Oryctolagus_cuniculus Locus Q95L77_RABIT
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Q95L77_RABIT
Oryctolagus_cuniculus
Q95L77_RABIT
GeneScaffold_1523
SNORA21
1120..1254
5091
CGCTTCGCAACTGTATCACGTCCTAATGAAACTGTTTCGAGCTCGCCATCCTCACACCC
CGGGCCTCTGTTTCTTGGGGAGCCCCACATAGCACAATCCACATTTTAATTATTTCTGAA
TTCCTGGTCTTCAGAAATGCCTGGCACATGCTAAGTGCTCAAAAGAGACTGCTGGGTAAA
ACAACAAATCAATGTTTGCATGTCCTCATCTACTTTCGACTCGCAGCGTGGAGAGCCCGG
GTTTCAAACCACTTCGGCAAAAACGGTCTCCGCGAACCTTCCACTTCGCAGCCAGAGCCC
CAGTGGACGTCCTGGATTTATTACGTAGAAATTCAGCGCCCTCGGGAAGGGGCGGGTTTA
ACAAACTGCCCGTCACGGAAGTGGGCGGAGCATCGAAGTTCATATCCCAGCGTCCTTTGT
GCCTACTTCCTTTCTGTGCCTTTCCGGCGTCCAAGATGTCGAAGCGAGGTGAGCTTTGGG
CTTTAGAGAATCGTTCGCCATCGGCCGCGTAGAGCTTACCGGGCTCGCCGGGAGCGGAGG
CTTTAAGCAGCTAGTGCGCTCTGCTCTCCTTCGGGCCAGAGAGAAAGATGAGAGGCACCG
CGAGAGCACAGCGAGATCGCTCGAAAGTGGCGGGGGTGGTGGTCCTGGGGCGTTCAGCAC
GGAATCCTTATTCCGTGCATGTCGTTGGCATTGGTGAAGTTCAAATTGCAAAGGCTTAGG
CAGGAGGACTTAGGCAGTCTCTCGCCGTGTAGGAAGAACTGTTGCCAAGTTGGAGCGAGA
ATTGAGTTATTCCAAGCCCCTTAATCTCCACATAAGTATGGTAATAAGGCATTGGCTGTT
TGGTGGCCGAGGCGGTGGGACCCAGTAAGAGACTAAATGGAGGCCTAGAAAAAGTTGGTG
TGCATGTATAGTCCGGGAAAGCGCGTGCAATGAGCTTATTATTGACAGTGAGACTCTGGA
CCGTGTCCGTTCAGTGACCATTTACCCTGTCTCCCTTCCTACCCGCAGGACGTGGCGGGT
CCTCCGGCGCGAAATTTCGGATTTCCCTGGGTCTTCCGGTAGGCGCCGTGATCAACTGCG
CCGACAACACGGGTGAGTTTGGCTGGCGCCTGCTACATCCCCCCTTTTAAAAGCACTCAG
TGGGCCTTTGCTAATGACCCATCGAGCCGTCCAGAAGAGCAGAGCCAAAAGCACCGCTTT
TGGGTGAAGCGGCAGCATGTTGTGCTGTTTTGCTTCAATCGGTGGTGTGACAAGACGTTC
CACTGTTGGGGACAAACCATGGGGGCGGGGAGCAGAGCTGGAGAGACTTGGAACACTGGT
GGAGCTGCCTACCTTGTTAAAAAATGAAGCTTTGCTTGTATCTTAACATAGGAGCCAAAA
ATCTGTATATCATCTCTGTGAAGGGGATCAAGGGACGGCTGAACAGACTTCCCGCCGCTG
GCGTGGGTGACATGGTGATGGCCACGGTCAAGAAAGGCAAACCGGAGCTCAGGAAGAAGG
GTGAGTGTCGGGAAGTGGACCGTGAGTCCTGCAGACAGACCACTTGCACGCTTGATTGCT
GGTGAGAGACCATCAGAGATGAATAGCCGAAGTAGGAGTTGTGCCCTAGGGAGCTGCTTC
TCACTTGGGCCTGGCGTGTTTACCCTGCCACTTCCCCAGCTCAGTTCATCAGCCCCTTGT
CGACCGCCTCCCATGCTTACACCTATAGAAGCCAAGGTCTGTCCCCTTGGAACTTAACAT
TCGGCTCTCTTCTGCTGGCTGTGGGCCCCAGCTCTCTTCCTTTCCAGTTGGAGTTGTGCT
CTGGCCAGTATCCCTTCAGGTCGATCTTACTCACTGTGCCTCCTGCCTGAAATAGCCCAG
CCCAGCTCACTGCCAATGAGTGACATCTTCCTTAGCCCCTCAACAGATAATGCCAGTGCG
GGTATTTTTTTGCGACATAGAAGGTGTTCTCTATTTAAGGTTCCTTGACCAGAGCATGTG
TTCAGTTCTTGGCTGATACCTTGGCTACACGTGCACATGGTGGTGCTTCGTGAATGTGTG
TGTGTGTGAGAGAGAATGTATGCTTGGTCAGAGACTTAGCTGGACAGGGGAGATCACTCA
GGTGAGTTTCCTTTTCGGGAATACTGGTTTGAAAGGGAATCAAGTAGTTCGCTAGTTTTT
CAAGTGCTGTGAGGCCAGCTGATGAGCTGAGGGTGTGGAGCATCTGGCCTGTTGCCTAGC
ACTTGGTTGAGCACAGAATAACAGATGGTATGCTTCCAGGCAGACTATGGATTGATGAAT
GCAAGGTTATGGGTACAAGGAGCTGCTCATTGTTTGTTTATGGTTACCCCCATCAAAGCT
TTGACCCCAGGTGTACACATTGAAATGGGAGGCCTTGGGACACTTCCAGCTTGTCCTGTC
TGGCTTAAGAACTTGGGGTATCCAGTGAACTTTTACTATTTCCTTTCTCAACTTCTCCCC
TTGCCTGCTTTATGCTGTGTCTGCTGTAGGGTGTCTTGCTCTGCACAGACATCGAGCCAC
CCTTTGGAGTACACGTCATGTGACAGGTCAGCGCTCTGGATTGCAGCCGACTCCATGCGC
CTCCGTGCGTCTCAGTAGGGTTTTAGTCTTTTTGGTCAGAAATCATGCTTTGTTCCCTTG
AATATCACTTGAAGGTGTGGGCACTGCTTGTGACTAAGTATTGATTAGTCAGTGTCGGGG
AAGAGGATGCAAGGGCTTCTTCCTCTTCTCAGAACACTTCCTGGGTCTGCAGGTGACCGG
GGAGCTGTCAGAGAAGAGCAGAGCAAACAGCCATTCCTTAGTGGTGCGGTGGCCGCAGAG
GATACTGTCGGTCTCAGGCAGTGGTGGGACAGACCGGAGAACACTTGGTGGTTTTAATTG
TACTTGTGATTTTCCAGTTCTGTTACTGTTTTCTTTAGTCCTTGTATCAGCTGAGCAGTA
TATCTCCTCACCTTGGATATAGACTTATACACGAAAGCCCAGAAATGTGGAGGAGGGAGC
AGGACTGGAAGTTTGTAGCGTCATCTGCTTCATGCATTGGTGAGCGTTAGTAGTTTGTGA
ATAGAGAGGAATGTGCCATGGTCGACAAGGCTACCTCAGTAAGTGTCCCATGGCTGCTTA
CCTAGATAGCTTGTCTGATACTTAAAGTTACTTATTGCAGAGGCAGGGTGACAGGAGAGC
CGGAGAGAACCTCTCTTTGCTGGTTCACTCCTCAAGTGCCCTCAGCAGCCCATGCTGGGC
CAGGCTGAAGTTAGGAGTCCAGAACTCCATCTGGGTGTCCCACATGGTTGGCCAGGACCC
AAGTACTTGGGCCGACATCTGCCTTCCCTCACAAGTTCATCAGCAGGAAACTGGGAAGCA
GAGTAGCCTGGACTGGAATGGACACTTAATACTGGATATGGGCATCCCAAATGGCAGTGT
AACTCATTGTGTCACAATGCGTGCCCCCCCCCCCCCCCCCGCCGTAAACTTCTTACTCCT
TTTTCCTGCATCCACTTTCAAGTGCACCTCATGCACACTAGCAGTTGAAGGCTTTCTTTG
GGGGCAGTTGCCATGTAAATGAGTTAATATAGAGCTTGACACATTAAATACATCTTTAAT
TCTGACAAGTTCTTTTGAACTAACTTACAGATCAGGTGTGTGCTTTCTTGGGGGTTTGAC
ACACAGTTGAGTGGAATATAACCTGAGGTTGATAGTTCGGCCTCAGAAGTATATGTTCTG
TCCAGAGGGATGAGCTGCTTGTGTGGCGGCTCTGGGGCTTGGCAGGTCAGTGACTGTTGT
CCTTTCCTCCCCCTCAGTCCATCCAGCAGTGGTGATTCGACAACGAAAGTCCTACCGGAG
AAAAGATGGCGTGTTTCTTTATTTTGAAGATAACGCAGGAGTCATAGTAAACAATAAAGG
CGAGATGAAAGGTAAGAACACTGTGTCTGAGGTTGAATGATTTAACTCTGGTCTAGGGGT
ACAAGCAAGGAACTCTGTCATGTCTTAACTGTCCCTCTTTTTAACGCAGGTTCTGCCATC
ACTGGACCAGTTGCAAAGGAGTGTGCAGACTTGTGGCCTAGGATTGCATCCAATGCAGGC
AGCATTGCATGATCCTCCAGTGTATTTGTAAAAAAGATAAATAACCCATTAAAAAGTATT
TGCTCCCAGTCCTTGCATTCCTGTTCATTTCTACACCTCCTGACACACCCTACCCATTGC
TTCTTTGTAAAATGAGACTGTTCAGGCTTTCCATGGGCATATGTAAACAAAGATACCATC
CTAGAGGCCAAAGCTGCTCTGCTTCCAATACAGCTCCCTGCTGATGCACCTTGCCATTGG
CAGGGAATACCTAGATGGAGTTCTGGGCTTCTGGCTCCGACTTGGCCTAACTTTGGCCAT
TGGAAATGAACCAATGGCCATAAGCTTGTTTATTTGACAGGTGGAGAGATGGATATACCT
ATAGATTCACTTCCCAAATTCAGGGTGGGCCAGGCTGAAGCCCAGTCTCATGTGGGCAGC
AGGGACAACCATTGCTGTCTCCTAGGATGTGCGTTTGCAGGAAGGTGCCATCGAGCTGGC
AGTTGAACCAGGATCTCCACTACGGGTGTTGGGTTTTCTAAGCTAAACATTTGCTCTGGT
ATTTTCAATTTCTGCTGTAGGCTTTCAAGTCCCTAAACTGCAAATACTAAATGCTAGTTG
GTGACAGGTTACCTCATGTACACTGAGTGTCCTATGGTGAGGAAGGCTTTTGAGATAGTG
AAAAAGACATGGCCAGAACTAGTGATTTTTTTTTCTGTAGCTGTGTAATACAGGCAATGT
GGATTATTTATTTGAAAGGCAGAGTTTCAGAAAGACCTTCCATCTGCTAGTTCACTCCCC
AAATGGCCAGAACTTCCAGGCCTCCACTGCTTTCCTAGGCCATAGAGAGCTGGGTCAGAA
GTGGAGCGATCAGGACTCCAACCAGCGCCCGTATGGGAGGTCGGCACTGCAGGTGGCAGC
TTTACCTGCCATGCCACAGATCTGGCTCCATATGTATCTTAAAAGTATTAGCAAAAATGA
AATACATCCCAGGGAAGTGTTTGGCACAACACTGAAGACTGCAACTCATGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1091, 1371..1499, 3797..3910, 4009..4091
1001..1091, 1371..1499, 3797..3910, 4009..4088
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved