Oryctolagus_cuniculus Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus RABGGTB
Oryctolagus_cuniculus
RABGGTB
GeneScaffold_3150
SNORD45
1360..1443
8844
TTGGTACTGTGTGGTTGGGTCGTAAGGAGACAGAGTGAGGTAGCGTAGAGCCCTGTAGT
TACGATGTGGTTGTCCACCGAGTGTTGCAGGATGGTTGATTTAAGACTCTGGCCTTTGAA
GTTTTCTGGAAGACTTGGGCTGAAGTGTTACTCAGCATTGCTGCAGACCTCGCGGGCACA
GTCGCCGCTTCTAATTTTGTCCAGGCTTCCGCCTGTCTCGCAGGCCTCACTAGATTAAGC
GACCTGATTTCATAATTACTTTAAAAGCCAGAACTGCTTGTTGGCTTTTTGTCCTTAACG
AATACGTGTTATTTATAAATTTATTTTTTAGGATTCCCGAAATAGTTAAGATTCGTAGTG
TGGTCTCGCTTGGAGACCTCCATCTTTAAATGGAATCAGGGAATTCGCTACATAATCACT
TTGAGGAATCGTCGTGACCTACTTAGAGTAACTCCATTGCGGAGTTAGGAAGAGGTAGAC
GAGAACTAGAGCAGTGTCCTCATTACCTGGGGACTGGTTGGAAAGCCAGACACTGCGATT
GAGGGTGGAGAAGATGGAGTTGGAAAGACTCCTTCCTTGAAAATTTGAGTAATTTTGGTG
GTGTGGAAGGTTCTTCGAAAACCTGAATTAGGTTCAGCAGGAATTGAAATTTGCGACATG
TTTTTGATAACCTATGGTGTTTGTTTTATTTAGCTCTTAAAAGTGAATGGTAAGCAGCAA
CAAATGCAAGTGGTCCTTTTTTTTCAGGTCAATGATGAGCTGGCATGTATTCTGAATTTA
AAGTTGATTATTACTACTTTAGCTCTAGAATTACTCTGAGACCTGAAAAATACCTGACCC
TTGACTGAATGAGAACTATAATGCTTTACATTCTTTTTGGTCACTCACGTGCAATTGAAT
TTTCCTGTGACAGGATGAAATGAAAGTAAAAAAGTAGATTGAATGTACACTTTGAGAACA
AAGTAAACATTGATAAGGTAACTCTTGTTTTGTTTTGCAAGGGTACACCTCAGAAGGATG
TTGTTATCAAACCAGATGCTCCCAACTCCCTATTATTGGAGAAACACGCTGATTATATTG
CATCCTATGGCTCAAAGAAAGATGATTACGTATGTATGATTTTATGTGGGAAAGTTTTTA
AAGAGGTCTGTTAGGCACAAGCAGTAGGGCAGTGTTTTATGTCCTGTTTGTTAAAATTGT
ATACAACTGAAGATGTGCCCTCCAGATTAAGTGCATCGTGGATATGTGAGATTGGGGAGG
TATATCAGAACCAAAATGGTACTTAGCAACGCCAGACAAAGTGGGTTAGGATTTTGAGGC
ATGATACAGGTTTCTGTTGTAGTTTGGGTGAAGCTTTTAAGGTCAATGATGTGTTGGCAT
GTATTACCTGAATTTAATGCTGATGTGTAATAACACTTTAGCTCTAGAATTACGCTGAGA
CCTTGAAAAAGTTTTACCTGAATATTTTTGAAAAAGAAAAGCAGTATCCCTTGGGACAAT
CTTAGGAAAATGAACAGATAGAGCTGGGAGTGGGTATTTTTTTTTCCTTAATGTATCTGA
TCAGCTAGATTACCTGGATTGTGGAGGACATCTGGTGTTGAAGTTTTGACTTAACATACT
CTATACTCTGTAAATGCTGAATTTGGATTGGTAGCAAATTTAAGTTTTAGACTTCTCAAG
TGTAATCCATTGATAACTGAAACAGAAATTTGTTTCTAGAATCTTCATTTTCATCTGTGC
ATGCTATGATTTCCATGCTTAGGTAATTTCAAGTTTCAACTGGTTAATGTCATTACAAAA
TGCATAATAGGTGTGGTGCAAAGTCCATATATTAAAAGAATGAATACTTACCTGAACACT
ATGAGAAAATAAGCAGATGAATTTTCTAATTTACCTTACTTTTGGTTGGTGCTTGGGCAG
AGCTAAACTCTTAGTGATATTAACCACATGAATTTTTTTATCATGCTTCACAAGTGATTG
TTTTTTCTAATTAATGTTAAATTTATTGCTAACTAGTGATACTGTTATGATCACATGAAG
TAATCAGTGATATGCCTATGAATTTGCTTTACGCATTTCACCACTTAAATCATCAATTCA
AACTGACAAAGTTAAAAAATTATGTATTTTAGGAATACTGTATGTCCGAGTACTTGAGGA
TGAGTGGCATCTATTGGGGTCTGACAGTAATGGATCTCATGGGACAACTTCATCGCATGA
ATAGAGAAGAAATTCTGACATTTATTAAGTCATGCCAACATGAGTGTGGTGGAATAAGTG
CAAGTATTGGGACATGACCCTCACCTTTTGTATACTCTTAGTGCTGTCCAGGTAATAACT
TAAAAGTTTCAATTGCTTAATAGTAAATGCTCTTAAATGAAAGCCAGGAGTTGAAACTTT
TATCAGGAGATGAAAACTGATACTGTAAAGTTCCATGTACAAGTGGAGTCTGTCCTACAG
GTCAATGATGGAATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNACTTAATGCCAACCCATATGACTTAAAGACTCAT
TGAAAGTAAAATTTCTATTTATTTTGAATTGTTTATTTGAAGGAGAGAGACCTACCTTTC
ATCTGCTGCTTATTCCTCAGATGGCCAGGGCTGGACCAGGCCAAAGCCAGGAGCCTGGAG
TTTATATGGGTCTCCCACATTGTTGGCAGATTCCCAAGGACTCTCTGCCTTCCCAGGTGC
TCTGATACAGGAGGCACAGCTTAGCTCAATGCACCACAACAACTTAAAATACTATTTTGG
GGGGGGGCATTGTTGTACCATAGTAGCTAAAGCCTCCAGCTGCAATGCCAGCATGCCATA
TAGGTGTTGGTTTGAGTCTTGGCTGCTCCACTTCCTGTCAACCTCCCTGCTAATGCACTT
GATAAAGCAGCAAAATACAGCCCCAAGAACTTGGGCCCCTGTACCACGTGGGAAACCAGA
AAGAAGCTCTTGGCCTCCGGCTGGCCCAACTATTTCTGTATGTAAATAAGTACTTTTACA
TACAGTATATTTGAGTATTTTGGGATGCTGCATTGTAGTTTATACGTGGAAAAATAATTG
CTTTTTGGTTAGTGTCTCAATTTTGTTGACTAACAAGATTGTATATTGGGGGAAAGTTTT
CGGTATACACTCAGACATGCTTTATAACTTCAAAGATAGTTGAGGAGAGGGCATCAGAAC
AGAGGGCATTAACTTAATGTTTCTTTGTTGCAGATTCTTACTCTGTATGATAGTATTAAT
GTTATTGACGTGAATAAAGTTGTGGAATATGTCCAAAGTCTACAGAAAGAAGATGGTTCA
TTTGCTGGAGACATTTGGGGTAATGTCATATTTAGTCCATGCTTCCCAAATACCAATATT
AAAATGTCCTCACTTCGCTTAGAGCCAGTTTGTAGATTTTTTTTTAAGTATTTCATTTTT
TCAGGTCCCACGAAGCAGCTGGTCTAATTGGAGTTAATGGTCTGCTGGAAGTTCCAGCAT
GCACTGTGGTAGTTATAACAGCATACAGGAGCACTGGGAACAGAGGGGGCCAGTCTAAAA
GATAAGGTAGGTGAAATTTTTTTCCCCCAATATTTGGTGGTTTTGTAAAGTTTTTAAAAA
GTACTTGCTGGAAAGGGAAAAATACTTCTAAAAAAACTTTACAAACTTACTGAATATTTG
TGTGGAGGGAGGGAATAGGATTTTTATTTGATAAATGTAGATAATCTGTGTTTTAGGGCT
AAACACAGTGCAGGCCAGAAAGACCAGCTGCTTCATGGGATGTGAAAATCTACTTTTTAT
TAAATAAGGGTAAGTTTTATTTTTTTTTTTTGAAATTAGCTAGTTTTTTTTCAGATGTTT
CCTTCCCTTTCTGGACCCCCATAAACAACATTGATAATTTGCTGTTATTTTTGACAGAGT
AGTTTTTTAGTTATTAGACTTAGAACTTCAGATTTAAGCAGTTCTGACTACCTGATGTTA
AGCTTGAACTCTTGGAAATTCAAGCTAGTAGGTGTACAGATTTTGTTTTTAGGTAACTTG
TACTATATCAGAAGGAAGTCTGATAATGGTTTGATTGATTCCTTTTTGTTTTAGGAGAAA
TTGATACAAGATTCTCTTTCTGTGCGGTGGCAACGTTAGCTCTGTTAGTAAGCTTTGAAA
ATACTTAAGGTTTGTTTATTTGGAAGGCAGAGTGACACACAGAAGTTCACTCCCAATTGT
CCACAAGAGCCAGGGACTGGGCTATGTCAGAGCCATGCATGGTCTTCCATTCGGTGGCAG
GGATCCCAAATACATGAGCCATCACTGCTGGGTGCACTTCACAGAAAGCTGGATTGGAAA
TAATAACTGAGAATCCTCTATTCACACACTTTGACTTGGGATATGAACAGATGGGTGGCC
ATCAAAAAGTGTGGCCCAGCCTGCTGCACCACAGTGCTTGCCCCAAGCTTTGAATATTGA
AATGATGAAGCATCCATGAGGACTTTTGAAATTTAACAGGCATATTTCTTTGTTTATAGG
GGAAGCTTGATGCAATTGATGTGGAAAAAGCCATCGAATTTGTTTTATCTTGCATGAACT
TTGATGGTGGGTTTGGTTGCAGACCGGGTTCTGAATCTCATGCTGGGCAGGTAACTTAAT
TCAGATTAAATTTTAGTATCAATTTTGAAGGATTTACCATTGTGATGACAGGGAAATGTG
TTAAGTGTAATATCATTGGGGTGTAACATTGGATGTTAAGAATTACGGAAAGCTTTTCCA
CAATATTTTGCATTATGTACCATTCTGTTAGTAGATCTCTCTGGCCCAAGCAGTTGAACC
GAAATATATTCAATTTTTAACTATGCAGTTGAAAACATTTCTACCTACCATGAGCCAAAC
GGGCAGCTCATTGCTTGTGCCAGAGTACTTTTTGTGGTTGCTCCCTTATGCATGACTTTG
CATTCCACAATTGTAATACCTGTGGTCAACTTAAGACTAAGTTTTTCATTGGTCTGAGTA
GTATAAAATCTCCCATCATATGTAGCATCCCTTTGTGCAGTATACTTACACTATACTTAA
CCTTATCTGTAGGTCTCATAAGAGACATGCCATGACATGTATTTTAGTAGTATACTTGGA
TTTTTGCAATTATTTAAAATTAGAAATGTTGAATCATCAGATCAGAAGGCAAAAGTGATA
AAAATGTTTTAATAATTTGAATAGTTGGATTTTGTCATTATTTTACTGTCACATTATTAT
ACACATGTACTTTATGTCTGTAATTTTAGATCTATTGTTGCACAGGATTCCTGGCTATTA
CTAGTCAGCTGCATCAAGTAAATTCTGATTTACTTGGTTGGTGGCTTTGTGAACGACAGT
TGCCTTCAGGTGGACTTAATGGAAGACCAGAGAAGGTATTATTTCATAAGCTTGAATCAA
TGCCACTTCGTAGTAATGAGGAAGTCCTTGTCCTTCCTCCTATTGTGACTTTTCAACTTA
TCATTTCTTCCATTATAATATCTCAAAAAGCCTGCCAGTGGCAAAAGTAGAATCCAAAAG
ATTGAAACGCTTCTGCTCTTGGATACACTTAGTGTGCCCCTGAATCATGCGTAAGAAATT
TGGGGAGCCAGGCTTTAGATGATATTAAGGCAAATTGGTGCCTAGTTGGAAAGCATTGGA
AAATGTTGTATGTAGATTATTGTAACATTCTCAGGGATTTCTTTTTTTTTTAATTTTTTG
ATGACTTTTATAAAGATTTATTTGAGAGGCAGAGGGAGCAAGTCTTCCATCTGCAGAGTT
GCAGGGAGGGAGGGAGGGAGGCCTTCTGTCTGGTTCACTCCCCAGCTTGCCACAACAGCT
GGAGCTGAGCCCATCCAAAGCCAGGAGCTTCTTCCTGGTCTCCCACGGGGGTGCAGGGGC
CCAAGGACTTTGGGCCATCTTCCCACTGCTCTCTCAGACCATGGGAGAGTGGATCAGAGT
GGAGAGTCCCAGCACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCTGAGTTAGGAATTTATTGATGCAGTTAGAAAATGTAGATATATACTTGTCACGGAGC
CTGAAACATTTAGAATGAGTACTTATGAATTGGAGTTAGTTTTCTCTTTCCCACTGGTTA
TCTTTTAATTATAAGCAAACATTGCAAACATATTTTAATGTTTTTTGTTACTTCTCACCG
TTTGAATATCAGATTGCTTAGATGAGACTTCACTTTAAATTGTTACTAATGACTTAAGAA
CAGAATTAATACTAGTAGTTATTTGTTGCTTTCCCCTACTCCTAGTTACCAGATGTGTGC
TATTCATGGTGGGTGTTGGCTTCTCTAAAGATTATCGGAAGACTTCATTGGATTGATAGA
GAGAAACTGCGGAGTTTCATCTTAGCATGTCAAGATGAAGAAACGGGGGGATTTGCAGAC
AGGCCAGGAGATATGGCAAGTATATTTCTAATGTTTATATATCTTTTTAGTGTTGCATTA
CTTTCATTGATGTAGGCATTTCCAGGCATGTAACGTCAAAGCAGTGTACTTTACTGAATA
GTGTCAGAAAAAATCTCCTTGCCTATTAAACAAGTTAGTAAATATTATATGATAAAGGTC
ATATTTTGAAGCAGGTTTAAGTTTATTTCTGAAAATGTTAAAGCCTGTACACAAAGTGGA
ATTGGCTGCAGTATAAATAAAATATTTTGAAGCAAGGTTTTGGGGGAGACCATTCATTTT
GTAATCTGTGAATTTTTGTTTTAGGTGGATCCTTTTCATACATTATTTGGAATTGCTGGA
TTGTCCCTTCTGGGAGAAGAACAGATAAAACCTGTTAATCCTGTTTTTTGCATGCCTGAA
GAAGTGCTTCGCAGGGTGAATGTTCAGCCTGAATTAGTGAGCTAGTTGGCTGATGGAAAA
GCTGTTTAGTGTAGCTGCCATTCCAACATTGACTACTGTTAATATTTTGTATATTGTGTT
AAATTAATTTTAATAAATTATGTAATTATACATACTGTAAAATAGATTTTGCATTGTATG
TTCAGCTTTAGGTTTTGTTAATGCTGTTACTCTAAGTACAGTTTTTTGTTTTTGCTTCAG
TGTATCATCTCCATGTCATTGTTTATTCCCTTTTTGTTTTGTAGAACCACAGCTGTAAAT
TGGTTTGTGTCTGCAAGAATTTTAAATGACAGATAAACCCATATATAAATAAAAATATGC
ACAGGGGTGTTGTTGAGATTCCTGCATCTTATATATCTGAATGCCTGGTTGAAAACCAGC
TACTCCACTTCCAATCCAGTCTCCTGCTAATGTGCATGATGAGAGGCATCAAATGATGGC
TCAAATGCTTGAGTTCCTGCCACTGTGAGATGCGATTGAAGTTCTTGGCTCCTGTATCTG
GCCTGCCCCAGCTCTCTGGGCTTCTGTATGCATTTGGGAGATTAAACCAGCAGATGGAAG
TATTCTGTCACTCAAGCCTTTCAAATAAAAATAACCACGTAGAAGATACATATTTTTTTT
TAGTTTAGGGGGCGTTTACAGACTAAGGGCTGAATTTGCTCACTATCTTAATTGGTTGCA
GTTTGGAGTACTTTTTGTTTAGCACTTTGTCAAAATTGCCCAGTTAAAGCTTGTGTTTGG
GAAATGAACTGATAGGTGATACTTTTTAGAACAAATGATGAAAAGTGTTTTGTGAACATC
TTTATTGAGGGTGCAGTAACACCCTGTGTTTATCACTAAGGGAGCCTTCCCACATTGGCA
TTGAAGGTAAAGCTGCCTTTGACAGTGGCATCCGTTATGGGCACCAGTTGGGAGTACTGG
CTGCTCAGCTTCTGATCCAGCTCCCCGTTAATGCACCTGGGAGAGCAATGGGGGAATGAG
TGCTCTGGCCCATGCACAGTGTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 2132..2287, 2289..2330, 3753..3858, 4614..4666, 5039..5149, 5789..5914, 7245..7398, 7665..7666, 7704..7844
1001..1108, 2132..2287, 2289..2330, 3753..3858, 4614..4666, 5039..5149, 5789..5914, 7245..7398, 7665..7666, 7704..7841
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved