Oryctolagus_cuniculus Locus IF4A1_RABIT
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus IF4A1_RABIT
Oryctolagus_cuniculus
IF4A1_RABIT
GeneScaffold_1838
SNORA63, SNORA63, SNORA4
2331..2453, 3140..3239, 3497..3640
6176
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTAAGTGAAATG
ATGGCAATCATCTTTCGGGACTGACCTGAAATGACAGAATACTCATTGCTGATCACTTGA
TTATTGGGGCATAATTTATGTTCCAAATGGAATACATGGTGTGAAGTAGAAGTGACAATT
TGATGTGGGATCGGTAAATATGTATCCTACTTTTTTTAGGGTATGATGTGATTGCTCAAG
CTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGA
TTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGG
TATTGATAGTGTAGTTCAAAAAAACTGCTTGCGTGTTGCATAGGTTTCAGGTTTCACAAC
TGTGAAGAATTTAAAATTTAGGGTAAATTAGTCCTGTCAGAGCCCTCTTAATTGTCCATG
CATGCAGGGAGTTTTTGTTGGAGGTTACATAGGAACTGGGTGTCTAGGTACTGTGTGTAG
GGTTGTCTCCCCAGACTGAGGCTGTGAAGCTTTCTGTTCAGGATACCCCATTCCTATATC
CATTTTCCTTACGTTCAAGTGCAGTTGTGCAACATGAAAACTGCAGTGACATGTTACCAT
TTGACTGTCTCAGTAGTTTGTGATGCATCTGTTGCATGCTATGTTTTCAAAGCTTACTGT
TAAATTGGCTTTGAAGTAAACCTTCCTAATAAAGCCACAGGCTTTATTATGGTCAAGATC
ATAAAAAGGTACAGTTCCCTGTGGGGAAAATGACCAACATTTGTCCTAGCTGTAATTAAC
AGAATTTAATCAATATTTACACCTTTCCTACATAATGAAGAATAAGATAGGATGTGCTTC
CTTTTTTTTTTTTTTTTAGTTGCCTAGCAGATAATCTGGGGCAAGAGGATCAGTTTGAGG
CATAAGAAAGACAGGGAATTTTATTCTTGAAGCAGTTAGTCTGCATTTTAAGCTTGGAAG
TAGTTTGCTGTGCATGCATAAAAGCTATTGGCAGACCAGATAACTTGCCATTATGCTTTG
GCAGTTAGTCATAGAAACTGCAGCCCTACAGGATAATAATTACCGATTTTGGCTTTTAGA
TCCAAAAGGTAATTCTGGCACTTGGAGACTATATGGGAGCAACTTGTCATGCCTGCATTG
GTGGAACAAACGTTAGGAATGAAATGCAAAAATTGCAGGCAGAAGCACCACATATCGTTG
TTGGTACACCAGGGAGAGTATTTGATATGTTAAACAGAAGATACCTTTGTAAGTATTCTC
CCTTAGGAGAGTTTTACATATTAACTGTTGTAGCAGGAAAGAAGTCAAATGATCTTTTTT
TTTTAATAGCTCCAAAATGGATCAAAATGTTCGTTTTGGATGAAGCAGATGAAATGTTGA
GCAGAGGGTTTAAGGATCAAATCTATGAGATTTTTCAAAAACTAAATACCAGTATTCAGG
TAAGTGTTCTAAAGTGTTCTTTTAAGTCTGATACCAAAAGTTTTAGATTTAACACAGGTG
CAGTTAGAACATAACTGAAGTGTTTTATTGTTCCCCCTGCTTATACAACATTTGATGCAG
AATTATCTGTCTACCTACCATTTCATAGTAGGACAGACACTTGGTCTGTTTTTCTAGTGT
CTTAATGTGAAATGTGAAAGTTGTGCTACCAGCTGGTATGACAGTGCCATCATTGTCTTT
TGAAGGTTGTGTTGCTTTCTGCCACGATGCCAACTGATGTGTTAGAAGTGACCAAAAAAT
TCATGAGAGATCCAATTCGAATTCTGGTTAAGAAGGAAGAATTGACCCTTGAAGGAATCA
AACAGTTCTATATTAATGTTGAAAGAGAGGTAATTTATCTGTTAAACATAAAAATGTACA
CTTTAACCTTCTTGTATAAGCACTGTGCTAAAATTGCAGAAACTAGGACCATGTCTTGGT
TTTTGTAATAATGCTAGCAGAGTACACACAAGAAGAAGAGTAACTGCACTAGATTGTAAA
GACTGGGGTGGACCTCTTTCTTAATGTCCAATGTCCTTTGTCTTAAAATTTGGTGCAATA
TGTTTTTGAGAGTAAATTTCATGACTGATCATACTGAAAATGAACTGACTGTCTTTGAAA
TCTTTTGTCTTTGAAATCCCATAGGAATGGAAGTTGGATACACTTTGTGACTTGTATGAA
ACACTGACCATTACGCAGGCTGTTATTTTTCTCAATACAAGGCGCAAAGTGGACTGGCTC
ACTGAGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGGTAAGAGGTGTTTTAACT
TAACATCAGTATTTACATTGAAGCAGGATTCAGACTACATATAGCTGTTTAGTGCTGTGT
TGTCGTTCCCCCTGCTCAAAGTAAGGTTGTTTCTTACTATNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGCTGATAAATTCAGTGACCTGAGCAGTGATTCTTGAATAA
AGGTTGGTTTTATTTGCAGCATGTTGACATGGACCAGAAGGAAAGAGATGTCATCCCGGG
AGAATTCCGGTCAGGATCAAGCCGTGTTCTGATCCCTACTGACTTGTTGGTATGCCTTAA
CTTCTTCCTTCCTAAATCTACCAAAAGTTAACATTTTGGGGGGAAGGTTTTGTTAATAAC
CTTTACCAACTTTGGCTATTTGGGAGAGTAAAGAAAAGACCACACTCCACAGTGGGCTTA
TACCATTTAGTATAGTTCACTACTATCTTGTGGCCTACAGTACATTTGGGTCTTTGGGGT
GGGGGGAATTTTAAACATACATCAATGTGTTTCAGGCTCGGGGGACTGATGTACAACAAG
TGTCTTTGGTTATCAACTACGATCTACCTACCAATCGTGAAAACTATATTCACAGGTGAG
AAGATGTCATTTTGACACTTGGTAAAATTAATAAATTGCTTTTTTTTCTGTGTTTAAACG
GTAATGCCGAATCAGAGTAGATGGAGTAAAAATGAGACAGTAACTTAGAACGCATCTAAA
ATTGTGTTGGGAAGATTGGTTTGAACAAAGTGGGAAAACTGTTGCCAGATTGTGGACATA
GATACAGATGAGGTTGTTTTAGATCTGTTGGTCTTAGCTTATGTTTGAGCTTATTTTTAG
TGATGCTCTTGTGTCCATGTGCTTTTTTTTCTTGGTGATTCTTCCGTAGTTGGGATTTTC
TTGGTGTCGTCTGGTAGCATTTTGAGTGATCCCTGGTTTAGTTATAGTGGCTTTATCCCT
AAATAAATTGAATTGTGCTTTGTTATATGATGTAAAAAAAGACTTTTTAAAAAATACAGG
AGTCGATAGCAGCAGTTGATGAGACGAGATGGCACTCAGAAACGGCGTTGACGTAATTTA
GGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTAT
ATTTGTTTTTCTTTTGTCATGATTATTTGATATTTTTAAGTTGTTCCAGCCAGGGCATTT
TGTACTTGAGCAGTTCTATTAGGGAGAATTTGCTAGGTGGTTTGTATTGTCCGGTTTCTA
GCAGGAAGGAAGGTAGAGAGCCGTTTAGGCGGTAAGCACGTTTGAGTAATTTTCAGTTAC
AACGTGTGAAACTGAGCAAAAAAGCAGTGATAAGTTTGGGTCACCATACCAAATCTTTCT
TTTCCCACTGGAAGAAAGTTGTAAACTTCAGGAAATAGTTAACCTTGTAGCATTTGTATT
TGCAGTTTACAGTTCCAGAAGAGCGTCGAAATGGATTACATAACTGTTCTTTTTATCCCT
GGTGTTTACATCTGTCCCAGGCTGACACCTGCTCTTGGCTGGCCCACTTTGGTATGGGCT
TTAATTTCACTACCCCAAACACAGTACTGTCATCTGCTTTATTATAATAATGCTCAAGAT
GCCTGAAAATCTCATTTTGCAGCCAGAAAAGCCTTGATTGAATCCTTTTGGCACTAACTG
CAAAGGAAGATTTTTTTCTCTAGATATTGATTAGCAGGTAGTGCTCCAATTAGCACGAAC
TATAACCTTGATAAGTAAACAGCAGCTGATGATTAACAAGTGGATCGTCATGTTCAATAG
TTCACAAGTGCATGAGAAGTATTCTGATTGCTGCTTTCTTTTTCTTACACAGAATTGGCA
GAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGA
GGATTCTTTGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATG
TGGCTGACCTTATTTAATTCCTGGTATGAGATAGTTTGAATGCAGTGCTCGCTGTTGCTG
AATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATATTTGAATCTTGTCTCA
ATGCTCATAACGGATTAGAAATACACATTTTGATAGCAAAGCGACATTAGTCGTGAGCTC
TTGTGAGGAAAGTCATTGGCTTATTCCTCTTTAGAGTTAGACTGTTGGGATGGGTATAAA
AGATGGGGTCTGTAAAATCTTTCTTTCTTAGACATTTATTTCCTAGTTCTGTAGAAATGG
TTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGGTATAAGTGCT
GTATAAAATCAGCCCAATTATGTTAAACTAGCATATCTGCCTTTATTGTGTTTGTCATTA
GCCTGAATAGAAAGGCCTTTGAAATTGATTTTTTTTAAGAAAGCATTTGAATGCGTTTTT
GTTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCT
GTTGCTAGCCCCAGCAAGCAATCATATCTTAGGTAGGGTTAAACTCCCAGTAAAATTGCC
ATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAGGT
TTTTGGTCACTTTATTTACATTCCAAAAAATCTGTTACAAAATTTAACAATTCTGAGTTA
GCTGCTGCATCACAGTGGCACAAAGGCTGAGCAATTGCAGATGCTCATCAGCGCCATCTG
CTAAGCACTTGTCAACTTCCTGTAATACAAACAAGATGTTAGTGTTCTTTCAGGTAGACC
CAAATAACTTAGCATGTGCAAAAGCAGTGCCTACTTACAGCCAATTTTTCAGTAATAATG
GACTTCTGTTTGTCAGAGAGGTCGTCATTTTCCACAACCACATCATGAAGTTGATTTACA
ACCTGAGTTGCTGCATGACCCTCATCTATTAGGTCCTACAACAGAAAGGCAGCAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1138, 1919..2087, 2169..2278, 2525..2668, 2964..3101, 3379..3468, 3695..3774, 5032..5176
1001..1138, 1919..2087, 2169..2278, 2525..2668, 2964..3101, 3379..3468, 3695..3774, 5032..5173
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved