Oryctolagus_cuniculus Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus CWF19L1
Oryctolagus_cuniculus
CWF19L1
GeneScaffold_1465
SNORA12
27922..28067
33246
GCTTCTTAGTGTGCCCAGCAGAGCGAAGGCATCAGTCCTTACTAGGCAAGCAACTGAGT
GTTTCCCAAAAAGCGAAACAGAAATTGTAGGGGAAAAACCAGAACTTTGTGATCTTTCCT
TATTACATTTTGAATTACCTAGTTGCCCTAGGTGAGTCGGTCCTGTCCCTTGGTTGTCAA
GACCTCTCTCCCCTTGGTTTTCATTTCTTTACACCCTGTTTTCTCCCATCAATTGACTTG
GACTGCTTAAAAAAAAAAAAAAAAAAAAAAGTCATGAATTAAAGCGAAAAGGCCAAAAGG
GTAGGTAGGCTTTTTTATAGACTAAGAGACTAGAGCTAGAATCAGATGCAAGAGAGAAAC
TTGATTGGATCCTGAGTGAAAACAAACACCAGGTATATAATCAGTTTGAGGAGGCAAATG
CAAGACTTAAAATATGGATGTGTATGAAGAATTACTAAATTAATGTTTATACAAAAGGGT
ATCCTTATTCTTAGGAGATTCAGGCTGAGACATCGCTGATGTCTACACTTTACAAATGAT
TCGGTCAGAATAAAATAGCTTGGGAACCTTGACAGGAGGGCGCCCCGGAAGTAAATCTGG
CCCCATTCTGACACTGAGCAGAGGTGATGGTCATTGTTCTTTGATGGGTTAAAAACAAAA
AAGTGCGGGTGAAAGGATTCTGCCTTGCCCACTAGACCGACGGAGTAGGTTAGTTACCGT
TGTGTTAGGAACTTACTCCAATTCTCCGGAAAACAAACCAACCGAAAACAGGAGAACAGA
AAGCATGATACTGGAACTGCCTTCTCCCCTTTAAACCACTCTTCAATGAAGCAAAGCCAC
ACGGGAGAGGTTTCTGTCCCTCGGCGCTCTCCGTAGAAAACTGGACCTTCATTGGTCGGG
TGCACTGACGTCATAAGATCAAACGGGCACGTTCTTTCCGCGCAGCTCGGGTTCGGGTTC
CTGGCTTTACGTGTTCTTTCCCATCCAGGCTTTCAGAATCGATGGCTCAGAAACCGCTGC
GCCTGTGAGTGTTTGTGTCTGTGTGTCTCTGGGTGTGAACGGGTTGAGGTGACTTCGTCC
TGACTGGAACGAAGGCAGAAGAGACGGGGGTCGCGGGGCTGCTGGGGGGCCCCGGCCACG
CCTTTGCTTGGGCAGGGTCGGCCTCCTTTTCGGGGTTGTTTTCACCTGGGCTCGGGGACT
CTCTTGGCAATACTCTCTGGGAGCCGCAGATGCTCCCGGGGTCAGGCCTCCTCCATCTTG
GGCTGTCCCAGCCTCTGGACACATCATCTCGCTTTCATTTTCCCCTCACCTCGTTTTCCT
GTTTATTAACCAAATACTCGCCATCGGGCCTGTCGATGGGCCTCGGGCAGTGGTGGACAC
GACAGACGAATGAGGCCCCTGTGTTGGTGCTGCATTTTAGGGGAGGCCAGGAGATGTGGT
GAGGAAAAGAGAACTTCATTCGTTCATCCGAGAGGAACGGAGACTCCACAGATAAATCCA
ACATTGTGATAAGGATAACGTGAGCAAGACGAAGCTCACCGTTGCGGGGGGGAGGGGGCG
GGGTGTATGATAAAAAGTGAGGCTTGAACCCTGGTAAATAACTTTGCCTTTAACCAAAAA
ATAGGCCATGGCACACCACTCCTTTGTTTTGGAAAGCGATTCTGGCTGCGGTATGAAAAC
AAGTCAGAACCAAAGTAGAGGACGACGAGGATTAGGTAGAGGAAGGATTCAAGGTTTGCT
GAGGAGGTGAAATCGACAGGGTTTGATTGTGCATGAGAAGGGAATGTCCAGTGCTACAGA
TTTCTTTTTCTTCAGTGGGAACACGGAATGCTGGAATAGGGCCCGGATGAGGAATGGTGA
TTTGTGAGCCGCCGTATGATGTGCAGATGGGACAGTGGGTCTCTTTCGGAAACAGTTACT
GTGTGTGACAGCCATGAGAGAAGTGCAGGATCCTGTGGGAGCACCAGGAGCTGGTAGCTG
GTGGGGGCTAGAAAGCTTCCTAGAAGGTGCCGTACTCAGAAGAGAACTGTGTGACAAAGC
CTGTTTTGCAACGCAGCCTGGGTTTCTGTGGTTTTGAGAAGGGAGTAACTTTCTGAACCG
ATCAGGAAGCTTTCAGAGATGTGGGCTGTGCCAGGTGGGGAGAACTTAGACTTGACATGT
GTAGTATTGGAGGATCAGGAGAGGTGACTGTCTCAGGAAATAGTGCAGGCAAAGAGTAAG
CGAAGTGACAGAGGGAAAGGTTTCAGTTAGGGAGACTTGGAGAAAGTGCTAGAAAGACAG
GTCAGGACCTGTGGAGATCAGTCGGGGAACAGCTAATGTTTTTGAGGAGATAACTTAGAA
CTGTCTTTATATAGGGTGGCATAGAGGGGTTAAAGGAAACACAGGCGCAGTCTCTACTTT
GTATCATATTTGTCTCTGATATAGAACTCTCCCTTGCCTTACCCTTCATTTTTCCTTCTC
ATTTCCCACCTTCCTTCCCCAAATGCAGTTTGTGTTCACGTTCTGAATTTCTCATCTGTT
TCTCTCCTCCCCATCTCCCTTAGCATTGTCCTTCTTGTTCCTCTGGGATCATGTTTCATT
CTGTAGCATTTGAAGATAAGTACCAGTTTATTGAATGAATGACTAAAGCCATGCACTGAG
AAAGTGGCAGTGGAAATAACAAGGACAGAATCAGTGTGACAGATGTTTGGATGGGATTTG
GTGACTGAACCAAGGAGTTTTGACTGTTGATGAGCAGTTTGTTACTAGACCTATCCACAA
AACATAGGAACGAGGAGACGATGGCTCAGTTGTGGAGGAAATGGTAAGCTAGACTTTAGG
TGTGGTGGGTTAGAGCTGCTCCCCCAGATGGAGCTGTCAGTGGTCAGTAATTTACAGGCA
CGACACCTTACAAGGTAACAGCAGAGACTGGCCCACAGTTCTGCTTCATCCAGAAGACTA
CTTTATACCAAACCTGGCAGGCCCATTTGTGTTTCTTGAATCGCTGTAATGTCTTTCTCT
GATTTACAGCTTGGCTTGTGGAGATGTTGAAGGCAAGTTTGATGTTTTATTCAATAGAGT
TCGAGCAATTCAGAAGAAAAGTGGAGACTTTGATGTAAGACTTTTTTTTTTTATTGAATG
TAATGTTGCTATTGTAGTCTAAACATACTAGAATAAAATTTGGGCCCCTACATTAATATT
AATTGAACACATACACTACATTTTTGTTCGACTGAGTTCCTTTTGTGGGCAGGGAAATTT
ATTTAGTAGCTGAGGAAAGTTACAAAAGGGATACCTTGTAACCTATGAATGTTTCTTTTT
TTTTTTTACTTTTTGAATTTGAATCCTGTTATTAAAATCAAATTCTTAAAATATCCCTAG
GTGATTCTGGTCCCTGGGTTTGGGAAGTGTAGGTCTACATCATGAGTGTATGGTACGGAT
TAAATCAGATAATATGTGTGCAAGTTCTTCACACACAGAGGAGCCCTCGATAAAGCTATG
TATGGCTGTCGGCTAGACTGTAAGCTCTTCGAGAACCGAATAGTGTCCTTGATATGAGGA
TAACTTGTTCATTAAGTTAAACACTGAGTAAAGTCACCAGGCAGGAAATGTGTTTCTTGC
GCCCTGTAGCTCTCAGTGTATCTGATCTTTTTAGTTTTATGTTTCACAGAGGGATTCTTT
AAAGGCCTGTGTCTCCATCACTGTGTGTTCCAAGGAGGGAAAAGGATGGTAGAGAGCAGA
ATGGAAGAGTGGGACTGAGAATATTTGAGAAGCACTTGAATTCTGATTTCTTTTGAAAGT
TCAGTTCCTTGACTTCCTCTTCTCTGTCCCCAACTTGAATTTGACAGCCATTGAGGCAAA
ATGTAATTCATAGAATCAGTAACTATTACAATTGCTGCTAAAGAATTGTGTATTGAAATT
CTGCAAATTGATTAAGAAGAAAAACTTGATTAGAGACCATTATGTACAATTATTTGTTAA
ATGTTACTGTCAATTTTGTACTGCTTAATATTTTAAAATCTCATATAACTGTTTAAAAAA
CTCATTTTAGCTGCTGTTGTGTGTAGGAAATTTCTTTGGCTCTACCCCAGATGCTGAATG
GGAGGAATATAAGACTGGCATCAAGAAAGGTAGAGAAATTCCTTTTATTTAATTTATGAT
TTCTAACCAAATTTTAATGGTTACAGTTCTTGCTGTTTTTTGTTGTTGTTGTTGTTGTTT
GTTTGTTTTTTACTTTTTAGTTATTTTCAGATTTCCCTCTTGAGCTCTACATCGAGCTGG
AAAGAATGCCTGAGCAATAAACTACATGTTCACATTTTTTACTTGCTTCAATTTAGTTTC
AAAAAAACCCTTATAGATGAGCAGGAAGTGAATAAATGCAACCATATATGTCTTTTCCTT
TATCTAGTCTTAGTTTTTTTTTTTTTTTTAAGCTCTTAAGAGTCTATGTTTTGCTCATTG
TACATTGACCATCTCTGCTAAGATGTCATTTCATGTGCCTACTGACATTATTTAATAGTA
AATTGATAAGGGTGGGTGTGGGATATTCTTAGTGGTAAGCATGTTCTACTTTTAGGATTG
CTATGGAGGAAATGCACAGCCTCTGTACTTTTGCTATGAGTATTTTTCCACAGGGAAGCA
TTTCTCAAATTCCGAAATGGATCTGGTAACTATGATGTCACATCTGTTTCCCTCACTAGC
CCCTATTCAGACTTATGTGCTTGGTGCCAATAACCAGGAAACAGTAAAGTATTTTGAAGA
TGCTGATGGGTGTGAATTAGCTGAAAATGTTACTTATCTGGGTAAGTTGAAATTCCTTAT
TTATAATGAACGTAATAACATGTTTCTAGGAATTAGTCTCCCCTAGAAGTGTTTGCCTGG
ATTCTTCTGCCGTAACTGCTTGAGCAAATAAGAGTTTGGGGGTTCTTTCCCAAAGTCTCT
GGCTATGCCCTTAGGACAATGGTGTTTTTCCTTTGGCTATACCATTTCTTCCCATTCTCC
TGTGTCTCTGCAACCCGCTATGTACTCTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCCCTGCCTGTGCCCTAAATGCCGAGCCCCTATTTAAT
TTATTTACAAGACACAGGTTTCAGCAGAGGAGCCGAGGCCGACGTAGAATGAAAGTCTTC
CATCTGTCAAGGATGGCGCCAAGACCTGAAGCTAGGAGCCAGAAGCTTCATCCAGGGTCT
CCCCATGTGGATACAGGGGCCTCAAGTACTTGGGCCCATCTTCCACTGGCTTTCCTAGGT
GCATTAGCAGGGAGCTGGATCAGAAGTGTTATAGCCAGGACTCAAACTGGTGCCAACTTG
AGATGTGGGCACGGCGTAACCTGCTACACTACAGTGCTGGCCCCATAAATGTAGTTTTTA
GATTTACATTTAGACCACTTCTAAATTTAGTGCCAGGATCAGAAAGAAGGGCCAAGGGGT
CAGCACTGTGGCATAATGGGTAAAGCCATCGCCTGCAGCCCTGGCATCCCATATGGGTGC
CAGTTCAAGTCTTGGCTGTTCCACTTCCAATCCAGCTCCCTGCTAATGTGGCTGGGAAAT
CAATGGAGGATGGCCCAAGTACTTGGCCCCTGAACCCATGTGGAAGACCCAGAAGAAGCT
CCTGGCTCCTGGCTTCTGGCTTCTGGCTTCAGATCAGCACAGCTCCGGCTGTTGGAGCCA
TCTGGGGAGTGAATCAGCAGATGAAAGATCTCTCTCTCTCTCTCTCCCCCTCTCTCTGTA
AGTCTGCCTTTCAAATAAATAAATGAATCTTTAAAAAAATAGAGGGACCGAAGTTGGCTT
ATATTTGTGAGACACATGTATATATAAAATATATGTATATTATATACAATATACATATAA
TATATATAAATATATAATATATAAAAATATAATATACATATATTTTAAAGATTTTATTTA
TTTATTTGAAAGAGTTACACAGAGAGAGGAGAGGAGAGGCAGAGAGAGAGAGAGGTCTCC
TGTCTGATGGTTCACTCCCCAATTGGCCACAACGGCTGGTGCTACGCCAGTCTGAAGCCA
GGAGCCTCTTTTGGGTCTCCCATGTGGTTGCAGGGGCTCAAGGACTTGGGCCATCTTGTA
CTGCTTTCCCAGGCCATAGTAGAGAGCTGGATCGGAAGTGTAGCAGCCCGGTCTCAAACC
GGCACCCATATGGGATACCAGCGCTTCAGGCAGGGCGTTAACCCACTGTGCCACAGCGCC
GGCCCCACATATATATTTTTTAAGCTCCATTTGGAGGAGGAACTAATGAACTTGATAGTG
AAAATGTGGTAGTGAGCTTAACACACTGGTGAAGCATCCAACATAGAGTTGGAAGTGATA
ATTCCTTCTAAATGCTACAAACAGGGTCAGTGTTGAAGAGTAGAGGCTTTAGAGAGTTAG
TCCCATAAAGATGGAAGATAGAGCTGAGAAGAGAGAGTGGTGGGAGAGTGAAATTCGATT
GTTGTGGGTTAAGGAGCTAACCAAGAGGTAAAGCCCTTAGAGAACATAGACCACTCTTCA
GAAACTTGAAACTGAAGAGAAGGAAGTTTCTAGTTAGTTTGTTTTTGTCCTGGATGGGAA
GGATTGAGCATATTCTATTCTATTTTTTTATTCTTTTTCTTAACAGAAAAAGTCAGTTAA
GCAGAGACTGAATAGGGAGGTGAAAGTTGATGGAAAAAGGTATCAGAGTAGAGAAGAAAT
GGAGCCAAAGATACAAGCTGGGAAAAACTTTCAGTCTCTGCTTTTCCCCAAACAGTTGTT
CTTTCCAAGTGTTTTCTTCTTGGAAGCTGCTGCCTGCCTTAAAAGTACTTTTCTAAACTC
TAGCATCCTTAGAACTACAGTTATTTTGTCTTTTTTTTTTTTTTTTAAGATTTGTTTATT
TATTTGAAAGGCAGAGTTACACAGAGAGAGAAGGAGAGGCAGAGAGAGAGAGAAGTCTTC
CATCCTCTGGTTCACTCCCCAGTTGGCTGCAATGGCCAGAGCTGTGCGCATCCAAAGCCA
GGAGTTTTTCCGGGTCTCCCACGGGGGTGCAGGGTCCCAAGCACTTGGGCCATCTTCTAC
TGCTTTCCCAGGCCATAGCAGAGAGCTGGATTGGAAGTGGAGCAGCTGGGACTCAAACTG
TCACCCATATAGGATTCCAGCACTGCAGGCGGTGGCTTTACCTGCTATGCCACAGCGCGG
GCCCCTATTTTGTCTTTTCATTGCCTCTTCTTGGGTCCTTAGCCCATGTAGAGTCTTCTC
TAAAGGTAGAAAGCCTTTTTCTTAGTTACCATTTCCCAACGTTTTCAGTCATATTTGGAA
GGCACCTGATGTAAACAGACTGGCCTGTGGGCTCTAGCAGCCTCCACATCATGGCTGCTT
ACAGAACAACAATGCATCATAGCTGTCTGGTATCTGTCCTAGTGGCCAGCCAGAGCAGGG
CTTGGGAAATCCACTGCTTCAGGGCAAGGGGAGAGCCGTGGTGGGGAAGCATCGCCATAT
CAATGGCATTTCCTTCTACAGTTTTGACTAAAACTTGTCCACTTTTCTTTGGACCCAGGT
CGTAAAGGTATCTTCACTGGAAGCTCGGGGCTGCAGATTGTGTACCTCAGTGGGACGGAG
TCATAAATGAGCCAGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTTCACTCCC
CAAATGACTGCAAAGACCAGAGCTGAGCTGATCCTTAAGCCAGGAGCCAGGAGCTTCTTC
CAGGCCTCCCACATGGGTGCAGGGGCCCAAGGACTTGGACCATCTTCTACTGCTTTCCCA
GGCCAAAGCAGAGAGCTGGATGCGCCACAGTGCTGGTCCCTTGACACTTCTCCAAAAGGA
ACATTTTAATATTGGGATGCATTGGAACTCCTCGTTGAGTCTGATATGCATCTTTTTATA
AGTGATTTCATAGAGGATGTTTATTTGGAGGGACAGCTGTAATGGGTAGTGAAATGCTAC
ATTGGTAGAAACAAGCCAAGGCAGATCTTGAGAAGATTGTGTGTGACAGAGAGACCATCA
GCTGGGCTTCAGTGGATGGAAATACAAGAATGCACCTGAGAACAAATATCCATGAATACA
TTTCAGAATCAGCCCGTGATCCAGAAGAGGGTCTCGTAGGCCACTCCCTGCCAACTTCAG
CACTATCTGTGGCGGGAAGGACCAGCAAGAACCAAAGCATTGTCAGGGAGGATTTGAAAG
AAGAAGAGACAGTTCTTTCTTCCCCTTCCAAAAACCCCTGGTTGATCTTCACCAAGAATA
CAAGAGATGGTGCTGGTTGCAGCACAAAGATATGGCAAAGCTAGAGAAGATGCAGAGAGG
GCTACTAACGTGATGATGGAGGGGAGGAGGACTCATGTGATGCTCCCACATGAGCAAAGG
GTGGAAACGAGGCCTCTTTAGCTTGGAGAAAGCTAAAAAACGATTTTGATCAGTTTGTTA
ACAGCCACGTGAGATATTTATGGGAGATAAAACAATATAGTTCACCAGTCCCTAAGATAC
TATAATTAACACGAAGGTCAGTTCCCTGCCCTTGAGTTCCTTACCTGAAGGAAGTAAGCA
TAAGACAAATTGAAGTTCCTGGTTTACTTAGAGAAAACTCAACTTTGGTAATTTCTTTAT
TTCTGCCTAATACCTTGTTTTAAACTAGACTTCATAATGTTATGGATGAGAGATCATGTA
ATTGGTTAACAGAAGCTAGGGAATAAGCTTAACTGGTGACTAACTTTACGTCAGTTAAAC
TTTGTAACAAGAGTGTAGTTGTGCCTAACTGCTGCTAACAAGCATCTGGTTGTGTAACAG
CTGCCGCTATCTTGACTGAAACGAAAATTTATGCGATGAGATCCTTGCTTGTTCTGTACT
ATGGATCCTCAGGGCCGTAAGGCTGGTTGTTTTCACTTTCTGTGTTGAGATGGACTGTCT
GCATTGTCATTACTATTGGTACACTACAAAGCACATTTTAGGAACACAGTTTATGGGCTC
CCAAGAAAGGGCTTACTTTCCAAAAATGGTTATAATAATCCGTGTTTTGGGAATTAGTAT
AGAGTGGTTAACTTACGTTTTCACTGCTGGCTTCCCACAGTTGTTCCTATTTCTGCATTC
AAAGTATTAGTAGTACAGTTCCCTTACTTGTTTGATTTTTCTCTGAATGCCATACCAGTC
ACTGTGCCAGTCCTTCTGCCCACATTTGTATTCAAATATAAATTCTAAAGGCATTTCATA
GTGTTTTGTTATTTCCTTGAATTTCTTCATAACTCTTGTGTCTGTAGAGATAACCAAGTT
TCTGTTTACTAGGGAGAAGTGGATACCAAAAAGTGTGGCTCCTCTTTGGTCTCCAGCCTT
GCCACAGGCTTGAAACCAAGATATCATTTTGCTGCTTTGGAAAAGACCTATTATGAGAGG
CTTCCATATCGGTGTGTAGCATTTCTTTTGTTCTTTTCTTTTTGAAGAATTTGCCTTTGA
TCAACAGTGTAAACTATTGTTACTCATTTTCAACCACAGAACATCTGGATTCTTGGTTAT
CAGGCACTGAAAGGAGCAACTGTCAAATCATTCACCTTCTCTGAGTTTGTTCCCTAAATT
GAAATACAATGGATAGATTAGAAGGCTCCTTAGCGATCAGTGCTGTGGGTAGCAGGTAAA
GCCACCGCCTGTAGTGCTGGCATCCCATATGGGTGCTAGCTGCAATGCTGGCTGCTCCAC
TTCCAATCCAATCTCTGCTAATGTGCCTGGGAAATCAGCAGAAGATGGACTAAGAGCTTG
GGCCCCTGTACTGACATGAGAGATCCAGATGAAGCTTCTGGCCTCTGGCTTCGATCTGGC
CCAGCCCTGGCCATTGTGGCCATTTGGAGAATGAACCAGCAGATGGATGATTTCTCTCAG
CCTCTGCATCTTCCTCTCTGTAACTCTGCCTTTCAAATAAATAAATAAATAAATCAGTCT
TAAAAAAAAAAAAAAAAAAAGTCCCCTTAAAGGTTTGAGGGCCTGAGGTAACAATACTTT
GTAACACATTATATCCCATTTGATCAGGTCAAGCCAAGGTTCTTTGTGTACTCTTAAAAA
TTCACTTCTCAGTTTAATCAGTATTTTACTTTAGAACTTATATCAGTTATTTCTTTTTTT
TTAGTTTGAGTTTGGAAGTGATTTTTTTTAAAGGAAAAAATTGCACAGAAAATAAAACTG
CTATTTTATAAGTGGTGGAGTTAAATAAAGTTGACTTTTAATTATCTTCACTGATAAAGG
GCATGGATAATCCCTATCTAATAGAAAGTTTCCTTTCTGTTTTTATACAAAGCAATATAT
GTGCTCCTTGAAAGTTTGAAAAATAAAAAATAAAAGTGAGCCAAACTATAAGTAACCTGT
CTCCATCTAGTTATTTCACGACTTAGTATATAGCTATAGGTAATAAAGTTTTTTGTTGTT
GTTGTTAAATCTGTGTATATGCATTCTAGGAAAAATACTTTGTTTCCTAAAAGTGTACTC
TGAAAACACAGGTAATAGAAATGAGCCGTTCAAAAACCTGTACAGCCTTTTAATGATCTG
AATACCCAGTTCTTCATAGAACAAGTATAAACTGCCATTTGGCACATGAAATGATGCTCT
CATCATTAGCCATTATGGTAATATATGTAAACTAAAACCACAATGACATACCACTTTTGG
CTATAATCAAAAAAGCAAATAATAACAGGTGTTAGTAACAATGTGGGAGATTTGGAACCC
TCACACATTGCTGGTGGGAATGTAAAGTTATACAGCCATTTTAGAAAACTAATAGTTTCT
CAAAAATTTAAACATGGTTACTGTATGGCCCAGCAGTTCCACTCCTGTTCTAAGAGAAAT
AAAGACATATGTTCGTATAAAAACTTATACACAAGTAGTGTTTCAGAAATGGTCATGCAT
GCATTTCTGGAAGCTGTAGGGGAGAATCTTCTAGCTTTTTTCAACTTCTGGAGGCCTACT
GAATTCCTCGTCTCATGACCTCTTTGTTCTTTTTTTTTTTTTTTTTTTTTAATGTCATAA
TTACAGAGAGAGGGAGAAACAGGCTAGCCAAAGCCAGAGGCCTGCTTCTTCTGGGTCTCG
CACATGGGTACAGGAGCCCCAGCACTCAGGCCATCTTCCTCTGCTTTCCCAGGCACTTGG
GCAGGGAGCTGGATTGGAACTGGAGCAGCTGAGATGCGAACTGGCGCCTAAATCAAATGC
GCCACAGGCAGCAGCTTTACCCACCATGCCACCGCACCGGCCCCTTCTTGTTCCCACTTC
TGGCTGGTGGAATCCTTCCTACCACTTTGACCATTCACAGTCTGTTTTTCCTCTTGATTC
TTTTCTGCCTCCCCCTTCCATTTTTCTGGGCCCTTGTGATTGCATTGGGTCTACTCGGAT
AGTCTAAGATCATCTCCCTTTCTAGGTAAGCCAACTAGTAACTGATTAGCTGACTAATTC
CATCTGCTCCTTTAATTTCTTTTTTGTGTACAAACTTATTTATTCATGTCCAATGGGAAT
TAAAACATGGTAACTTTGGTGGGGAGGACCATTATTTTGCTTCCCACTCCTGGTGGGAAT
GTTGCCAGGTTTTGAGGCCATTGTGCTAGTCATTTGCATTTAAGAAAAACATTTTTGCAG
GATATTCAGGTATTTTTACTTAATGTCTTAATATATTGTTAAAATTTCTATTTAATTGTG
AGAAAACTTATTTCATTTTTTAAAAGATTTATTTTATTTATTTGAAAAAGTTACGGGCCG
GCGCCACGGCTCACTAGGCTAATCCTCCGCCTAGCGGCGCCGGCACACCGGGTTCTAGTC
CCGGTCGGGGCGCCAGATTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTGTG
GCACGGGAGTGCAGTGGAGGATGGCCCAGGTGCTTGGGCCCTGCACCCCATGGGGGACCA
GGAAAAGCACCTGGCTCCTGGCTCCTGGCTCCTGCCATCGGATCAGCGCGGTGCGCCGGC
TGCAGCGCGCCGGCCGCGGCGGCCATTGGAGGGTGAACCAACGGCAAAGGAAGACCTTTC
TCTCTGTCTCTCTCACTGTCCACTCTGCCTGTCAAAAAAAAAAAAAAAAAAGTTACAGAG
AGAGGTAGAGAGAGAGAGAGATCAATCTTCTATCCACTGGTTCACTCCTTAAATGGCCAC
AACTGCTGGGGCTGGGCCAATCCAAAGCCAGGAGCCTGGAGCTTCCTTCAGGTCTCATGT
GGATACAGAGGCCCAAGGACTTGGATCACCTTCTACTGCTTTCCTAGGCCACAGCAGAGA
GCTGGTTCAGAAGTGGAGCAGCCAGAACTAGAAACGGCGCCCATATGGGATGTTGACCTT
GTAGGTGGTGGCTTTACCCGCTATGCCACATTACCGGCCCCAAAAATAAAGGATTCTAAG
GATTGGCGTCTGTGTTAATAATCAACTCATAAAATGATAAATACCTATAAAGTACTATAG
CTTTTTTCTTTTAGTTACAAATAGTAGTTACTCACTTTAAATACTTTTAAAATTTAGAAT
AGTTCCAGAAAGTATTTTGGTGTATACAGTTTCCATATTTTCTCTATGACTTATAGACAT
GCCTGCATTTTTATATTTTTCCCAGAAAAATGATTATGCTGGCCGGCGCCATGGCTCTTT
TGGCTAATTCTCCATGTGTGGCACCGGCACCCCAGGTGCTAGACCCACTTGGGGCGCCGG
ATTCTGCCCTGGGTGCTCCTCTTCCAGTCTAGCTCTCTGCTGTGGCCCGGGAGTGCAGTG
GAGGATGGCCCAAGTGCTTGGGCCCTGCACCTGCATGGGGGACCAGGAGGAAATACCCAC
TCCTGGCTTTGGATTGGCACAACGTGCCGGCCGTAGCGGCCATTTGGGGAGTGAACCAAC
GGAAAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTCATTGTCTAAACTCTGCCTGTCAA
AAAAAAAAAAAAAAAAAAAAGAAAGAAAGAAAAAAAAATGATTATGCTGTATATTGCTGT
TTAGTGAATGTTTTTACATTTAGGACACATCTCTTTAGTTTTCATTGTTTCATCTTTTAC
ATTGTTTCATCATGGCACAGTGGGTTAAGCTGCCGCTTGCAATTCTGACATCCCATATAA
ATATGTGCGGGTTTGAGTCCTAGCTGCTCCACTTCTGATCCAGCTCCCTGCTGATGTGCC
TGGGAAAGCAGCAGAAGATGGCTCAACTGCTTGAGCTCCTGCCATTCCATTCTCCTGGCT
TTGGCCTGGCCCAGTAGTCATTGTGGTCATTTGGGGAGTGAACTAATTGGTGGAAGGTCT
TTCTCTGTCTCTCTTTCTCTGGCTCCCTCTCCCTGACTCTGCCATTCAAATAAAATAATA
AATAAATGTTAAAAAAAATAGTAGAATGAACCTTCATACCCTTATTACCTAGTTTCAGTA
ATTAGCAACATTTTACTAACTTTATAGCTCTTTTGAAACAAGAGTGGTGAGTGCTTTTCA
GAGATATGGATCTCATCTCTTTTTTTTTTTTTTCAATTTATTTATTTATTTGAAAGACAG
AGTTATACAGAGAGAGGAGAGGCAACGAGAGAGAGACAGGTCTTCCATCTGCTGGTTCAG
TCCCCAATTAGGGGCAATGGCTGGAGCTGTGCTGATCCGAAGCCGGAAGCTTCCTCTGGG
TCTCCCACATAGGTACAGGGGCCCAAGGATTTGGCCCATCTTCTACTGCTTTCCAGGCTA
TAGCAGAAAGCTGGATTGGAAGTGGAGCAGCCGGGACTCGAACCGGTGCCCTTATGGGAT
ACCAGCACTGCAGGCAGTGACTTTACCTGCTACACCACAGTGCCAGCCCCAATCTCATCT
CTTCTTAACAGCCCTGTGTGATAAGGAAATTGGTCCCTATTAGGTGGATGGATGTCTTAC
ATGAGATTGTGCATTTGTAGTGATGGACTTTGCTCTTCTCATGGCCCCATGGAGTCTATA
TTTTCTTAATTGCAAATTAAAAGTGTTAGTAATCTGTTTTCTGTCAAATATGTTTTAGAA
ATCATGTTGTTCTACAAGAAAATGCACAGCATGCTACCCGGTTCATAGCTCTGGCAAATG
TTGGAAATCCAGAAAAGAAGAAGGTAAAAATTGGAGTATTTGGTGATAGTTTAATATTCG
TTGTTTGCTTGATAAATGTTTCTCTGGCACAGTTAAGCAGTCACATCTTCTCACTCCCCA
ACTGCAAGGTTCTAGAAACTTTCTGGATTCCTTTGTAAAGATACAATAATGAAGAGTCAG
ATTTCCTAGGGTCCTTTGGGAAAATATTTTTATCAAATGAATGGTGTTCCTTTCCTGCCA
CATTCTTGTGGTTTTTGTACGTGTATTTGTGAATTGTCCTTAGATGGTACTCTTGCTTGC
TCCTTTTACAGTTTCAATTAGTAGAAATAATAAAGTCCTCCTAAGGATCTACCTAAGCCC
TCCTTGACTTTGGGAAATATTAGTGATATCCAGAATCTTTGTAGTGGAAAATAGTACAGG
TCATAAAAGGGAAAATACTAGAAAAATAGATAGATTGTTTCTCTTTCTTTCCTGAGAGTA
TTTCTGATTTCCAGGGGCCAGAAATACCCTATTGTGGATTCAGATGGGTAAAATCGGAAT
ATTTAGTCAAATAGGAAAATAGGCAGAAATAATCTTCCTAAATAATTTAAAGTTTATTCT
ACTGTAACATATCATAGATGATGTGTATGAGTTAAGAAAATATATTTTTTCATAATATAT
TAATCTTTTATGCTCAATTCTTTCTTAGAAAGTTTTGTAGATTTATAAATTTTTTTTTTT
TTTTTTGACAGAGTGGACAGTGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTGCCGTT
GGTTCACCCTCCAATGGCCGCTGCGGCCGGCGCGCTGCGGCTGGCGCACTGCGCTGATCC
GATGGCAGGAGCCAGGATCCAGGTGCTTTTCCTGGTCTCTCATGGGGTGCAGGGCTCAAG
CACCTGGGCCATCTCTCCACTGCACTCCCTGGTTCACAGCAGGCTGGCCTGGAAGAGGGG
CAACCGGGACAGAATCTGGCGCCCTGACCCAGGACTAGAACCCGGTGTGCCGGCGCTCGC
TAGGCAGAGAGATTAGCCTAGTGAGCCGCGGCGCCCGGCCCAGATTTATAATTTTTTTAA
TTACCATTTCAAATTGAATAGCACTTCACAGTACTTTCCACCTGTTTGCTTTATTCTCAG
AAACATGTTAGCCTCAGCTATAAGCTACTCATACTCCAAGGATATGTACATTTTTTAATT
TGGTAAGCATTATTAAATTCATCTGAGAATTTTATTTCAATCTATATGCTTACCAGCAGT
ATATGGTTTTTATCCTCTATATTCTCAACTTTTTAAAAGGTTTTTGACAATCTGATCGGT
GAAATATGATGTAACATTGTTAGATTTCCTTGATTAGTAGTGAAGTTAGCATCTTTTCAT
ATCTAAAGTTTTTAATATCTGTGCCATTTGTCCAAACCTCCAGGTATTTGTATGAATATT
TAATTATTTGCTGCTTGTTTCTAAGGAAATTTTAATCAACGTTTTAGCAGAATCTGTGTA
ATATCAGAGGGAAATCCTTAGTTGTCTAATTGTAGTTTTCATTGAGAAAAAAGAATGGCA
GTGCCATGATTCTGTTGATAAAGTACACAAAAATAAAGGATTCAGAGACAGAAGCAGATT
GTCTTCAAGGGTTCAGAGCAAGTCAAGGAGTGGTGCTTGTCAGTCTTCCCTTAGGCAAGC
GGAGAATAGCGGCTCCGTGGATACAATCGAGGCTTCATCAGTCCTATTTTAGCCCCTTTA
CAAGTCACAGAATAGAGGACAACGCCGCGACTCACTAGCTTTTATCCTCCGCCTTGTAGC
ACCGACACACCAGCTTCTAGTCATGGCTGGGGCGCCGTATTCTGTCCCAGTTGCTCCTCT
TCCAGGCCAGCTCTATGCTGTGACCAGGGATAACAGTAGAGGATGACCCATGTGTTTGCC
CCCTGCACCCCATGGGAGACCAGGAAAAGTACCTGGCTCCTGCCATCGGATCAGCACAGT
GTGCTGGCAGCGCGCCAGCCGCGGCAGCCATTGGAGGGTGAACCAATGGCAAAGGAAGGC
CTTTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAAAATAAAAAATAAAA
AAAATAAAAAATAAAAAAAAGAAGTCACTGAATGGGGACTTGATATTCTGTGTATTTTCT
GAGCCACAGATGGGCTGATTGCTGTACTTTTGGTTTTATTCAATTCATTTCACTCAGATC
TGATGCTTTCTGTGAAATCTTTGTAGTAAAGCAGACTGATCACATTTGGGTAAATGGTAT
TAACTCTAACATTATTATGTTGTTTTTCTCCAAAGTATCTTTATGCATTCAGTATTGTTC
CCATGAAACTAATGGATACAGCAGAACTGGTAAAACAACCTCCAGATGTCACCGAAAACC
CCTACAGAAAATCTGGGAAGGAAGCAGCCACAGGAAAGCAAATCTCTGCCCCTGAGGTAT
GTTCTAATTGAGGGCTGGTATCTTCTGGGAAGGAGTGCTCATTACAAGTATACTTTTTCT
GATGATTGCTTAGTACATATGACAAATTTCATACTTAAAATCAGAATCTTTTTTCTTTAG
GAAAATCATAGTGGTGAGTTTCTTATTGTAGCTTGAGGTTAAACAGTTTCAATGTTTTAA
GTCTGTCTTTGTCAAAATTTGATTAACTGGAGACTGGTGCTGTGGTGTAGTGGGTAAAGT
CGTTACCTGAAGTGCCGGCATCGCATATGGATGCTGGTTCAAGTCCTGGCTGCTCCACTT
CCTATCCAGCTCTCAGCTATGGCCTGGGAAAGCAATAGAAGATGGCCCAAGTACTTGGGC
CCTTGCACCAGCGTGGGAGACCTGGAAGAAGCTCCTGGCTCCTGGCTCCAGATCAGTGGA
TGGAAGACCTTTCTCTCTCTCTCACTTTCTCTGCCTCTGCCTCTCTGTAACTCTGCCTTT
CAAATAAATAAATAAATCTTTAATTAAAAAAAAAATTTGATTATTCTTAGCTCTTTAGCA
AGGATTCAAGTTGGTAGCAGTGTCATTTGTGATTTATATTGATTGCTAATAGGTGCATAA
GATTCATTCTGAAGAAATTGTCTTGGTAGAAGACTTTACTGAAATTAAATTTTCTCCACA
ATAAAGCAAGGAATGTCAAATTCTCTTATTAGTTTGCATGGTCTGCTTTCTTGGGCTTTT
CTTTATGTTCAATCTTCTCATCTCTTCAAAATAAACTGAATTATACTTATTTGACCTGTG
AAATTGTAGGATTATATTATGTTTCCACTGAGAGAGAAAGGAAAAGGAATTTGAATGGGT
TCATACTGTTTTGCTTTAAGCAAGAATTGCTTTGTACTTTGCATTTTCCCCCAAGTGGTG
GGTTTGGCAGTAGATTGGCTAAGGGTTGAGGTACATGACTGAGAGTCCTGGAATCAGGAT
TGGGAAGATTCTTTTTTACCCTCAAATAGGCAGAAAGGGCTGAGAGGAAGGATAGTCATA
ACATGGCGGGAGTCTCTGCGAATGGTTGGCTACTTGTCTAGAGGTTAACTGAATAATATT
TACTCTTCTGCTTACTGCCATTCCAGGAAGAATCGTCCTGTCAATTTTTCTTTGATTTAA
ATGAGAAGCAGGGAAGGAAGCGTTCATCCACAGGCAGAGATAGCAAATCTCCTCACCCAA
AGCAGCCTCGCAAACCTCGTAAGTACCTTGGTTCTGGAGGTCGCCTGTGTGAGCAATAAC
TTTGTTCTGGATTTTCTTTGGAAAGCAGCATTGCTAAAAGCACCTCTTCTGGCAGAGAAA
AACTGTGTACTTAATCATTAGGAGCAACAGTAAAAATAAAATACCAAAGATGGCCTGACT
TTGAGGCTGTTTGAGACACTTCCTGTAAGAACCATGGAAACAGCTCCTTTTCTTTGTGTC
TATAAAACATGAAAAGGTAAAGAGCATAAAAAACCAATATAGTCTATGGCCATACCACCT
TGAACTTGCCCGATCTCGTCTGATCTTGAAGCTAAGCAGGGTTGGGCCTGGTTAGTACTT
AGATGGGAGAAGACCAATATAGGTTCACAAAATAATCGAGTATTCAAACTGAGAGGAAGG
ATCTTAAGGCTATTTCATTGAGATCCACTTTTCCATCTCCTTGTTTTAAAGATGAAGATG
CTGACCTTGGCTGGCCAGTGGGACTAGGGGGCAAGAGGGGAAACTGAGAAGGGGGATCAG
CTACTGGTATAGTTTTCTTTAATGGCATCCTGTGGCCAGTTGTGTGCTGTTTAAGTCCAT
GTGTGATTATCTACTACCTGTGGATTGGTTACAGATTCAAAATTTTTCTAATAGAGATGT
AGTCTCATTAAAAATGGTGTTGGTGATGTCAGAGTGAGGAACCGAAGTCCAGCCCTTTAT
GGCAGTGCTATGTCCCGGTATTCACAGGATAAAAGGATTGGACGAGACTGAGTTCCACAG
GGTGATTTTATGCTGTAGTGCTTGGACCATAGTAACTCTTGGCTTTCTTCCACATGAAGC
TCAGCCTCCAGGACCCTGCTGGTTTTGCCTTGCGAGCCCTGAAGTGGAAAAGCATTTGGT
TGTCAACATTGGCACACATGTGAGTTATTTCCATTAACCTTTTACAGAGAAGGAGGCACT
TGCTTGTTTTTTAATTAACCTTATTGAGTTATAATCTACATATAAAATTTACTTTCAATT
TGAAGTGTGCAATTCAAAGACTTTTAGTAAGCTTACTGAGACATGCAACCATTGAATAGC
ATAGTTCTATAACATTCCCACCTCCAGATGTCACTGAAAACCCCTACAGAAAATCTGGGA
AGGAAGCATCGTTAGGAAAGCAAATCCCTGCCCCTGAGGTATGTTCTAATTGAGGGCTGG
TATCTTCTGGGCAAGAGTGCCGATTACAAGTATACTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTAAGATTTATTTATTTATTTGAAAGGCAAAGTTACAGAGAGGCAGAAGCAGAGAGAG
AGAGGTCTTCCATCCACTGATTCACTTACCAAATGCCTGCAACTGCCAGAGCTGAGCTGA
TCTGAAGCTAAGGAGCAGGAACTTCTGGGTCTCCCATATGGATACAGAGGCCCAAGCACT
TGGGACCATTTTTCTACTGCTTTTCCAGGCCCTAGCAGAGACTGGATTGCAGTGGGAGCA
GCTGGGACCTGCCTGAACCGGTGCCATATGGATGCTGGCACTGCAGCTGCAACTCTACCT
GCTGTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGGACATTTCAATTTTAAATAGCATATTACAGAATTGTGACCTTTTGGG
GTCGGACTTCATTAAGTCAGCACAGTATTCTTATGGTTCATCTATGTTGTAGCATGTCAT
CAGTATTTCCATTTTTTTTATTCTGAAATAGTATTCCCATTATAGAGACATACTATGTGT
TGTCTGCCCTTCATTTGGATGGACATTTGAGTTGTTTCCATTTTATGGCTATTAAGCGAA
ATTCTGTAATGAGATGTTTGCTTTCCTGTCTTTGTATAAAGCATGTGTTTTCATTTCTTT
TGGTTAGATAGAATGGAATTGCTGAATAATGTAGTACATTTATATTTAACTTAAAACAAA
AAACTGCCAAGTTGTTTTCCAGCATGGCTGTACTATCTTATATTCCCTCCAGCAATGTCT
GAGTATTTCTTTTTCTACAACCTCAGCAACATTTGTTGTTGTCTGTCTTTTTTATTGTAG
CAATTCTCCTGTGGTTTTGTACAATTGGTTTCACAAACTTGCTCCCTTCCTTTATCCCTC
TCTCACAAATAGGTTTGATTCTCCTAGGGTGATGCTTTTATATATATCTTAAACTCTTTG
TATTTTTATTTTATTTTAAAATATTTATTTTGTTTTATTTTTTTAAATACTGAAAAAGTT
AACAGTTTATTATAATTTATTTTATTTAACAATCTAGGAAGTTCGCAGCCATCAGCAGTT
CCAGTGCGATTTCAGGTGCAGTTGGGAATTTGGGAATCTCGGTGGAGCTGTTAGTGTAGC
GAACCTTGTAGGTAAAATACAAGCATACTTTTGATAGCACATGTGAAGGGATCTCTCTCA
AATTGACCTCATTGGTTTCATTTTCAGCAAACTGACCTGGGCCACTCAACATGGCTAATT
GTTCCTGATATTAGTGCATGCTCTCTTTTTACAATAAATTCATGACCATCAGAAGATATC
AACTTGACATACATGGCATCAGGGCCTTCACAGCCACCATACGTTTTCTCCTCTCCATCC
ATTATGTTCTTATGAAATTCTACTTTGCTTCCACAGAAACTTTAGTAGTTTCCCCTGTGG
GTTCCGGGGCAGTCTAAAGGATTACTTCCGTCAGGTCACAGCCGCTCTCTTGTTTATTTA
TTTCGAAATTCAGAGTTAGAGAGAGTGGGAGAGAGAGATATCATCCGTCTTTTACTTCTC
TCTCCAAATGGTCACAGCGGCCAGTTTTGGGCCACGCGAGAGCCAGGAGCTTCATCTGGG
TCTCCTACTTGGGTGGCAGGTACCCAGACACTTGCACCATCTTGCACTGCTTTTCCCAGG
CCATTAGCAGGGAGCTGTATTGAAGTGGAGCAGCCAGGACTAGAACCGTCACCCACATGG
GATGCTGGCATTGCAGGCTGCAGCTTTAATTGCTACACTATAACACCAGCCCCTAAACTC
TCTTTTTTTTAGTGCATACCTGTTTGATAGTGATGTGTTGCTTTTGTTAATTATTCATAT
TTAAAACTGGATATTTTTTGTCCTGAAAAGGAGTCTTCTGTTGCTTATATGCCTTCGCTG
GGTTTAGAATGTTGATTTTTTTTTTTACAGCTTCAGATTCTGAAGCTTGAACTTATACAT
TAGTTTTTTGCAAGAATTGTTAACACTGAGAGTGATTCACACTAACTTATGTCAAAGACT
AACATGACAAATTCTCTTTTGCCCAGTAGTAGAGGATGTTACTTCCTGATGTCAGGAATA
CCCACATGCACATCCTGGTGTGAGTAGCCAGGAACCCAAGACAGTTTGGTAAGCACTGAA
TCAGACTATAAGCACTGAATGACCTTGGGTATAAGTTTATTTAGGCTGTGCAAAGTTTGG
GTAAACTGTGGGTCTGTCACAAGAAAGTCATTGTCGTTCACTTTTCCCCCAAATGTTTTT
CCTTGGGCATGGCTCAGTTAGAGATTTTTAAAAAGATTTTTATTTATTTGAAAGGCAGAG
TGATGAGAGTGATTAATCTTCCATCCTTTGATTCACTTCCCAAATGGTCCTCAACAGCTG
GGGCTGGGCCAGGACATAGCTAGGAGCCAGGAACTCCATCTGGGTCTCCCACGTGGGTAG
CAGGGACTGTAGGACTTGAGCCAGCATCTGCTATTTTTGGAATGCACTTTTTAGATTGTT
TTTCTTGAATCTTACTTCTTCTTTGGGTTAGTCTATAACATTCTTTCTACCACATAATTT
GTGTGGTGAGGCAGGCTTTTTTTTATTTATTTATTTATTTATTTATTTTGACAGGCAGAG
TGGACAGTGAAAGAGACAGAGAAAGAGGTCTTCCTTTTTCCATTGGTTCACCCTGTAATG
GCTGCTGTGGCTGGCGCGCTGTGGCCGGCGCACCACACTGATCCGAAGCCAGGAGCCAGG
TGCTTCTCCTGGTCTCCCACACGGATGCAGGGCCCAAGCACTTGGGCCATCCTCCACTGC
ACTCCTGGGCCATAGCAGAGAGCTGGACTGGAAGAGGAGCAACCGGGACAGAATCCGGCG
CCCTGACCGGGACTAGAACCTGGGGTGCCGGCACCGCAGGTGGAGGATTAGCCTATTGAG
CCGCGGCACCGGCCATGAGGCAGGCTTTAGACTGTGTTCTGTTTAAGAAGTTTCAATAGG
TTTATGGTCCTATGCAGGGGAAAAGAGATATGCAGTGGATGACCTAGCTAAGTACTTCTC
CAGACCTCAGGAAGAGATGACATTTTCTTTCCATTCACCTTTCTCAGGTATCTAGCTCGG
GGTATGAACCAAGGAGACCTTACTTCTCATCTAGCCTGAAGTTAGAGGGGCAGAGTCTTC
TTGGCGGCCCATCCAAGCAATGTTGTCAGAAGGCCCCTGTGAACTTCTCAGTCTAGAAAC
TAGTAATGAAGTCTACGTTTACTTGTACTGACCTTTGGCAGAATCGTGTTAAGAATTCAT
GGTAACCTTTGAGTGTCTGGCAAGAGGTTTGAGACTCCTCCCTGCAGCCATATTTCTTGC
TCACCTTTTAATACATTCTACCTCCTGGCTTTCTTTGCCTTTGCTGTGCCTTCCTTAAGG
GTGGACATAGAACTGTGCTGATGACCCACAGCCACAGTAAAATGGGCAAAGTCTACTAGG
AGTCCCAAATAACTCCTGCAAAAGCCATGTGTCTTTCCTATGGGAGGAATACTTATTTCA
GGTTCTATTTATATGTTGTTAGAGATCATCATGAAATAGATGAGAGGGTGAGGCAGGAGC
CAGAGCTTCTTCTAGGTTTTCCATGTGAGTGCAGAGCCCAAAGACCTGGCTATTCTTCTG
CTGCTTTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGTGGTTCAAGGT
AATAAAAACTGTAAAGTTGTTTTCAAGTTGCCCAAGAGGGAAAACCTGTCTGTCGTTATG
GTTTCCATCAGCTCTAGTGTGCTTGACGCCAAAAGTCTGTTCCTCTGCCTTTCCCAGTTC
ATTCAGACATTCAAGAACATTCTTGCTATAACCTCTAAAATCAGATTTTTGAAGGTTGGA
GTTTTGTTTAATTTTTTTATATGTCGTATTTATACATATTTATGGACTGTACTGACATTT
TGATACATGTATGTCTACAATGTGTAATACACTGATCAGGATAATTGACATAACTATCAC
CGTAAAGATACATCATTTCTTTGTGTTAGCAACACTGAAAATTCTCTCTACTAGCTATTT
TGAAATATCCAATTACTCATCGTTAGCCATAGTTATCTTTTGGTGCTACAGATTATTAGA
AGTTATTCCTCCTATCCAGCAGTACCCCTGTGTCCATTAACTTTCCTTTCTCCATCCTTC
CCTCTCTTATACCCTTTCTGGGCCCTTGGCAACTACTATTTTATCCTCTTTACTTCTTTG
AGCTCAAAAAGTTGGAAAATTTTTATTGATGCCTCTTGAGCACTTTTCTACCACCCTCAG
GCCCACTCTTTGCATAGGCCTTTCTCCCTGGAGACCCATCCATACACTGTTGCTGTCTCA
ATTCCATGTGCTCCCTCTTTAGTGCTACCTAGCCCTGGCCAAAGGAGGCTTAGCTGATGA
TCATGTCCTCATCCTGCCCATTGGACACTACCAGTCAGTGGTGGAGCTATCGGCAGAAGT
GGTGGAAGAAGTGGAGAAGTATAAGGCTACACTGAGACGGTTCTTTAAAAGTCGAGGGAA
ACGGTGTGTTCTGTTCGAGAGAAATTATAAGAGCCATCATCTCCAGCTACAGGTAGGTAG
TCACTGCACAGGAACTTAAAAGTGCACTATAGGACACTTGATACTGATAAATAAATGTTC
AAATAATGCTTAACTTTAATATCTAATTAGATATTCAGAATATTTAACTTTATATTTAAT
GTATTTAATATGAATTTTCATATTTAAATCATGTTCATTTAAAGAGTATCTGGTGATAAT
CCCAGATATTTCACAAGGAAGTGCCTGATCAATACAGGTGAGCAGCCAGGTAATGCAAGT
ACCTTGTTTGAGAACAGAACAGGTAGTTGAGGAAGGTTCCAAGGAAGAAACACGTCTGAC
TATGTAAGAGTTTGCAAATTAGTGGGCTATTTTGTGTGGAGACCCAGCACAAGTGAGGGC
TTAAAGGTGAAAAATAGACATGAAGCCTGCAATGGGCTAGCCGCTCATAAATTCAGAGAT
TGTTTGTAGATACTGTGCTTGGATTTGTGGTGGTTTTCTCTTTGGTCCATTTGTTAAGTT
TTCAAATGGGCCTGACTCGGCCACATACATTATAAAGGATCTGGCAAAGGCTTGATGACA
GAGATTTCTGTTGAGCCTATCCTGCATCACAGCTTGGCTCCCACATGCAGCAGGCTATCT
CATAAGTTTAAGTCCTTACAGACAGGCTGGTATGGCCTGTCTGGCCTGAGGAGAGTTTGT
GCTGAGGGGTTTTTCTCCATGCCCCTGTGATGGATTCGCTGCTTTGCAGACTGTGCAGGC
CCACCCTCTCTGGGACCTGTACTGAGAATTTCTCCTAACCCCACCCTAGGTCATTCCGGT
GCCACTCAGCTGCTGTGCCACTGATGACATTAAAGATGCCTTCATTACCCAGGCACAGGA
GCAGCAGATAGAACTGCTGGAAATCCCTGAGCACTCTGACATCAAGCAGGTGAAGCAAGA
AGGGAGGGCAAGGGTCAAGATCTGGGTTTTGACATACTGTGCTTCAGGTCTATCTAGGCT
TCCCAGAAATGTTCAGTGGGCAGGGGACAGTTTGGAACTAGAACACGGGTATTTATTACA
CTGGCAATGGCGATGGTATTACAAAAAAGTCATAGTGCTTTCCTGTGAAGAACAAGAAAT
TCGCACCGTTCCTAAGGTGGGAATTTAGATGGGTGGATGCAATGAAGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGAAATGTAGGAAATGTACAAAATGGATTATCTGATGTCAGTATC
TGTGATTTGCCATTGTTTCATTCCCCATAGTTAGAACTGGACTTCGAGTGAGTCTTGAAT
TCTTCCTGTCTAATTTGGAAAAGCCTCCTAGAGATTGCCCCACTGGACAACTCTAGTGAA
TATGTTTTCCTACATTTTTAAAGAGCTAATTAATAAGTGACAACAAATGTGTTAAAAGCA
TCACATTGATTTGATGCTTTTGTGTTGCCTTAGCAGCAGGTGCAGATAAGCACAGTAATG
AATAGGGATATGACTAGATGCATACGGGCATGTTACACATCCCACACAAGGGAGAGTCTC
TGAATGGCTTTTTGCTCATGATAGTTTTATTTGCAATATTGAATAATTTTTTAAATATTT
ATTTTACTAATGGCATTCTGTAATTAACACAATACATATAACAGCAATTTTTTTCCAGCT
GTTCAAGAAAAGTAGTTTTATATTCATTTTACATATGAGTAAGTAAGCCCAAGGTTGGCC
CAAAGAGCTAGAACTTGAGTTCAGGTCCTTCGTCTTTTAGGGGACTTGTGTGATTTGTTT
TCAATTCTCCTATTTATTATAGCTTCAGAATGGAAAATGAACATACAGGTGCACACAGAG
TTATTTCTAATGTATCAAAATAAGTAAAAATAACAATATAAAGCAGTGGCATTTAGAAGG
CATCTTATGTGTGTGTTCCTGTATGTAGTTATTCTTTAGTCTTGTGAGCCAAGATTAGTT
GTTGACATAGAACTTTGTATTGCTGTGACTGTGTAGGCCTGAGTCCCCTGGAGGGAGAGG
CAAGAGGAATTTTAAGTCAGAGTGGGTACCACACTAGGTGCCTCCCTCTGAGTCATGCCT
TCAGCAAACTCATAGTCTAGAGGGGGTGACAAAACTACAGTTTAGGGCAGGATGTAGTCA
TAGCCAGCATGGTATCTCTGTACCTCACCAAACCCTGTAAGGTAGGCAATCTTATTTGCA
TTTCATAGATGACAAATTCAGGACTCAGAGATGAAGTAATCTATCCCAGTCATAGACAAG
AAGTGGCAGAAGTAGGAATGGAATCCATTCTGTGATCTTTCTGACCACCAGTTCTACCCA
CTTTCTGCTATGTCACATTGCTTCTCTAAGTACCAGCAATGTAATTCAAGTGTGTTCAAG
AGAAGGAGAAATAAGTGGGGTTTAATGGGTTAGAAAAAAGATAAGACTTAAGTTGGCCAC
TTAAATTTTTATTTATTTTCATTTTATTTGAAAGGAGAGACAGATGTAGACAGAGATTTT
CCATTCACTGTCCAGATGCCCACAACAGCCTGAACCAGGCCAGGTTGAAGCCAGGAGCCT
GGAACTCACAGGCCTCCTATGTGGGTAGCAGGCACTCAAGTACTTGGGCCATCACTTCTT
GCCTCCCAGGATGCACATTAGCAGGAGGCTGGAATCTGGAGCAAAGCCAAGGCTGAAACC
TAGGCGCTTGGATATGCAATGCAGATATCTTGAGCTGTGTCTTAGCTGCTATGCCAAATG
CCCATCCCTGAGCTGATCACTTAAGATGGATGTGATTTTGATAGATGGGGTGGCAGAGAT
GTTACTCAGGGCGGGAGAACACTAGGAGCAGTCAGACAAATTCACATACTTCGGTTAGAG
AGGAATAGAATAGAGGGAGGAAGGGGTTTCAGTCTGATATTGTCCATTTTGTGTTCTTTC
CACAGGGAGGTGCTGGCCAGTGAAGCCATCCTTAATATTCCTGACAAATCTGACTGGAGG
CAGTGTCAGGTCAGCAAGGAAGAGGAGGAGACACTGGCTCGCCGCTTCCGGAAAGACTTT
GAGCCCTTTGACTTTACTCTGGATGACTAAGCAAAGGGAAGAACACTTTATGAACTTCAC
AGGAAGTAACAGCTTGTTTTTAAACCAGTCTCCCGTGGGGACTGTTTCTCTGCCTCTTTT
TTGTGCATTCCCATGGAACCTGCCTGTAGCAAGAGGCTTAGGATTGCATATTTTTGGGGA
GAAGTCATTCTAGGATTAAAATACTGTTTTGAAAACATCTGTCATCCAACTCCTAAGAAC
GGCTTGTGTTTATGTTTTCAAAAACTTTGAAGCTATCAAATAAAATCTAAGTGCTTTCCA
CAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 3009..3093, 4030..4108, 4679..4780, 8518..8582, 8585..8595, 8598..8733, 11652..11770, 16378..16462, 18755..18895, 20006..20117, 20939..21018, 27262..27471, 28249..28368, 29442..29539, 32105..32246
1001..1023, 3009..3093, 4030..4108, 4679..4780, 8518..8582, 8585..8595, 8598..8733, 11652..11770, 16378..16462, 18755..18895, 20006..20117, 20939..21018, 27262..27471, 28249..28368, 29442..29539, 32105..32246
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved