Oryctolagus_cuniculus Locus ENSOCUG00000005303
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000005303
Oryctolagus_cuniculus
ENSOCUG00000005303
GeneScaffold_6304
SNORD49, SNORD49
1273..1343, 1661..1730
3200
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAAAAATGCTTCCAGAAGGCTTAG
ACTCACAGAGAGAGAGCAGCTGTAGTAACAGTGTACCCCCAGCTCCTGACCCTACGTGAG
CCCCGCGGTGAGCGCCGCGCCGGGTGTCCGAGGGGTCACGTGCGTGTCCGGTACAGCCAC
CGCCCGGGGAGCCTGCGGTCCTAGAAGAAAACACGAGGAGTGCGCGAAACCCGAGAAAGG
TGGGTGCGTTTGGGGGCCCTGCCCGCAGTTGGGGGTGCACCGGGGGCGGTAGGCGAGGAA
GACTTCGGCCGACTGACCTGATGATACCAGTAATAGGAAGTGCCGTCAGAGGCGATAACT
GACGATGCCCGTAGCCGTCTGAGCGCAGTCGCTGAAACCTCGGATTTAGTTGCATGCATG
GGTAACTGCCTTAGCCCCTGACGCCTGTCTTCCCGTCTTTAGGTGGCGCCGAGAACCCAA
GGTAGGCGCAGCCTCCCAGCGTGAGGTAAGCCCTAGTGCGGGGCCTAGTGGTCGGCAGCT
CGGGGGCACTGGGTTGGGCATTTGCACGAGGCCATGGGTTATCCCGTAGTGGGTGCGGAA
CCTAGGGCGGCTGTGGAGCTCTGGGCAGCGGGGATCTTGCATAAGTGGGGTCTGATGGGT
CCCTAAGGCAGTTAGGGCTCGGCTGGGGCAGCCGCGGGGACTGCTGTGATGAGATCACTC
TTAGGAAGTGCCGTCAGAAGCGACAACTGACGAGAATGCTCCTGGCTGATTGCAGTCCCC
AAGTCTGCCGCTGGCCAGGGCCGAGCCCGGGCTGGCCTGTGACCTAACGTGGCGGCGTGT
TCACGTAGGTTCCACGCTACAGCACCAGCAAGCCGCCGAGGGCTGGAGCTGCAGCCCCGC
CCCTCCCCCCGTCACGCGGTAAGTGTATCTGCGGAGCCGTTAGTGGTTCGTGCTACTTGA
TGCTGGTGTTTGATTGGGTGAAATCCAGAGGGCTGGGTCCCGGGTGGGCTGGGGCAGCGT
GGCGCCCAGAGCCAGGGAGGGGAGCTGCCGTCTGGCCTCTTGGCTGCTGAGTGGGACACA
GCTGTCCGGGAAAAGAAAACCTCGGGTTTGGGAAGAGGATGGAACTCGGTGGAGGGGACA
GGTCCCCCAGAGCGGCAGGTCGAGGCTGCTGTCAGCGGGTCTGCTCCAGGCTCCGTGCTG
TCTTGTTTTGAGCGCGTGCCTTCTCTCCTCCCAGGCTTTGCAGCAGGGAACTCGGGGGCT
GGCAGTGGCTTCTGCTCCGCGCGAGAGGTGAGTACGCACAGTGTTGACCCTGCTTACTGG
CAGAATGGGGGAATGAGCAGCTAGTTCAAGAAAAGGATATCAATGATGAAATCACCGAAA
AATAGCTGGAATTACCGGCAGATTGTGTGGTGGTGAGCCCAAGGTCTTCTGAAGATATCT
TCCGTGTTGGGAGTGGCTGTTGGCTGCTGGAGCAGGAAGGGGGACTGAAATGTCGTTCTC
TGCAGGCTGTCCCGGGAGGATGCTGAGCCCAAGGACCGGCTGCCGCCAGCAGTGGAGATG
CTGCACGCCTAGTGACTCGGGGGTGGTGTGAGGCCAGCACACAGGGCCGGTGTTGCTCCT
TGAGCTGCCTAACAGGGGTGCCTTCTGCACTTCAATAAACTTAGTGTGATAAACTGACTG
TGGTTACATTTTTCTCAAAACTCTAGAAGTCACCATTAACCAATGCCATAATAAAGGGGG
GTCATTGTTGTTGGTTCTTAAAAATGTGTATTTGAAGAAAAAGTTAGCTCTGATTACTGC
TATCAGGTATTAACAGTCCAGTTATTAGCACTCAAGCTTGTAAACTTTGGGTCAGCCTGG
GCTGCTCTCCCCCTCTTAGCCACTTGAGACTGAGGGCAAAAATTCCGAAGCATTTAAGGC
ATCTACACAACCGGTTCCAATCCAATCCTGACTTGGCTGCAACACACCTTTCACAGCTCT
CTGCCCGTGAGTCCTCCCCACACTTGCCTACAGTGCTGCGGTTCACCCATTGAGAACCTG
TACTGCTGGTCTGGCCTGATGACAACTGGCTCCCAGTCCCCTGACCTGGCTCCCAGGGCT
TGGCCTGGGATTTGGGAGAGTGGGGGAGGGGCCGCTGGAGGGCAGATGCCCTTTGCTGAG
TTGGGTTCCAGGGAGGCCCCAGGTTATTCGCCTTCTCTGACTGCTGGGAACTGTGCTCAA
GGAATGGCTGGTTTGGGAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1017, 1019..1052, 1057..1065, 1069..1098, 1101..1106, 1109..1123, 1126..1167, 1172..1184, 1186..1202, 1422..1445, 1447..1457, 1808..1829, 1831..1877, 2194..2200
1001..1017, 1019..1052, 1057..1065, 1069..1098, 1101..1106, 1109..1123, 1126..1167, 1172..1184, 1186..1202, 1422..1445, 1447..1457, 1808..1829, 1831..1877, 2194..2200
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved