Oryctolagus_cuniculus Locus ENSOCUG00000015533
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000015533
Oryctolagus_cuniculus
ENSOCUG00000015533
GeneScaffold_2706
SNORD14, SNORD14
2820..2906, 3218..3300
5094
GGCCCAAGGATTGGAGCAGGCTTCCCATTGGGGCTTGCAGAGGTTGCCGGGCACCATTG
GCTGAGGCTGCCATGATAGGCAGCCGGCAGGGGCGGGCCCCTTCTGGAAGGTTCTGAGAC
AGGGTATAAGAGGCAGGGTGGCGGGCGGAAACCGGTCTCATTGGAGTCGGTGACACCTTT
TCGGCCGGACGTACTATTTTTCTGAGCCGAGCCGGGCCTTCGCGCAAGGTAAGGTCTTTG
TCCTTTGAGCGCTTGGTGGTAGCGGGGTGGGGGGATCTCCGAGCGCATCGGGCGGAAGCT
GAGGGAGGCGCCTGCGAGCCCGGGCTTTCGGGGCGCCTGAGCGAGGGAGCGTGCGGCGGC
CTGGCTGCCGGCTGAGACCGCCTTCTCTGAGGCGGCGCGGCGCCTGGCTGGCAGCCGCCG
GGGCGGCCGGGCTGTGCGGCGGCCGGGAGGGCAACACGGGGTCCCGTTCGCGCCAGGGCC
CCTCCGCGACCGCGTGGCCGGAGGAGTTGGGGGGGGGCGCCACATCCGTTTTCGGCCTGC
GGGGCTTGGCAAATGGAGCCGGCCCTTTCTGCCTCATTGCTTAATCCGGTCCCATTCAGG
GTCTTAGAGGAGGAAGCCGCTCCTGGCGTGCGCCCAAGACGGGGCTGCTTTGGGTTTTTT
TAATTTAAAGGCCGAGTGGGGCCCGGGAGCGCGGGGTTCTGGCCGAGGTGACCTGGGGTT
CTGCTCGGGGTGAGAGCACGTGCGCCGCGGACCCTCGGGGCAGGCGGCTCCTGGGGCCCG
GGGCGGGCTGTGCTGCGGTTGGCACGGCAACCCTAACTGCAGTGGGGCTGCGAGGCCCTC
CCGCGTGCCGACTTCCGCCCCAGCGGTGCTAGCGTGCTGAGCCAGGCCCTCGGCCATCGC
TGTAACCGGGTTTCGGGCTTGAAGGACAGGGGTGAATATTTATAGCTGAGTACGCTGTGT
AGAGCAGGTATATTTATTTTTTTTTCCTCTTTACAGCAATCATGTCTAAGGGACCCGCAG
TCGGCATTGATCTTGGCACCACCTACTCGTGCGTGGGTGTCTTCCAGCACGGGAAAGTGG
AGATAATTGCCAATGATCAGGGCAACCGAACCACCCCAAGCTATGTCGCCTTCACTGACA
CCGAACGACTGATCGGTGATGCTGCAAAGAATCAAGTTGCGATGAACCCCACCAACACGG
TTTTTGGTGAGCCATTATAATTGATTTGCCGTGTGGGTTTGAGGGGACCTAGGCAATAGG
ATACTTGGGATGCTGGCACAAGGAGACCCTTACAGGAATTCAATCCTTATTACCGTTAAG
TTGCCGTTAATCATGGGCTTAGTTGTGAAAACTACTGAAATTGGGCATTGTGCTTATGAA
TCTTACAGATGCCAAGCGATTGATCGGACGCAGATTTGATGATGCTGTCGTTCAATCCGA
CATGAAACATTGGCCCTTCATGGTGGTGAATGATGCCGGCAGACCCAAGGTGCAAGTAGA
GTACAAGGGAGAGACGAAAAGTTTCTACCCAGAGGAGGTGTCATCAATGGTTCTGACGAA
GATGAAGGAAATTGCAGAAGCATACCTGGGGAAGGTAAGGGTAATGCTGAGAACCGCAGG
CTGAGTGCATCATTGGCTGAAAATACAACAAGTATTTTTGAGATTTCTAAACTGAGCAAG
TATATGGTAGTTGTACTGTTGATGGTTAGTGGTTTCCAATAACTTGCTGGGATTTGGGGT
TTATGTCCCAAGTAGATTTGAACATGGGCGTTAAAGAGCATTTTATAGTTGAGCATAGTA
ATTTAGGATTCTTAACTTTCATTCCTAGACTGTTACCAATGCTGTGGTCACAGTGCCAGC
TTACTTCAATGACTCTCAGCGTCAAGCAACCAAAGATGCTGGAACCATTGCTGGTCTCAA
TGTACTGAGAATTATCAATGAGCCAACTGCCGCTGCTATTGCTTATGGCTTAGACAAAAA
GGTATGTAACATCTGTGATGGAAATGAAAGCTTAGGGTGATGAGCCAGCAGAGGTGTTTA
CATGGTTTTTTAATTGCAGGTTGGGGCTGAGAGAAATGTGCTGATTTTTGACCTGGGAGG
TGGCACTTTTGATGTGTCCATCCTCACAATTGAAGATGGAATTTTTGAGGTCAAATCCAC
AGCTGGAGACACCCACTTAGGTGGAGAAGACTTCGACAACCGAATGGTCAACCATTTTAT
TGCCGAGTTCAAGCGCAAGCATAAGAAGGACATCAGTGAGAACAAGAGAGCTGTCAGGCG
TCTCCGCACAGCTTGTGAGCGAGCTAAACGTACCCTCTCTTCCAGCACCCAGGCCAGCAT
TGAGATAGATTCTCTGTATGAGGGAATCGACTTCTATACCTCCATCACCCGTGCTCGATT
TGAAGAGTTGAATGCTGACCTTTTCCGTGGCACCCTGGACCCTGTCGAGAAAGCCCTTCG
AGAAGCGCGAAGTTAGATAAGTCTCAGATCCATGATATTGTCCTGGTGGGTGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTCTACTAGAATTCCCAAGATTCAGAAGCTGCTTCAAGACTTCTC
AATGGAAAAGAACTGAATAAGAAGCATCAACCTGATGAGGCTGTTGCCTATGGTGCAGGT
AATAAATCACTTTTAACCATTTAACCTGGTAAGCAGCCACTTTTTAGTGGATCAAGATGA
CCGCTATGATGAGTGATCCTTAACCATTCGTAGTTTCCACCAAAAGCTTGGCTAATGATG
GCAAACCTTCCTTGGATGTCTGAGCGAGTCAGATTGGTTATGGAAATGGTAGAAGTTTTT
CTGTTTAACTGAATTTTCCTTTCACCAGCTGTCCAGGCAGCCATCCTGTCTGGAGACAAA
TCTGAGAATGTTCAAGATCTGTTGCTGTTGGATGTCACTCCTCTATCACTTGGGATTGAA
ACTGCTGGTGGAGTCATGACTGTCCTCATCAAGCGCAATACTACCATCCCTACCAAGCAG
ACACAGACCTTCACCACCTACTCCGACAACCAGCCTGGCGTGCTCATTCAGGTATGTCTA
TTTAATGTTGGCTTGGTTTATGGAGGTTGGGAAAGTTTGCGCTGTGATAGATTCCAAAAC
CATTCGTAGTTTCCACCAGAATTCTTATGTTGGCAAGTTCCTTCCTTGGATGTCTGAGCG
TTAAGTCTTCCCTAGATAATCTTAGATAATTAGAACTAGGACAGAAACCTTAAATCTTGC
AATTTGTTTGTTCACAAAGGTTTATGAAGGTGAGCGTGCCATGACCAAGGATAACAATCT
GCTCGGCAAGTTTGAGCTCACAGGCATACCTCCTGCACCCCGTGGTGTTCCTCAGATCGA
AGTCACATTTGATATTGATGCCAATGGCATTCTTAATGTATCTGCTGTGGATAAGAGTAC
AGGAAAAGAGAACAAGATCACCATTACTAACGACAAGGGTAAGGACAAGGATTGCCTTTA
TTGCTAGGGAGGGTTTAGGAGATGGCATGTTAACGAAATTTGAACTATTACTAAAAAGAT
TATCCCAACTTGCAGGCCGTTTGAGCAAGGAAGACATTGAGCGTATGGTCCAGGAAGCTG
AGAAGTATAAGGCTGAAGATGAGAAGCAGAGGGACAAGGTGTCTTCCAAGAATTCAGCTT
GAGTCCTATGCATTCAACATGAAGGCAACTGTTGAAGATGAAAAACTTCAAGGCAAGATT
AATGACGAGGATAAACAGAAGATTCTTGACAAATGCAACGAAATCATCAACTGGCTGGAT
AAGAACCAGACCGCAGAAAAGGAAGAATTTGAACATCAGCAGAAAGAACTGGAGAAAGTC
TGCAACCCAATCATCACCAAGCTGTACCAGAGTGCAGGGGGCATGCCAGGGGGCATGCCT
GGGGGCTTCCCTGGTGGGGGAGCTCCTCCATCTGGTGGTGCTTCCTCAGGGCCCACCATT
GAAGAGGTTGATTAAGCCAATCCCATTGTAGATGCAGCATTGTTCCACACAGTAAAAGAT
GGAAGGACCCAAATTTGTAGCAAATTCTGTGGCAGTTTTAAAGTTCAGCTGCTATAGTAA
ATTACTGGGCATTCTCAATACTTGAATATGGAACATGTGCACAGGGAAAAGAAATAACAT
TGCACTTTATAAGCACTGTATCTAAGTGGAAAATGCAATGTCTTAAATAAACCTGTATTT
AACATTGGCACCATACAGTTGTCTTGACTCTTATTAAATAGTAGGCCAGGTTTAAGCAGG
TGCCTGTTGAGCACCTATGAGCCTGTGAAAAGTGGTTTTTGCTAAGGTGGCAACTAAGGC
AGTTCCTCAGTAAGCTGTGTTGAGGCCTTGAATTTGTGTGGCATTCCCCTCTGGTGGCTG
GAGTAGTAAATAGTCAAGGCAGGGTGGTTAAAAAGGCAGGTAGTTGGTAGCAGAGCAAGT
CAGTTGCTCACCATTAAAGACCTTTGAAAAGGTTGAGTGTCATCTTAGTGGAGCCTCAAG
GTGGGAGAGTATTTCTGTAAATCTAGTGTTTTCTATAAGTTTGCATGATAGCTGAATTCT
GTCAGTGCATTAGCAAAGACTGACAATGGGTGATAATGTACATTTTGCCCTATGCACCTC
CAGGAAAAGTAGATCAGAGGTGCTTTAAAATTGATTAGAGTTCACCGGCCACCGAGTGGC
CATTTGGAATCCCAACCGTGCAGCCATAAAGTGTGAAGTCATCTGCAGCAAAGCTTTGCA
GTTAATCTATATACTATACTGTTCCTGTGGCCAGCCCAGTTCCTATTCTGTAGGTATGAA
GTTAGGGCAAAATGTTTGATGTATTTGTCCAGTTCAGTGAACTGGTCCATTCATGAAATG
GCTACTTAAGCATCCTGAAGGACACATTAATGCCTACCCATACACCAAGAGTCTTCCATC
TTGGTTTTCCATGGGTCTCTAGAGGTTAAGTGGAGTGCATTGTAGGATAATACGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 1388..1593, 1828..1980, 2059..2462, 2465..2512, 2655..2697, 2700..2720, 2722..2727, 2730..2757, 2968..3170, 3379..3577, 3675..3775, 3777..3908, 3954..4094
1001..1205, 1388..1593, 1828..1980, 2059..2462, 2465..2512, 2655..2697, 2700..2720, 2722..2727, 2730..2757, 2968..3170, 3379..3577, 3675..3775, 3777..3908, 3954..4091
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved