Oryctolagus_cuniculus Locus ENSOCUG00000007879
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000007879
Oryctolagus_cuniculus
ENSOCUG00000007879
GeneScaffold_6793
SNORA38
1290..1421
17883
TTACTCAGAAATGAATGCTCGTTCTAGAATGGACTCCGGATGGAGAGCTTTGGCCTGCT
CGGGGCGAGGGGGTAATTGGGGCAAGAATGACCGCCGAGGGGAGTTTTTACCGATAGGGA
AATGGGAGTTGGTTCTGGTGTGAGGCCTGAGGTTACCGAGTGCTGTCGAGGTGGATCTGT
AATGCTTTGTTTTTCTCAATTCTGTGTCTGAGAACCCAGAATTTCTATAGAGACAGGATT
GTTTTTTCCAGGAGCTGAGATGGGAGCAAGTTGAGAGAAAGATTGGTTATTTCAAAACTT
GGGCTTCTGCAATCCGGGTCTGTGTAAGCCACTGTTTGTTTCATGAGGGTTTCTCTGGCA
CCAGCTCCTAGTCTGACTGAGCAAGCTCATAAAATCTTTTAAACTCCCAGCATACCTTCC
TGCAAACCTTCCCAGATGGGACTTAAGGCTGCTGGGAGTGGAACCTGGGGCACAGGGCCC
TGGGGCATGATATAGGGAGCTGGTGTCTAACAAGTAGGGCTATATAAAGCGCTCCTCCTG
ACATGATGGAGTTGTGTGCCTGCCTCTTTCTGCTTTTTTCCTGGGAGTTGGATTTGCCTG
CCCTGTTTTATTGTAGGTCTCTGACATGATTTTGGTTGAGAGAGAAGAGATGACTGGGGG
TAACGAAGAGAACACTGCCCTTTACGGATGGGCACCGAGGGCGGCATGTTTGTATTAGGA
GGATACTAGATTTTTATTTGGCTTCCTTGGCAAGAAATGTCTGGGGGAAAGGGAACATGG
CAGTTGGGCCTTGTGGGAGCTGAGGGACTGGGGCTGGAGTACATAGGCTGGAGGAGAAGA
TGCCAGAGGGTCACAGGCTGCGTCCTTAATGAGAATGAGAGGCTTCTGTTCTAGTTGTCT
GTAAAGGGGGCAGAGACAGACACTTGTCTGGCCCACAGGCTCCGGCACGTTTTGGGGGAG
GAGCCTGCAGGACCCAACGTACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACGTATA
AGGGCAAGTCCTTAGAGATCCAGAAACCCGCTGGTGAGGGTCCTGCAAAGATGCTCCTAT
GTTTGGAGGCTAGGCGTGGACGGGGCATGTGTTTGAGAGCTCTCTGCGGGGGAATTGCTA
CAGTAGAGATACCACAAGATTGGAGGGACCCTGGAGATCTCCCGGCTTTGGGTCCAGGAG
GGGGACTGGGCTCTGGGCGAACACCAGTTATCCTCCTACAAAGGCGTGTCTGTGGTTCCC
AGTCTCTGGACACGTAAGAACTGGAGGCAAAGCGATGTGGACTTGGGGGAGTTCTGGAGC
CAGCTTGCTCCCCGCAGGCTCAAAACCAACCATCCCACATTGAAGCATTGGATGTAATGT
ATTTCATCCTTCCTGATAGGGGTTTCAGAGTTTATCAAGTGCAGGGGAAGGGGATGACTT
CCGGTAATAAGACACTGAGGGTGTCTAAACTGGGCCTAGTGTGGGAGGCTGTCAGATCTC
TCAGGTGAGGCATTTTTGACCCATCTCTCCACCTTTTCTCCAGTTGCCCCTCGCCATGGC
CTGCAGAGTCTCGGGAAAGTTGCCATTGCCCGGCGTATGCCACCCCCAGCCAACCTTCCA
AGCCTGAAAGCCGAGAACAAAGGCAATGACCCGAATGTCTCACTAGTGCCGAAAGACGGA
ACAGGATGGGCAAGCAAACAGGAGCAGTCCGACCCCAAGAGTAGACGACCTTGGGGACAC
CTGGAGTGATGGTATGTAACTTTGAACTTCAGGGTGAATTGGAGTGGGCTTGGTCCACAT
TAAGAGCCAGAGAGAAAGGGAGGCCCCTTTCTTACCCATCCCAGGTTTAGATGATTCTAG
AATTGTACCTTCAGTTTTCTGTTAGATGGAGTGAAAGCGTGAGGAAGCAGCAGCCTCTAC
AGGGTGACAACGTATTTCGTCCGAATGTTTGTCACTGGGAGCGATGGGTCAGGGTCCAGT
CCCTACCAACGCCAGTTGGAGAAGTGGGGTGGGCTTTTTAGGCTCCGGATAACCTTTGCA
TTATGCTGTCCCCTCAGTTCCGATGCCTCAACCGCTCAGCCGCCGGAATCGCAGCCACTG
CCGGCTTCACAGACGCCTGCCTCCAACCAGCCGAAACGACCCCCAGCAGCCCCCGAGGTA
CCTGGAGAACTGGAAGGCTGGGAGGAAGAATGGGTCGTAGCTCCTCCACCTGTATCACCA
TTTAACCCCTCTCTGCTTCCCCAGAACACTCCTTCGGTTCCAAGCGGGGTAAAGTCCTGG
GCGCAAGCCAGCGTCACCCATGGAGCACATGGAGATGGTGAGTGCTGGGCACCGTGGGAG
GCAGGCGCCCTGCACTCTCTCTTCAGTAAAGGGTCCTCAGTCCTCTGGCTAAATCTTAGC
TCCCATGTTTAGTGTTGTGGGACACGTGAGCAAGTTTAAGTCTCTTGGTTTTATATGAGG
GGGTGGAGGGGTCCCAGAACTAACCTTGTGTCCTGGGGGATGAGCACTTACTCCATAGAG
GTGGAGTCTGAGGCATGCATCCTGGCACTTTAGTGATGTGTCCTCAGTACATGCACTTTT
CTCTCTTGTTCTGCACCCCCATCCTCACAGGTGGAAGGGCATCAAGCCTACTGTCACGAT
TCTCTCGAGAGGAATTTCCGACCCTGCAGGCGGCTGGCGACCAGGACAAGGCTGCCAAGG
AAAGGGAGTCTGGCGAACAGTCGTCTGGGCCCGGACCAAGCCTCCGCCCCCAAAGTAAGT
GGCTGCCTTTTGGACTAGACAGTACCTATTCCCTCTCAGAGTGTTTTTTTATTCCCCTTT
CTCTGCCACGGTTTTCACTGTGTTCACTTGTCCCTGAAGCAACTGATAAATCTCTCTGCT
TTTTCCAAAACGTAGATTCTACAACCTGGAGGGACGGAGGTGGGCGTGGCCCGTGATGAG
CTGGAGGGCCCGGACTCCAAACTTCATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTTCCCCAGTGAGTGTCTAA
AATGAGGAGGTTAACAGGGTCAGTTTGTGAGAGATTAGTGTTCAGCTGGAGTTGATAGAA
AGCGAATAGTTAGCAGAAGGTAGCTGGAGTGAGAAGGCGGAGTCCTGAAAGTGTGCTCTG
CAAGTATAGGGCTGCAGGGTATCTCTGGAAGTCTTGGGAAACAAGATTAGATGTTGGAGG
AAGTCTGGAGTGTGTAGAGAGATAAATTTGGGATGCTAGTGAGGAAGAGCAGAGTGGCCT
TTAGATCTCCAAAGGAGAGGGAACAGAAAAGAAAAAAACCCCAGAGTTGTGAGTTTGTGT
CCACCCGTGAGGCACTCCGCCTCAAGGCCTGGTGCTTGCACACTGCAGCTAGCTAGAGAC
GGTGGATCTGTGTGAGAGGTGGTGGGAAGTGTAATGCCTTACAGCTCATCTTGCCGGATC
TGTCCCTGGCCAGGATCGTGGGGGCCCTCCCTGCAAGCCCCCAGCACCTGAAGATGAGGA
TGAGGCCTGGCGGCAGCGGCGAAAACAATCTTCATCTGAGATCTCCCTGGCGGTGGAGCG
GGCCCGGCGGCGGCGCGAAGAGGAGGAACGCCGCATGCAGGAAGAGCGCCGGGCAGCCTG
TGCGGAGAAACTCAAGCGGCTCGATGAAAAGTTCGGGGCGCCTGACAAGAGGCTCAAAGC
AGAGCCTGCTGCTCCCCCTGCTGCCCCTCCTGTCACAGCTGCACCCCCTGCAGTCCCCAA
AGAACCCACACCGCCAGCTCCTCCGCCAGCACCAGCTCCAACCCCAGAGAAAGAACCTGA
GGAGCCAGCACAGACCCCTCCTGCCCAGTCCACCCCCAGTCCAGGTGTGGCTCCAGCTGC
CACTCTGGTGAGTGGTGGTGGCACTACCAGTAGCACCAGCAGTGGCAGCTTCGAAGCCAG
CCCAGGTATGCAGCAGGGGAGAGGTATTCTCAGGTGTGGTGTCAGGTCTTGGCTTGGAGT
GCAGGGTGGGAAGGACGGAGTAAGCAAGGTAGAAGGCATTTGTTGTAGTTTGTTGGACTA
TCAGTAGGAGGAAAGGGGACTCTGAAAAGAGAGAAGGGTCTTAAACCACTTTCTGTAGAC
TTAGAAAGGAGCTAAGCTGAGGAGTTTTGGTGTCGGTAGTTTGTAAGTGAATACCACTGT
TAGTGGCTCCTGAGGGGTTTAAATGGGTAGAGCTTTAGAAGTAGATTCTCTGTGGAGCAC
CTCTGATTTTGAGAGGGAGCTAGAAGTGAGGGCTGAAGTTGCTGCGGTTGTCGGTTGATG
GAGTATGTCGTTCTGATCTTTTTAGTGGAACTCTAGCTGCCTTCAAAAGAGGGTCCTGAA
CCACCAGAAGAGCTTCTCCTCTCCTAGCACACCTCCAACCCCCAAGGTGGAACCCAAGAG
TGATGGGGTTGGTCCTACTCGGCAGCTCCTCAGCCAGGGTTTGGGCTATCCCAAATATCA
GAAGTCGTTACCACCTCGTTTCCAGCGGCAGCAGCAGGTGAGGTCCAGCTCTCGTTGCCG
TCTCGCCCAGGTTTTCTGGCGGAGTTGTACACTGAGTCTGAGCTGCTCTGCGGTGCTGCA
GGCTTTGGTGACCTCCACCCTGTCTGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGGGGAGACCTTTTTGGGGGCTGGGGTGCTTGTGATGGAAGATTG
GTTTTTCTTACTCTTCGGTTTCTGCAGGCCTAGTTCCCCGCGAGCGCTCAGACAGTGGGG
GCTCAAGCTCAGAGCCATTCGAACGCCATGCACCCACCCTTTTACGGGAACGGGGCACTC
CACCAGTGGATCCAAAATTGGCCTGGGTAGGAGATGTCTTTACCACTACACCTACCGATC
CTCGCCCGCTGACCTCACCACTGCGCCAGACTGCGGATGAGGATGACAAGGGGATGAGGT
GAGTGTTGTGTTAAGAAATTTCGGAAAGGTGTGCTCAGTTGATTGTAAAGAACTCTTGAT
CCCCACTTAGTTCTGATTTTCCTTATTCTGAGATGCGCATTTCCATTCTTTCCTGTCTTC
TTTTTCAGGAGCGAGACTCCTCCAGCACCTCCCCCTCCACCCTATCTGGCCAATTATCCA
GGCTTCCCTGAGAATGGAGCCCCTGGACCCCCGATCTCTCGATTTTCTCTGGAAGAGCCA
GTTCCCCCAGGGCCCCGTCCACTCCCCTGGCCCCCAGGCAGTGAGGAGGCGGCCAAGATA
CAAGCTCCAGCACCCAAGAAGGAATCCCCCAAGGAAGAGATTCCACAGCTGACAGGGCCA
GAAGCAGGTCGAAAGCCTGCCGTGAAGTTTGGAGGTTGTAACCAAAAGAGGTGAGCGACA
CTATCCGTAGACCTCAATGTCCTCGAGTCGCTGGGCAGACATGAAGAAACATAAGAAGTA
CACAGACACAATGGAGGGTAGTGACGTTGGTGCTGTCCCGGGACAATTACAGCACCAAGG
GAAGCGAAATTCAAGCCTTATGTCCGAGTGTTTCGCTCTTGAGCCTTGCTCGGATTTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CAACAAGGAGCCTTTGAAAGAGAAGCTGATTCCCAGGGCCTCTGTCTCCTGTGGCGCGTG
AGGCAGCAGTGCAGGCAGCAACATAGGCATAGGTGTGGAAGATGGGGAAAGACCCCGAAG
GAGGCGTCATGGCAGGGCTCAGCAGCAAGATAAACCGCCTCGTTTTCGGAGGCTGAAGCA
GGAACGGGAGAATGCAGCCAGAGGGGCCGAGGGCAAGCCCTCTTGCCTAGCCCTCCCAGC
CCCCACTCCTGGACCTGAGGAGCCACTCCCAGCTGTTGCCGCACCCGCACTGCCTCGTCG
GGCAGCTGCCAAGTCTCCCGATCTGTCAAACCAGAACTCGGACCAAGCCAATGAAGAATG
GGAGACTGCATCGGAGAGCAGCGACTTTGCTAGTGAGCGCCGAGGGGACAAGGAGGCTCC
CCCACAAGCACTGATGGCCCCCAAAGCTGTGGGAGCTCCTGGAGGCAGTGGAGGTGGAGC
TGGTCCAGGTATTTCAACCATGTCCCGTGGAGATCTGAGCCAGAGAGCCAAGGATTTGAG
CAAGCGGAGCTTTTCCAGTCAGCGGCCAGGCATGGATCGGCAGAACCGACGCCCAGGCCC
AGGGGGCAAGGCTGGCGGTGGCGGCGGTGGCGGGGGTCCTGGGGGAAGGACTGGCCCAGG
ACGAGGGGACAAAAGGAGCTGGCCCTCGCCCAAAAATCGAAGGTAGGTAGAAGTAAACTG
TTAGGTTAATATTCTGTTATTTGAAAAAGAACTATACCTAAATACCTGCAACAGCCAGGA
TTGGGCCAGGGGTCCAGAACTCTTATTCGGGTCTACTGTGTTGGTGGCAGGACCCAACTG
CTGGAGTCCAGGGTGCACATGAGCAGGAAGCTGGGGTTGGCTCAGAGGCAGGACCCCAGT
CAGGGCACACTGATGAGGGTGCGGGTGTTCCAAGTGGTGGTGTCTTGACTTATTAGGCCA
AACCTGCCTGGGAAGGGAGACCGCGGGGGGTGAGGAAGCTTGGGCTGTGAGGGCAGATGA
GCCCATTAGGAAGGCACTGGAAGTTCAGGCATAGGTGGGAGCAGCAAAGCAGTGACAGAA
TACTGCCTGTAGGTGTGTCCCTGTCTTCCATCTTTTGCCCCATAAAGCTATATGTGGAGA
AACAGTAGTCAGAGAATTGGGTTTGTGAGAGAAGTTGGATTTAAAGGGACAGGGGCTCGA
GTTAGTGAGCCCTGGGGCCAATGTTGTTTCTCCTCAGCCGTCCTCCAGAGGAGCGTCCTC
CAGGGCTGCCCCTACCGCCTCCACCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCCCAGACCCAAGCCTGACCTCCCCAAGCCCAATCAGGACCCTTCTC
CTCGGCCCCCACCGATACGACCCCCAGAGGACCAGCAGCAACAACGCCAGTTCTGGTAAG
CTGGAGGGGATTTGGGTGGGAAGGTCTCCATCCCCAGAGAAGGTCAGGTGCTGGAGGGGA
AGAGTGGCCTGGGGCCCTCCTGCTGGGTGTCTGCAGTGCGCAGGGGCAAGAGCACTGGGA
GGTGCTGTAGGAGTGAGGGGGGGTGAGGCAGATGCTGACAGCTTTCCCCTCTTCCCCAGA
CGCCCACTTTGAGGAGCCAGGGCCAATGGTGAGAGGAGTAAGCGGGACTCCCCGGGATTC
TGCTGGGGTTAATCCCTTCCCCTCCAAACGGCGGGAGCGGCCTCCCAGGAAACCAGAGTT
GCTACAAGAGGTAAGGGCTGGGGTGTGAGATCATGCGTCACTGAGCTCCGCTTTGGAAGG
TTCTTGTTCTTGATTGTTTCCTCCATTTTCCCTGTGTATTGCTGTCATGGTTTCCTCACT
TCAGGTAGTCACTGCTTGTCTCCTGTCCATGTTGGCCCTCCTCCTCACCTTGTCCCAGCC
GCCTACGTTTCCCTCCTAATTCATGTTTTGCCTCTGGTCTTTGTCATCTCTAGGAATCTT
TGCCACCTTCTCATAGCTCTGGATTCTTGGGCCCCAAGCCTGAGGTCCCAGGCCCTCAGG
GGGAATCCAGAGATACAGGCACAGAGGCTCTGACTCCTCACATCTGGAACCGTTTGCATA
GTGGTGAGTAAAGCTGAGGGAAGGGAGAGGCTGATGGAGGGGTGAAAGAGTGAGATGGGC
TTCAGAACTGTTTTCTCTCACTTCCTGTATCCTGGTCGGTGCTCCCCTCTCCAGCCACTA
GCCGAAAAAATTACCGGCCTGGATCCATGGAGCCCTGGATGGAGCCCCTGAGTCCTTTTG
AGGATGTGGCTGGCACAGAGGTGAGTGAGCATGGGAGGGACGCGTGAGCTGGGAGTTGGT
TGAGAACTGGCTGTAACTGTCCCTGCCTGTTGGGTCACGTCGGGCTGTTCTCCTACACAG
CGGCCTCTTCAGTTTGTCTGTCTGCGTGTGGGAATCAGTCAGGAATTGGGGTGCTTTCTA
CCCTGGCTTAACCGGCTCCTTCTCCACTCCTCTCAGATGAGTCAGTCTGACAGTGGGGTG
GACCTGAGTGGGGATTCTCAGGTGTCATCAGGTCCCTGCAGCCAGCGAAGCTCCCCTGAT
GGAGGACTCAAGGGGGCAGCAGAGGGACCCCCCAAGCGGCCCGGAGGCCCCTCACCCCTG
AATGCTGTTCCTGGTGAGGGTCCACCTGGCTCTGAACCCTCTGAACCTCCTAGGAGACGG
CCACCTGCCCCCCACGATGGGGACAGAAAGGTAAAAGACCAGGAAAGGTTAAGAGGAACA
TTTCTAAGCACCTGCTTGTCCTCCCTTTGCCCCTTTCCTCTGCCTCTGCTCTGGGGATTC
CTTGATGTCGGATCACCTCTCCTTTCTCCATCCCTACTTTATTATGTTCCCTATCCCAGG
AGCTGCCCCGGGAGCAGCCTCTGCCCCCTGGCCCCATTGGCACAGAACGATCTCAGCGTA
CAGACCGAGGCCCGGAGCCTGGCCCTCTCCGGCCATCCCATCGACCTGGCCCCCCAGTCC
AGTTTGGCACTAGTGACAAGGTATGCTGTGGGCTGGATCTGGGGGTCCTGGGCTGGGTGG
AGAGAAGGGAAGGGCTGGAGGGAGGACTTGAAGCTCATCTGAGTCCTGGGGCAATCTTCA
TGCCTCATGACCACAGGATGCAGACTTGCGCCTAGCGGTGAGAGACAGTTTAAGAGCAGA
GAAGGAGCGAACCACATCCGTCACTGAGGTGAGTGTGAGAGTGAGAGTTCAACAAGGCTC
GAGATTACTGGTGAAGATAGCCGGGAGTGGCCTGGGCTTCCAGGATGCCAGATATCTCCC
TTAGCAAGGCCTCTCCTTTCCAGGCCATTCCAATATCCCGAGACTGGGAGCTTCTCCCCA
GTACTTCTGCCTCGGCTGAGCCACAATCCAAGAACCTGGTTTCTGGGCACTGTGGCCCAG
AGCCCAGCTCCTCAGCCAACGTCTGTACCCTGAGGTCTTCTACGGCAGCCCCGGGCCTCC
CAGCTCTCAGTGGGCCTCACTTCCCATCCTGTGACCCCTGAATGAGAGTCCTGCTTTCTG
CCTGCTAAGCCTTCCGGTGTTGGGAAGTTTCCAGACCGCTTGTTTTTCTTTTTCTTACTC
CAGTTTTCCCCTTGCTTTCACTGCAGTGGGTGGGAAGTGCTAGGTTTCCAGACCGGAGGA
ACTGGGGCTGTGGGGCTATTGCAGCCATGCTCTTTTGTCCCACAGGTCTCTGGCGGAGCC
ATGGACTCTCAGTTACATCCCAACAATGGCGGCTTCCGCCCAGGGACCCCCTCTGTGCAC
CCTTACAGGTGAGATGAGATCTCTTGGGCCTCAGAAGGGAATGGAGATAGTTCAGGGGAA
AGGGAAGCCAGAGTGACACATCGCGGCATTACTCAGACTAGAGGAGTAAATGACTGGTTT
CCTAACGTCTCTGTTCACCTTCATTCCTTCTAGATCACAGCCCCTGTACCTACCCCCGGG
CCCAGCCCCTCCCTCGGCACTTCTCTCTGGGGTAGCTCTCAAGGGCCAGTTTCTGGATTT
CTCAGCACTGCAAGCAACAGAGCTGGGCAAGTTGCCAGCTGGAGGAGTTCTCTACCCACC
ACCCTCCTTCCTCTACTCTCCAGCGTTCTGCCCCAGCCCCCTGCCCGACCCACCCTTGCT
TCAGGTAAGAGGTGGGCAGGTGCTGCTAGGGGTAGCAGTTAGGGGTGAGGGAGAGTACTC
TGGGAGGAGGAGGAGGAGTTGCTATTTCTGCGCATTCCTCAATAGGTGCGCCAGGATCTG
CCATCCCCTTCGGATTTTTACTCTCCTCTGCAGCCCGGCGGCCAGAGTGGCTTCCTTCCT
TCAGGGGCCCCTGCCCAGCAGGTACCTCTTCTCTTCCCGTCCTCCCTTCATCCTGCTTCT
CACTTTGTTGTGATTACCCTTGGTTTTCCAGCGTTTCTCGCCTTCCCCAACACGCACGCC
CAAATGTATTACAGATGCTTCTACCCATGGTAGACTCTCAGCTGCCTGTGGTGAACTTCG
GCTCCCTGCCGCCAGCGCCACCTCCTGCCCCACCTCCCCTTTCTCTGTTACCTGTGGGTC
CTGCTCCTGCAGCCCCTCAGTCCTAGCTTGTGCGGCCCTCACCTGGCTCCTGCTACTGCG
GTGGCTGGCCTTCACCTGCCAGGCCTTTCCCCGCTATCTTGGGGCGAGCAGAGGTAAGGT
ACATGAATCACGGTGCCAGGGAACTCCACAAGTTACGGATAGGGATCTCGAGACAGACGG
GTTAGTATCAGGGCCGTCACGAATTTTTCTCCTTCAGCTGCACCCAGTGGAACTAAAGCC
GTTCCAGGATATCGAAAACTGAGCAGCAACCTTGGACCTGGGTCCTCACGTCCTCCCCCA
GCTGGAAGGTAAGAGGATGGGCATGCAGGGCCTCCCTCCCCGCGGGCTTTCCACCTGGGG
CCAGAGGTCAGGTCCTAGGCTTGCCGTAAACACTCGTCTGCCCTTAGGTCCTTCTCGGGT
CTCAATTCCCGTCTCAAGGCCCCGCCTTCCACCTACAGCGGAGTATTCCGCATCCAGCGC
ATCGACCTCTACCAGCAGGTGAAGAAAAGACCCATGTGTTTTCTAAGTTCTGCCTGACTT
CCTGTCCTTCCATCCCTGGCACCTCCCACTAAGCCTTACTCTCCACACCTACTGTCCCTT
AGGCCTCCCCACCGGATGCTCTGCGCTGGATGCCGAAGCCTTGGGGAGCGGACAGGGCCA
CCTTCTCGAGAAGGGCCTTCCCGAAGGACAGAGGAGCCTGGGTCTCGAGGGGACAAGGAG
CCTGGGCTGCCCCCACCCCACTGAGGGAGTTCCCCTTGCCCCCCACCCCCGGGGCTTGTA
TATAGATTATAAATATATAAAGGGGAAAGGGGTGGGTGTGGAGGGGTTGTGGGGCTGGTG
CCTCGCTTCCCCTCCTCCCCCTTCCCCTGGTCCCCTATCCCTGGGGCCGTTTGTTAAAAA
ATAATAATAAAAGGATTAAAAAAAAATCCCAGGAGCAGTTGTGGGGAGGGATGGGTGGGT
TGGTGTCTTACAGCATGGTGTTGACATGTATGGGAATTCAGTCAGAACTGTTAGTCAAGT
GTCCTTTCAGATTACCTCAAAAATGTGACCATGTTACTGGATCTTCAAGTTCTGTAGGTT
GGCGGTTTGGGCTGGGGCTTACCTGGGCCCATCTTCTTGGGCCAGTTGGGAAGTCAGGTG
GTTGCCCGAATGCAGCTGATAGCTGGGCTGGCCCTAGTATGGCTTCCTTCACATGTCATG
TGGGGTCTTGGTGAAAGGTGGAACCCCTTCAGACTGTCAGCCATTGTCCCCAGATGGCTC
CTGTAGTGGGGTGTTAGCAGGACTTGCAGATAGAACTTGCAGAGCCGGTGTCTTGACCTT
CAGATGGGATGTCACATTGTTGGTCCTGCAGTAAGCTAGTTAGAATGGATGGGAGAGAGC
ATAACTGCAGTTGATGACAGCAAAGTTGGCCGCCATGCCTCTGGTCCCACTGACAAAACT
GAGAAGTCCTGTTCATAGCTGTTCTGAGCCTTGGCAGACTGTTTAAGTGTCATCAGAAAT
GGCTGGATTTCATGGGAATCCCAGTTAGCAGGCTAAGATACTAAGGTCTGGAGCTGCTTA
GAAATTGAAAAGCATTTTCTGTTCTAGCATGTACTTGGGATACATGTCTCCCATCTCTGA
ACTCCTTACATGAACACATGTGTGTGTACAAAAAATGCATGTGGGATTATTCAGGGGTAG
CCACTGTGAAGCTAAGGATCCCCACACGCTGGGATGGACTTGCACCTCTAGTTCCTACCC
AGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1603..1778, 2118..2216, 2304..2376, 2670..2813, 2955..2991, 2993..3026, 3129..3209, 3310..3389, 3490..3632, 3733..3823, 3924..4136, 4244..4247, 4693..5164, 5545..5552, 5556..5598, 5600..5736, 6577..6874, 7047..7257, 7388..7637, 7640..7653, 9551..10439, 10441..10469, 10471..10498, 10501..11141, 11677..11724, 12793..12928, 12931..12944, 12946..12970, 12972..13014, 13199..13329, 13553..13682, 13794..13879, 14076..14309, 14459..14599, 14716..14787, 14903..15013, 15016..15066, 15285..15367, 15513..15723, 15825..15920, 16034..16144, 16146..16159, 16161..16166, 16168..16183, 16185..16202, 16205..16252, 16357..16386, 16389..16447, 16547..16637, 16742..16781, 16783..16883
1001..1112, 1603..1778, 2118..2216, 2304..2376, 2670..2813, 2955..2991, 2993..3026, 3129..3209, 3310..3389, 3490..3632, 3733..3823, 3924..4136, 4244..4247, 4693..5164, 5545..5552, 5556..5598, 5600..5736, 6577..6874, 7047..7257, 7388..7637, 7640..7653, 9551..10439, 10441..10469, 10471..10498, 10501..11141, 11677..11724, 12793..12928, 12931..12944, 12946..12970, 12972..13014, 13199..13329, 13553..13682, 13794..13879, 14076..14309, 14459..14599, 14716..14787, 14903..15013, 15016..15066, 15285..15367, 15513..15723, 15825..15920, 16034..16144, 16146..16159, 16161..16166, 16168..16183, 16185..16202, 16205..16252, 16357..16386, 16389..16447, 16547..16637, 16742..16781, 16783..16880
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved