCCACATGGTCCATCTT
CTGCTTCCCAGGGAGCTGGATCTTAAGTGGAGCAGCAGGGACTCAGAACTGGCCCCCACT
CTCCCAGGAAGCTTTTATAGCTGCACCTGTGCCAGCATGGCTCCTGACCACACTGCTTCG
TGGTCATCCATGCTACAAGGATGTTCAATGTTCACCATTAATCCTTGGCTCTACTTACTT
GGTTGTCTGAAGCTCTGGTGGATTCTTCAAAGTTCTCAAGGCAGCATTAGGAGTGCTGGC
TTACCTTTGTGACCACACTGGCTTACTGGAAACTGGCTCTTGCTGCTACCCCAGAAAGCC
AGCAAGTTATTTTATCTGCCCAGGTAAAGATCAAATTCAGATTGGGACCCAGTGTTGTGG
CTCAGCAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1516..1619, 1953..2140, 3732..3940, 4926..5035, 5188..5309
1001..1062, 1516..1619, 1953..2140, 3732..3940, 4926..5035, 5188..5306
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved