Oryctolagus_cuniculus Locus SCCPDH
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SCCPDH
Oryctolagus_cuniculus
SCCPDH
GeneScaffold_4566
SNORA40
2940..3069
24246
TGCAAGGTGGTCCAGCAGTTTTGGGAATAGAGAATCGAAGTGTGGTGACCTTTGCTGAG
ATGCCACCTGGGGCACCCACATCCCGTACTGGAGGGTCTGGGTTCCAGTCCCAGCGCCAT
TTCCAATCCAGCACCCCGTAATGTGCACCCTGCCGAGCAGCAGATGAGGGCTCAAGCACT
TGGAGACCCACGAGTTCCCGGCTCCTGGCTTCAGCCTCGTCCACACTGAGCTACTGCAGG
CATTGGGAGAATGACCCAGGTCGCAAAAGATCTCTTTGTCTCTTTGCCTTTCAATCAATC
TTTAAAAAAAAAAAAAAAATAACAATTTAATGGGTGCCGACTTATTCGAGTCAGCCGGAC
GCCTGGGATCTACAGGAGGCCCGGGGCTCCACGCTGCCTGGGGCCGCTGGATCCAGTCCA
GAAGCCAGGTGCAAATCAGTGCCTCCTGCAAACTGTACTGATAACGAAAAACGCGAAACA
CGGCACAAGGGCGTTCCCTTGTGCCCCTCACCCGCTCTCCCGGTTGTCTAGCCGTTTACC
CTCCACCCCAACCCAGGCCTCGCAGACACCCCTGGGGGCCACGCTACTCTTCCTGGTGCA
ATCCTCTCCGACAACTGGAATAACCGGGCTCCCGCCGGCCCCCAAGCCCCCCCGGGCGGC
GAGCAGATGCGCCGCCTCGAGCGGTCAGAGCGGTGACGGGACCCACCGGCTGGCCTGAGC
CACCGGCTGCCGTCCGCCCCCATCAACCCCGGGAAGGGCCGCGGCCCACGGGCGGCGCCT
CAGTAGGGGAGGCCCGCGGCCCCACCCGGGAGCTGGGGCGGCGCGGGTGTTGCCCCTGCG
CGCCTGCGCGCGGGGCTAAGGGGGCGTGGCGCGCCGGCGGCGGCGGCGACGGCGGCGGCC
AGGAGGGCGGCGGTTACTGCGCCGGATACTGGGGTCGCTGCCTGAAGCGCAGGCGCCGTG
GACGCAGCTCGCCCCGGGCCTCGGGTGCCTGTGGACTCGTCATGGCGACCGAGCAGAGGC
CTTTCCACCTGGTGGTGTTCGGCGCCTCTGGCTTCACCGGCCAGTTCGTGACCGAGGAGG
TGGCCCGGGAGCAGGTGTCCCCGGAGCGGAGCTCCCGCCTGCCCTGGGCCGTGGCGGGCC
GTTCCCGGGAGAAGCTGCAGCGGGTGCTGGAGAGGGCCGCCCTGAAGCTGGGTAAAGGGG
GCGGGCCGGCCCGCTGCGGACTTTAGCATCTCCCCGAGCGAGTTTCCTCGGGGATGCGCC
CCACCGCTGTCCTCCGTCCTCTCCGTCCTGCGTGAGGGCACGAAGCGGAGAGGGATGTTT
CCTACGTTGTCGTGGCTTTGCCATGGCAGTGTTCCACTCCTGAAATAAAAAAAAAATTCT
TTGCCTCCCCTCCTCATTTTTCAGTGAGTCCCCTAGTTTGGGGGAAGGGGCCTTATGGAG
AAATTGGTCAGGAGCTTCAGTTGTCCCTTTCTTGTCTTGGTCTTGATCTGGGGCAAGGGT
AACTGCTGGGTCTCGAGGTTTCTGGATATGTGGTCGGCTAGGGAGGTAGGACATTGATTC
CTTTTAGTTTGTGAGACACTTTGACCTATTGAAGCTTGCACTGAGTTGGCTTGTTCCAGT
TCTTTCCTTATTATGAGCCTAGGTGTTGTTGTGTTTGTTTTTGTTTTTTTTGTGGTGGTT
GTTTTTGTCAAGGTGTTGATGCAGTCTTCTTCCACTCCCTATAATTGTTGATTTGTTGAT
GAGAAACTTTTTATTTTAACATTATTTATTGAAAGAATTACAGAGAGAGAGAGAGATCTT
CCATCTACTTGTTTACTCCCCAATGGGTGGAGGAGCGAGGTCTGGGCCAGGCCAAAGCCA
GAAACTTCTTTCAGGTCTCCCATGTGAGTGGGTGCAGGGTCCCAAGCACTTGGCCATCTT
CCACTGCTTTCCCAGGCACATTAGCAGGGAGCTGGATTAGAAGTGCAGCAGCCAGGACAG
GAGCTGCTGCCCATAAAGCATGCCAGCATTGCAGGCGGCAGCTTTACCTGCTACATCACA
GTGCTGGCCCAAAGAGATTTTTTTCCCAGAAACTTTCTATGATATAAGTTTATTTATAAA
GAGGAATTCAGGACCATCATCTACTCAGTAACTAGACTTGTTTGTAAAATTGTCCTGTTA
CACAGAGCTGTCATTCACACATTGCTTGTATTAGATGCATTTGTAAAGGTTTCTAATGTT
GATAACCCTGAATGTTAACTCCATTTTCCTTATAGTTATTGATTTTAAACAGTTCTATCT
TTGAGAAAGATAGATTTTAGTATATCAGTATATTTAATAAATTTGCTCTCATAGATTACT
GTAAAAAGATCTGGGAGATGTAATTCTTTGCTAGGATTTGCTTTAAATGATTTATTTTGT
TTTTATTTTAGGCAGACCGACACTGTCATCTGAAGTTAGAATAATAATTTGTGATACAAC
TAATCCTGCCTCTCTCGATGAAATGGCTAAACAGGCAACAGTTGTCCTCAATTGCGTAGG
ACCAGTACAAAATCGCCCATTCGGGCAATAAAGAGAAATGCACATCGGTTTCTTTCCTTT
TTTTTTTTTTTTTTTTTGACAGGCAGAGTGGACAGTAAGAGAGAGAGAGAGACAGAGAGA
AAGGTCTTCCTTTGCGGTTGGTTCACCCTCCAGTGGCGCCGCGGCTGGTGCACCGCGATT
ATCCGAAGCCAGGTGCTTCTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCACCTGGGCC
ATCCTCCACTGCACTCCCTGGCCACAGCAGAGAGCTGGCCTGGAAGAGGAGCAACCAGGA
CAGAATCCAGCACCCCAACCGGGACTAGAACCCGGTGTGCCGGCGCCACAGGCGGAGGAT
TAGCCTGTTGAGCCACAGTGCCAGACGGCACATCGGTTTCTTTAAGAAGGAAGTTGATAC
TGCACTTGTGTATATGTTTTTGTTTAACTTGTGGACAAAGACTGACATACAGGTGCAAAA
AATAAATCCTCTTTTGCAACCCAGAACTCATTGATCAGTATGAGTTCTGATACATACAAG
CAGGAATAGGATGCCAAAAAAAGAGGAAAGTTGAGGGGAGGTCTCTGTAAGGCATCGACG
TTTGCGCAGAGATCGGAATGAAGAGCAGACTGTGAATATGTGAGGAGAAGCATGCTGCAG
GCCGAGCGCCTTCTCAGGTCCTGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCAGGTATGTAAATGAGAAGAAGAAAGCCCCAGAATTTGAAGCGTTGATTTTT
CTGTGTAATGAAGTGGAGACTGTCTGGTGCCGTTGTGCAGAATGTTTTTCTGGTTAGAGA
TGGTCTTTGAAGCTGGCGCCGCGGCTCACTAGGCTAATCCTCTGCCTAGTGGCGCCGGCA
CACCGGGTTCTAGTCCCGGTCGGGGTGCTGGATTCTGTCCCGGTTGCCCCTCTTCCAGGC
CAACTCTCTGCTGTGGCTGGGGAGTGCAGTGGAGGATGGCCCAAGTGCTTGGCCCTGCAC
CCCATGGGAGACCAGGAGAAGCACCTGGCTCCTGCCATCGGATCAGTGCGGTGCGCCGGC
CGCCGTGCGCCGGCTGCAGCGCGCCAGCCGTGGCGGCCATTGGAGGGTGAACCAACGGCA
AAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAAAAA
AAAAAAAAAAAAAAAAAAAGAGAGATGGTCTTTGCTAGCTTGAAGGAGGCCACTGATGAT
AAGGTCTCAGCCTCAGTTTTCTTGACTTTTTTTCTTCCTCACAACCTCATTTGCTTTAGG
TCCTCGGTTTAGGGAATGTGTTGATTTTTATGGCTATTATATGTGGTAAATGAAGTTAAA
ATAGTGTCCTATGTGTAATTCTCAAAATCTCACGTTTACAACTTTCCACTATGAATTCCC
CTTTCACCACCCCCCAGGCACCTTTACGTCCTTACAGAAAAGTAATTGTAAAATCTCAGT
AACTTAGAAATTTAAGTGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTAGCCGGTAGCTGGAATGGAAACAGAGCAGCTCAGAC
TCAGTACCGGGGCTCTGATATGGGATGCTGGCGTTGCAGGCAGCAGCTTAGCTCACTGCA
CCACAATGCCGGTCCTCCCTACCTTCCTTTTTTGTAGATGGAAATTAAAGTTTAAGAAGG
TTTAAGTCATGGTGAATGTTTAGTACAGCAATTAAGTCACTGCTTGGGCCAGGCTGCAGC
TAGGAGCTGGGAACTCAGTTTTGCCTTTCTGCCTGCACAGTAGGGACTCAAGTACTTGGC
CCGAGAAAGCAGTGGAGGATGGCCCGAGTACTTGGACCTCTGCACCTATGTGAGAGTCCC
AGAAGAAGCTCCTGGCTCCTGGATTTGGATCGACTCAGCTCCAGCCATTGTGGCCATTTG
GGTAGTGAACCAGCAGGTGGAAGCCCTTTCTCTGTGTCTCTTCCTCCCTCTGTAAATCTT
CCTCTCATATAAGTAATTAAATAATCCTGGACAAAAAAAAAAAAAAAGTACTTGAGTCAT
CTACCTGCTGCCTCTCAGGATCTGTATTAGGAGGAAGCTGGAATTGGGAGCAGAGAAGTA
CTCAAACCCAAGCACTCTGATATAGGATGTGGATCTTGTCCACTGGGCCAGACATCTGCC
TGATAGGTCAATATTAGAAATACAAATAACTGGTGTTGGCTTTGTGGCATAGTGGGTAAA
ACCACTGCTTGTGACACTGGCACTCCAGATGGGCACCTGTTCATGTCCTGGCTGTTCTGC
TTCTGATCCAGCTCATTGCTAATGGCCCGGGAAGAGCAGCAGAGGATGACCCAAATGTTT
GGGCCCCTGCTAACCATGTGGGAGACTTGGATGAAGCTCCTAGATTGTGACTGGCCAATG
CAGCCATCTGGGGAGTGAACCAGCAGATGGAAGATCTCTCTCTCTCTCCATCTCTGCCTG
TAACTCTTTCAAATAAATAAACCTTAAAAAAAGGAATGAGATACAAATAACCCAATTAAA
GTGAGGGGTTATGAGAAGAGATACATCTCCTATATAGAAGAATAATTTATGTAGCTTGTC
TTCCCTCAGGAAGGAGCGGCATAACTTTACAGTGGAGAAAGCCAGCACACCAGGTGTTCA
GGGTCAGCATCAACACTGTAGATTGTATTGTCAGGATGTAGCCTTGACATGATGTGGGGA
GAATGGGGCCTTTTTTTTTTTTTTTTTTTTGACAGGCAGAGTGGACAGTGAGAGAGAGAG
AGACAGAGAGAAAGGTCTTCCTTTGCCGTTGGTTCACCCTCCAATGGCCGCCGCGGCCGG
CACGCTGCGGCCGGCGCACCGCGCTGATCCGATGGCAGGAGCCAGGTGCTTTTTCCTGGT
CTCCCATGGGGTGCAGGGCCCAAGCACTTGGGCCATCCTCCACTGCACTCCCTGGCCACA
GCAGAGAGCTGGCCTGGAAGAGGGGCAACCAGGACAGAATCCGGCGCCCTGACTGGGACT
AGAACCCGGTGTGCCAGCGCCACAAGGTGGAGGATTAGCCTAGTGAGCTGCGGCGCTGGC
CAAGAATGGGGTCTTACCTCTTTGGTCTTCTTTCCCAAACTGTTAATCCCAGCTTATCAT
TAGAAAAATAAGACATAAATATTTCCTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCATGAGAAACCTAAGGAGACACAACTAAATGTAATGTGTATCCAGGACCG
GACCTGGAACAAAAAAAGGACATTAGGTACAAGTTAAGGAAATCTGAATAAAGCATGAGC
TTTAGTTAGTAATATTATATACATCTTGTTTCATTAATTGTAATAAATACTAATGTATAA
AAGGTGTTAGTGTGGAAAACTGGGTTTCAGGATACATGGCAATTGTGAACTATTCAGTTT
TTCTGTAAAACTTCTAAGAAATAATTTTTAAAAACAAGGAAGTGATTTGAACAGACGTCA
TTCCCCTGTCATCTGTCATCTGTTGCTTTCCTGTCTGTAGACTTGGGTCTGCAATGGTGT
TCATCTGATAATGCCACTGAGGTCATTTTTTTGCTTTCTTTGTGGTTTTCTGTATTTAAT
TTTTTATAATGGCTAGGGCTTTTACATTTAAAAGTCATTCAAAAAAGTAATTGTGTCATT
AGATCATCAGTCTATCTCCTGTACCACCTTGCACATTTTAGGTATTCTGTCAATATTTGT
TGAATAAATGGAAAACAGAGTTCATATTGTGCTGCAGGGCCATATTGATTAGCATTTCCA
GTTTAATTGCTTTGTCTTTAGAGATAAGTTCTTTAACTTTGGTCTGGATGTTTCTGTATG
GCTCTGATTCAGATTCCTGCTTTGGGTTTTTCAGTTTCTAGAACTAATGCATTGGAAGTA
TCATGAGAAAGCTGCAGAAAAAGGCGTTTATATCATTGGAAGCAGTGGCTTTGACTCCAT
TCCAGCGGATCTGGGAGTAATTTATACCAGAAATAAAATGAACGGTAATTATTAATCCAT
AAACGGTAATTGAATTTAACAGTAGGAGGGCTTTGTGTTTGTATTGTGATGAACCTTAAA
TCTAGTTAGGAAAAGAAACATAATGATAAATGAGTAATACTAAAACATGTATTTTCTTCA
TAGTATAGCTATACTTGATAAAATGTTACTGACACTATTATTGAGGCATGGGTAGCTGGA
CAAGTGTTCTAAAATGAGAAATTATCCACTATTTCATTTTAGTTATGATTAGAGCTATAA
AATTACTGAAAAAAATTGGCAGCCATTTTAAATTCGAACTTGTTTAGGGATTCACATTTT
ATTTATTTATTTTTAAAGCATTTTTATTTTAAGATTTATTTATTTGTTTCTTTGAAAGGC
AAAGTGACCGAGAGAGAATGAGAGAGAGCAAAAGAGATCTCTTCCATCCATTAGTTCACA
AATGGCTGTGGCAGTTATGTTTGGGCTAGGCTGAAGCCAGGAGGCTGGAAAGCCATGCTG
GTCTCTCACAGGGGTAACAGCCCAAATACTTGAGCCAGCTTCCAGTGCCTTCCAGGTGCG
TTATCAGGAAGCTGGATGTATTTATTTGAGAGGCTGAGTTACAGAAAGGGAGAGAAAGAG
CGAGAGAGATTTTCCAACTGCCAGGGCTGGGGGAGAGAGAGAGAGAGAGAGAGAGAGAAA
GAGGTCTTTCAACTAAGCTTCATCTGGGTCTCCCACATGGATTCAGGGACCCAAGCACTT
GGGCCATCCTCTGCTTCTTTCCCTGGGGCATTAGCAAGGAGCTGGGTCAGAAGTGAAGTA
GCCAGGACTTAAACCAGTGCCCATATGGGATGCTGATGTCACAGGTGGCAGCTTAACCCG
TTATGCTGTAACACTGGCCCTAGTTTTTAATTTTGAACTGTAAAAGCTATAAAGTATTGA
ACACAGAATTTGGAATCTTTTTTTTATCCCACTTATAAAATAGAGATGGTTATTTAAGAA
TGGATAAAGTCAGGAATATTTTAACAATTCAATTTAAATATGTCATATATTTTATAAAGT
ATCCATTTAGAAGATGACCTGAAATGTAATTCCAGTGCCCTATAAATTGTTCTTGAGGTA
AAAAAGATGAAAGTGTTCCATTTTATATTAAAATTTAACTACGAGGGGCCAGCGTGGTAG
TGTTTGGGTAAAGCCACTGCCTGCAATGCTGGCATCCCTTATGTGTGCTGGTTCAAGTCC
CAGCTGCTCCACTTCCAGCCCAGATCTGCTATGGCCTGTGAAGGCAGCAGCAGATGGCCC
AAGTCTTTGGGCCCCTGTACCTGCTTGGGAGACCTGGAAGAAACTCCTGGCTCCTGGCTT
CGGATTGGCCCAACTCTGACTGTTGTGTCCATTTGGAGAGTTAACCAGCGGATAGAAGAC
TTTCTCTCTTTCTTTGCCTTTGCCTCTCTGTAACTCTGCCTTTCAAATAAATAAATAAAT
CTTTTAAAAAAATAATACAAAGTTACAATAACCACGATAGCATGGCACTTACATAAAACT
AGACCAATGGAAAAGAATGGATAATGTAGAAAAAAATACACATATTTGGGGCCAGTGCCG
TGGCACACTTGGTTAATCCTACGCCTGTGGCGCTGGCATCCCATATGGGCACCGGGTTCT
AGTCCCAGTTGCTCCTCCTCTGGTCCAGCTCTCTGCTGTGGCCCGGGAAGGCAGTGAAGG
ATGGCCCAGGTGCTTGGGTCCCTGCACCTGCGTGGGAGACCAGGAAGAAGCACCTGGCTC
CTGGCTTCAGATTGGCATAGCTCCAGCCCATGATGGCCATTTGGGGGGTGAACCAGTGGA
GGGAAGACCTTTCTCTCTGTTTCTCTCTCTCACTGTCTAACTCTGCCTGTCCAATAAATT
AAAAAAAAAAAATTGCACTTCCCTAGGACTACTTTTAAAAAATAAATAAATACCTAATAA
AAAAAATACACATATTTACAGTCAACTGATTTTCCACAAATGCGCAAGAACATACACTGG
AGAAAGTAAAACCTCTTCCGTGAATGTTGCTGGGGAGACTGCCTACCCATATGCCAAAGA
AAGAAACTAGACTCCTTTTACCACATACGAAAATCAACTCAAAACAGATTTAAGACCTCA
AATTACAAAACTACTAGAAGACAAGGGAAGACACTTCATTCTGGGCACGTATTTTGGAAA
TGACCCAAAAGTACACGGAAGAAAAGCAAAAAGTAACAAATGGAATTACATCAAACAACA
TAATGAAGAGACAGCTTACAGAATGGGAGAAAAGATTTGGCAAACTGTCCATTCAGCAAG
GGACTAAACTTTAGAATATAGAACAAACTCAAACTATTAAACAGCAACAAACAACAAATT
TCATTAACTGCAGCATTTTTCACAATACTAATCCTACTATTGGATGAATTGTTGAAAAGA
AATATGGTAGGGCCAGTGCTGTGGCATAGCAGGTCAAACTGCTATGTCGACCTGCAGTGC
CGGCATCCCATATGGGCCCTTTTTCGAGTCCCAGCTGCTCCACTTCCGATACAGGCTCTC
TGCTATGGCCTGGAAAAGCAGTAGAAGGTAGCCCAAGTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCTCAATACCCACGGCAGCCAGGGCTAGGGCAGGCTGAAGCC
ACGGTACCAGGTCTGGGTCTCTCATATGGGTAGCAGGAACCCAAGTGCATCACCAGGAGT
GGGGAACCTTTTTCCTGCCAAAGGCCATTTGGATATTTATAACATCATGTGAAGGCCATA
CAAAATTATCAACTTAAAGGTTAGTCTGCCATAGATTTATTGAATTTTGAGTCCTGCCTG
TGGTTGCCTTGATAGGGCCAGACCACGTAAGGCCTGTGGGCCAGGCATTCCCACCCTTGA
TCTTAAGCCACCTCCTGCTGCCTTCCAGAGCATGCATTAGCAGAAGTAGGATTCAGGAGT
GGAGGCAGGGCTCGAATCCAGTTACTCTGAGATGGGCTGTGGGCATCTCAAGCAATGTCT
TGGCTGTGTCTTTACTGTTGAGGTGAATTTCTTGTAGGCAACCCTCAGAATCGTCTGCAG
CGAGTTAGCTTTCATGATCGCTTCTCAGTTTCTCTGAGTGGTCTGACAGGCGCCGTCGTT
TCCTGCTGCACCATCTTTGCGGATGATGTGCTCGGCTGTTATTGCTCAGAAAGGCTTCAT
GTTTTAATTATCTCTTGGAATTCAAACTAGCAACAGTGTTAAGAAATGGAAATATTTCAT
TTGGTCAAATTTTGAGAATTAGCCTGTTATATTTTTCTTTTGCCTTACTGTTCTTGCAAA
GCTAAAATAATTAATCACTGTACCTATGCCTTAGTCATCATGGTTAATATAATTGATTGC
TCCTATTTTTTTATATAAGCCGTCGTGTCACAAAGGGTGTTTTTAATGGTTTTTCTGCAT
GTTCATTGTAAGCTATCATGTTATCGTGTTTGAAATCACAAGAATTCTCATATATCTGAT
TTTGAGAACTACATCCTGATGTGTGAGTTAAGTTGTTACCTTATTCAGGGTAATATGTTG
GCACTTAAAATACTAGAAAAGATTGTGTCAGTGCTAGCAGTTAGTTTATGCTAAACTCTT
CTTTCTGACAGTTTACCTGGCCTTAGCTGCTTCCACCTCCCCACCCCCCACCCCCTGTTT
TACTTATTTATTTGAGTAGTCAAGGGCTGCCGTATGCCGGTTCACTCTCCAAACACCCTC
AGTGGCTGGGAGCTGAGAACTCGGTCCAAATCCCTCACATGGGTGGTAGGAATGTGAACC
ATCACCAGTGCCTCCGCAGTCTGTTTTCCCAGAGAGCTGGAGTGAGGAGCCAGAGCCAGG
AGTCAACCCAGGGCTGTGCAGTGTAGGGTGCAGGTGTCTTAACTGGAGTCCTAACTCCTA
GGCTGAATAGTCACCGCTTTAGCTGCTTCTTAGGTCTGAATCAATAATATCACAAAACTG
TAACTGTTATCTCTATAGATTTTCCAACTGTATCAGCTGTAGGCTTAGTGAAAGTAGTCC
CTGAATGAATAGTAACAGTTCATTATTACTTATAACTAAATATTTTTATTTTATTCTACT
TTTACCCTTGTCCTACTCTTTTAGGTACTTTGACTGCTGTGGAAAGTTTCCTGACTATTC
ATTCAGGACCTGAGGTTAGTTTTTCTGTTTGTCAATTGTTTTTTCAAGTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTAATGAAAACATTTTGGAAATAGTGTCTCTTTAAAAAGACTTATAAGTTTTTTATG
TGTTTATAATTTTAGTGTGTGGATATTATTTAATTTTAAATCAAATTACTTTAGCCTAAA
ATTAATTTTTTAAGGGAAGATTTACTTTAACCTAAAATACAGTTTTGTTTTTTTTTTAAA
TGATGTATTTATTTGAAAGGCAGAGTGACAGAAACAGAGAGATCTTCCATCTGCTAGTGC
ACTTGCCAAATGCGTGAAACAGCTAGGTCTAGGCTACTCCAAAGCTGGGAGCCAGGAACT
CATCATGCATCCCGTATGGTGGCAGGGGCCCGAGTACATGGTCATCATCTGCTACATTCC
CAAGTGTGTTAGCAGGAAGCTGGATTGGAAGCAGAACAGCCAGGACTTGAACCCAGGCTT
CCAATACAGGATACCAGTGTTGCAAGTGGCAGCTTCACCCTCTGTGCCACAACTCCAGCA
CCTTCAAATATAATTTATTATTTTTAAATAACTGCACAATTCACTATATTAGAGTAATTT
ACCTTGATCCCAATACAAAAGCATCTGTGGTTGTTGAATAATAAATGTTGTGAGCCAGGA
AAGTGATCATCAAAGTACAAAAAGTGTGTTATTATTAAGTGCCCAACTTGGAGTTGGATA
CTGTTGTACTGTCGAAGAAATATATGAGGTAAATCTAGTCTTACTGTATTTATAGTCTAT
TTGGGAACATGAGATAGTTGCATTTCTGGGAAAGGACCATATTTAATTGTTTTTTAGTTT
TTAATCTATTTATTTGAAAGAGAGACAAAAAGAGAGAACTTCTGCTAGTTCACTCCCCAA
ATGCCCAAAATAACCAGAGTTGGGCCTGTCCAAAGCTGGGAGCCCAGATGTTCCATGTGG
GTGTGGCAGGAACCCAGGTACTTCAGCACCTGCACTGCCAGCATTCCATATGGGCACCGG
TTCGAGTCCTGGCTGCTCCACTTCTTATCCAGCTCTCTGCTTTGGCATGGGAAAGCAGCA
GGAGATGGCCCAAGTCCTTGGGCCCCTGCACCTGCATGGGAGACCCAGAAGAAGCTCCTG
GCTCCTGGCTTCGGATGGGTTCAGCTCCAGCCATTTTGGCCATCTGGGAAGTGAACCAGT
GGATAGAAGACTTCTCTCTCTCTCTCTCTTTCTGCCTCTGCCTCTCTGTAACTCTGCCTT
TCAAATAAATAAATCAATCTTAAAAAAAAAATAGAGATCAGGTGCAAGGAATACTGTAGG
ATTCTGACAGTGGAACAGAACATACATTTGGTTGGAAGGCCAGGCATCAAGAACTTTGTG
GAGCAACTGGTAGATGGACCAAATTTCAAGGGCTGGTGCTGTGGCAGTGTGAGCGAAGAG
GAAATGCAGATCGGGCATTCCTAACCTGAAAATATGAAACCTAAAACATTGTGAACACCT
TGTCAGCACTCAAAACATTTCAGATTTTGAAGCATTTTGGATTTTGTTTGTTCAGCCAAT
GAAACGTACACAGATATTCCAAAATCCAAAAATAGCCAAAATCTGGAATATTTATGATCC
TAGGCATTTCAATAAGGCAATTAAATCTGTACTGTAACAAAGACAGAAGGATGGGAGGGT
GTGGAATATGTTTGTAAGAGCAATGACTGGCCGGCGTCTCGGTTCAATGGGCTAATCCCC
CACCTAGCGGTGCCGGCACACCGGGTTCTAGTCCCGGTCGGGGCGCTGGATTCTGTCCCG
GTTGCCTCTCTTCCACGCCAGCTCTCTGCTGTGGCTCGGGAAGGCAGTGGAGGATGGCCC
AAGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAGAAGCACCTGGCTCCTGGGCCTCG
GATCAGCGCGGTGCGCTAGTTACAGCGCGCCAGCCATGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGAATACCAGAAAATAACCAAAAGAAGGCTTATTGCCAGTAATTTAAGAT
GGCTCAAGGAGGTCTTAAAGGACTGAAAAAGCAGTCACTTTTGGAAGGTCAGAGGCAGCA
GCAACCTCAGCAAAGATTCAGAAACAAGTATGAGAAAGATATGCTTGGAACTCAGGTCAA
CACCATTTAAACCTAAAAGGAATTATTTGATTTGTGTGACCAAATGTCTGCAAATAAAAA
GCATGGCTGGATCTAGACATTCCAATGAAAACTATCAGAACTCTGTTTTGTTTTTCTTTT
TTTTCCCCCCTTCTTGTGTTTTTTTTTTTTTTTTTTTTTTTTATGTTTTTCTATGTATAG
AAGCTCCACAGGGCAGGGAAAGCACTAGAAGCTCCAAGTCTATATTGCCTTAAGGTTTGT
GGTTCCTGACAAGAGCTACCAGGGTTTGCATATCAGTGATAGGGAAGGTCAGCCAATCAG
TGTGACCCAGGATAATGGACTAATCAGAATGCCCAGGTCTGGGTCATGGGCCTTGCAGGG
GGACCATTTGAACAACATGGTAAAAGTTCCAATAGTAAAGACTTTATCAGCATAATAGAG
GGTAAGGGGCTCTTGGGAATACACAGAAGACTGCCAGATAACTGACTGCCCACTCCCTGG
AGAAAGTGAGAAAATTGGTAGAGCTGGAGAGGCCTCCTTTGAGAGAGCAGCAGGAGATGC
TGTTGGAAAGAGGAAGTAGAACAGATGATGATCTCTTCCTTTTACTAGAAGTAGCAGAAG
AACCACAGAGGGGATGATTCCTGTAGATCCAAGTCGGGAGTCTAGATCAGAGTGGTCAAG
AGCGCAGGTTTGGGAACTGGATTCCCTGGCTCCGAGTGATGTTTCTGTGGGCCTGTTTAC
CTGTCCTCCGAGTGCCTCATTTCCTTCCAGTTGAAAAGGAGATCATAATTTGTGTCTACT
TCTTTTGGTGCTATTAGGATTAAATTAATCAATTAGTGTGAATCGGAACAGTACTTGGCA
GTTAGTAATTGCTCTGTAAACGTTAAGTATGATTATTAATAAGAGGACTCATTTCACTGC
AGCTCGCCTTGAAGCAAAATACAGAGCCGTAATTTCACAGAGGGGAGTCAGTGGAAATTT
GCTGTTGATTCTGGGGCATCCCTCGGCACTGGAGCACTCCTTATCATACTTTTTCCTTAA
GCTTATTTATTTTTACAGTGAAAAATTGAACATCGGCTATATGCTGGGCCCTAAAGCAAG
ACTCAGCGACTTTCAGAGGACTGAAATCATAAATTCTAGAGCAGCGCTGTCCAGTAGATC
TTCCCACAGTGATGGAAATGTTCCACAGATGCTATATGGTGGCTGCCATGTTGGATAGTG
TACCTGCAGAGCTACACTAGAGTTTTGAATCTCCCTAAATGACATCGTTTATTTAAACAA
GTTAAATAACAAGAAGGAAGGACATAATACAGTTATGCACATCACAGTATAAATGCGGGG
GGTGGGGTGGTTTGGCACAGCAGTTAAGACAGTTCTTGAGAAACCAGCATCTCATATCAG
AGTGCATCATTTCAACTCCTCACTCTGCTTCCAATCCAGTTTCCTGCTAATACACATCCT
GGAGGCACTAGGTGATGGCTCAAATGCTTGGGTCCGTGCCACCCAGACAGGAGACCCCAA
CTGAGTCCAGGATTTTGGCTCCTGACTTAGGCCTGGCCTAGCCTGAGCTGTTGTGGGCAT
TTGAATGGGAGATCTTTATCTCTCTGCCTGTCTAATTAATTAAATAAATACATAAATAAT
TTCTTAAAAATTAGTCCAAGAAAATAAAAGGGCCACTTAGCAGTTGGGTAGAGAAAGGCC
AGCACTGTGGGGTTATATCCTCTTCTGTGGTCTCCTTTCTGCCACTCATTTCCTAGTGGA
GTCAGAGGTAATAGATGGGGAAGGTGCCAGTCATTGTGCTAGAACCAAGGGAAGGTTCTA
AGAACTAAGAGTCTCAGGAAAGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCTGCTTCGGGAAATGGATGGTATAAAAGATAGCTAAAA
CATAGCTATGCTGAATTTGTTATGTGTCCATGGTGGGAAGACTACTACACTGTTCCATCT
GTCGCTTGTTGGGATCTAAATGTAGAGTAAAAAGAAGAATCACTGGAATACATTTTAATT
AAAAGTAGATCTGCCGTCTTCTTTGTTATGAATTGCTTCAAGAAAAGTTACTAATTTTTA
TCAAAAGACTTACCAGCTGAAGTTGTAGTCACTGTAGCTGGAGAAAATGCAGAATACTCA
CAGGTCTGTTTTGCAGGTGGCCAGTTTCTTACTGTAGGGAACTCAGCACATATTCCATTC
CTTTCTTCGGATCTGATATGTCTGTTGTGAGGCGGACTCAGCGTTACCTGCATGAAATTT
TAGAAGAATCACCAGTAAGTAAATACAGCTTATGTATTAATAAAGCGCATTCTGTGTTTG
TAACAGTTCCCCTTTCAATTAATGTAGGACTTTTATGCTTATAAAGCAAAAAAAGAGTTA
ATTAATGCATATTTCCGCTTCTGGAAATAGAATAGGTATGGTTGAGCATTTTGCATTTTT
GGGGGGGCTGGTAATAGCTTTATCTCATGATTCAAATCTGGCCCACCAAATTGTGTGGGT
TTTTTTTGTTTTTGTTTTTGTTTTTTTTTTTTTGACAGGCAGAGTGGACAGAGAGAGAGA
CAGAGAGAAAGGTCTTCCTTTGCCGTTGGTTCACCCTCCAATGGCCGCCGCGGCCGGCGC
GCTGCGGCCGGCGCACCGCGCTGATCTGATGGCAGGAGCCAGGTGCTTCTCCTGGTCTCC
CATGGGGTGCAGGGCCCAAGCACTTGGGCCATCCTCCACTGCACTCCCTGGCCACAGCAG
AGAGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCTGGTGCCCCAACCGGGACGAGAA
CCCAGTGTGCCGGCGCCGCAAGGCAGAGGATTAGCCTAGTGAGCTGCGGTGCCGGCTTGA
ATTGTTTTTAATGTGACACAGTGGCAGTGAATTGAATACGGGAAATGCTAGTGTCATAAA
CACCGGCGATCCCTGTGTTGAATGTTTCAGCTGCTAGTACACCCATTTCTGCTGCTCATG
GAGGTGTCTGGGACACTGTGTCCTCTGCTTGCTTCTTCTGGAGTGCCATCCTCCTCTTCC
CCATGGGGGAAATCACTGCTCCCACTGCTGAGGCCTCAGCCAGAACTGATCACAGGTGTC
GAAGTGGAGACATTTTCTCACAGGAGGTTGGAAATGGAATCCACATTTTGTAAGGTGTTG
GTACTGAAGTCAGATATGCTAGGGATTGTGAGGACTTTTGTGTTCCAGTGTGGGAAGCTA
TCATTTGCAACAATTTCTTTAAAAAAATAGTTCATCCCTGTCTGGTTTCTGAGAGCAGTT
GTAAACAGCCAGCACGCTTGTGTTACTTGGTCTGAAATGCAGAGAGTAACGTTTTGATAT
TCTCACCCAGGTCCAGTATGCTGCTTATGTAACTGTGGGTGGCATCTCCTCTGTTATTAA
GCTGATGTTTGCAGGGCTCTTCTTTTTATTCTTTGTGAGGTTTGGCATTGGAAGGCAACT
TCATCAGTAAAAGTAAGTGAGGTTTTTTGAAATCAGATCTTTAGATGTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAGTCCTCTCTTTGGTCCAC
TCTTCTGCAGAGGCTGGGTACGTGTACTACTCCCATAGCCATGGTCCAGGCAGCCGTGAC
TCTCCTGCATGAGTCCTCTAATCTTCCAAAGGCGTAAGTTTGGTTTTCTTCTAATTAGAA
GATACCTTCTCCATTTGTGTTATAGGGTAGCTTATTTTTATTTTTCAGGCTTTGGGTCTG
CACATAGCTCTGAGAGTTCCTTTAATCCTGAGATATAGTACATTAAAATTGTGAGAAGGC
CGTTTCTCACCATTGTTCCTTTCCAGCCTCTGGAAACAACTGCAGAGGTAAATGAGAGGA
GACAGAAAAGTGTAAGAGCCACCAAAGTCAGCTTTAGTCCCTTGTAAGAACAGCTCAAGT
CCAGAGTCAGCCGTTCAGAGAAGATCCCTGCTGTTTCATAGTTCTGGCAGGGGCCTCTAA
TCAGTGCTGAACGATACCCAGTTAGCCGTGGGAGCCCTGGCTCACACCAGACGTGGGTTG
GATCATGGGGCCCTGGCTAGATGGCTATCACATATGCTATCTTGCTGGAGCGTTCAGCTG
TTACGCTAAGGCTAGGCCAGCTTTCACCAGGAACTGAACCATATACACAGGATTGACTGT
GCACTAGTTTCTTCTAAATAGGAGCTACTTGCTGATAGTAGCCATGATAGAATGAAACCT
TAAGTTCTCCAGAGTTCTGCAGGGATTTGTTAGCTAGTCCTGCAGAGGAGAGGGCTTGAG
AGCAACTGTGTGCCCTGTTTCTTCTTGTTACTGTTTTTCAGGGGCGGGGTCTTCACACCT
GGAGCAGCTTTTTCCAGAACAAAATTGATTGATAGACTCAACCAACGTGGCATTGAATTT
AGTGTCATTAGCAGCTCTGAAGTCTAAGTATTTGAAGAATTAACTGAAGTCATAAGATGC
ATGGATTAACAGCTTCTTTATTTGATACTTAAAATTCTATAAACCTATCTGATGATATGT
GGAAAAGATTGTCAAGTCCAAAATATCTACACATTAAAAGTAGGAAATTATACTAACTTA
ACCTACATTTCAAATCTCAGCTGACTTTTTTATTTTGTTGCTTGTGAGAGAAAACTAATA
TTTGACTGACTTTTTCATTGAAGCGTTCCTGGTAAATTTTTATGAATGAGCTGGCTGGTC
AGATGGTGGCAGAGGTGTCCCTGTCTGTGTCGATACAGCACTCCTCAGCAAGGGTGCTCG
GACTGGTGTTCATTTAGGGCAGTAACTGCTGCCTTCCTTCCATAGTAGTGAATGGAATCT
CGTCTTCCAATGAGTTTCTCTACATACTGCGTGGCTTTTGCTAAATGAAACTGCACTTTT
TCCTATTTTAGCCTAGTTTTTCATCCATCTACACTGATTTTGGTGTGTTCCCTCTGTTGA
ATAATAAAGGGTTGAAGTTGAACGGTGGTTTTGTGTTTGGATGTGTGTGTCTGTGGTGGG
AGAAGCGTGCTGCTTACGCGCTCTGACGCGTCACTGCCAGCCGTGGGGCTCCTCCTTCCC
CTCTCCCCGGTCTGTGCCCGTGAGTAGTTCAGGATATACCTGGTAAGTGCCTCTGGATTT
TCTCTGCCTTAGGAGAATTTTCTCTCATTTACTTGTTGTATGTTAACTGTTTCCCACTGG
AGTCCTAAAATAAGGTGAAAGACTTTTCCTTTTGTAAAAGGCACGTGGGAAACTCATACA
CGGTGTCTGTGCTGTTCATTATGTAAAAAGATACCCTATGTAGAATTCCTGTTCTATAAT
GTTTCTATTCTATAGGTTCTCTTCTAAAGTGAGTAGGGGAGTGAGTACTTGTGTCGGGAC
ACCCTGCCGTGCTGTGCTCAACAGAGGATGGCTCGTGTCTCACTGGGAGAGGGAGATTCT
TGTATTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1190, 2411..2523, 3306..3386, 7714..7843, 12024..12073, 19218..19348, 20536..20653, 21730..21841, 21843..21845, 21847..21851, 21988..22044, 22145..22256, 22390..22403, 22405..22472, 23141..23246
1001..1190, 2411..2523, 3306..3386, 7714..7843, 12024..12073, 19218..19348, 20536..20653, 21730..21841, 21843..21845, 21847..21851, 21988..22044, 22145..22256, 22390..22403, 22405..22472, 23141..23243
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved