Oryctolagus_cuniculus Locus BTN1A1
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus BTN1A1
Oryctolagus_cuniculus
BTN1A1
GeneScaffold_1779
SNORA20
2391..2523
7536
GTGTAACTCTGTCTTTCAAATAAAAATAAGTAAATCTTAAAAATATATATATATAAAAA
GATAGAAAGAACTGAGGCTTGGAGAGATGAATTAACTGCCTGCAGGCCTCACAGCTCATT
TGAGAATTTCTGTCAATCCCCACCGCAGCCCACCCCCTTTTCTTCTCAATCCTTTTTATT
TAGTCCAGCTTCCTGATCCATTCCCATCTCTCTGGAAAATGTTTCTTCTTCTTTTTTTTT
TTTTTTTTTTCCCAAAGCAGATGTACCGGGCCACCTGGGGGCAGGCCTTCCTGAGAGCAC
GTCCCCTTCCTTCTCTTGCCAGCTTTTTTAACTTTTGCCCAGAGGCCCTAAGCAGTTTCG
CACTTGGAAGCTGTGGTTCCTGGAGCCTTTTCCTCCAAGATCATCCAGGTCAGTGAGTGC
CCCTGGGAGGGTGGGCAGCCAGCAGAGCACAGTTCTAGCCCCCAACTCCTTCCTCCTGCG
CCCTAGGCCCCCTTATTGTTCTTCAGCCACCCCTCCCCATCTCCTCCCATCTTTCTCGCT
TTTCATTTCCTCGGTCCTCATTTTTGTCTCCATGCCTTCATCTTTATTATCCTTGCTAAA
GGCAAATGCCAAATTATTGTATTTGGAAGGAAGCTTTTTAGCGTAGTGAATTCCAAGATT
TGTTCATTTAAATGCAAGCCACTAATGGGTACAACGCCCCTCTTCTCTGACTTCTCCTTT
GGGTTTTCAGGGTCTGGTTCATTGTCTTATACCTGCCGGTCTAAACGTAGGGAGGTGTTC
AGGTGCTGACGACAGTAAGATGGAAATCCCCACCTGGGAGAAGGTAAAGAGCTGCAGATG
CAAATGGCCAGAGCTCTCCAGGTTGGAAGGAACTGTAGGGAGATGCAGGCAGAGCAGGCG
GTCTGCAGAACTCCTCAGTTACTCGCCTGTGCATGCCTGTCCTAGGCTGAAGCTTCTTCA
GGGACTCATTCCTGTGTGTTGCTGTCCCAGGAAGGAGGGAGATGGCCGTTTCCCCAAGCG
CCCTCCCCAGGTGTCTGCTCACCCTCATCCTCCTGCAGCTGCCCCCCCTGGATTCAAGTA
AGTCTCCCCCATAAGGGATCCTGCCCAGTTCTCCCTAGTGACTCCCTCCGGAATCCACAT
GGCGTCTCCCCAGGCTGTCAAAGGAGTGGGAGACAGGATGGGAACCCGGCCTGTGTCAGC
CTCCAGCTCTCACCCGCACGTCCTGACTGCACGGGTTCTGTTGTTGTTTGCTTTCATTGT
TTTGGGCAGCCCCCTTTGAAGTTCTCAGACCCCCGGAGCCCATCCTAGCCGTCGTGGGAG
GAGACGCTGAGCTGCCCTGTCACCTGCCAGTGAACGCGAGCGCCCAGCGCACGGAGCTGC
GGTGGTTCCGACACACCTTCTCGCCGGCCGTGCTGGTGCTCCTGGCGGGGCGCGAGCAGG
AGGATGAACAGATGCTCGAGTACTCGCGGGAGGGCCTCTCTGGTGCTGGCGGTGCTCGCC
TGGCGGGCGCGCAGCCTTGCGGATCCGTGCCGTCAGGGCCTCCGACGACGGCGAGTACAG
GTGCATCTTTCAGGAAGGACAGCAGCTACTCAGAGGCTGCTGTGAGCCTGAATGGTGGCC
CGGTAAGTGGACAGAGGACTTCGGTCTTTCTCTGGGACCCAGGCTGTGAGTATATCCCTG
TGGCTTCGTCACTTTTAGAACTACCGGATCCATTCCCCAATCCCTTTTGGGTCGGAGAGG
TTGGCAGGCCTTCCTTAGAGCAGCGGGCAGGGGGTGAGGGCGCCGCACAGGCCTTTGCTG
TAAGGGTTTCCTGCAGTGATCTCCCCATCTCCCCCACTACTAGCCTGGGAAAACAGTTAC
ATAATGCTAAACTGTGGCTGTGCGATGCTCTTTCACAGTAGTACACCTTGTCTGCTTGAT
CAGGTCCTAGAGCCGAATAGTTAGGATGTGTCCATTTTCCACCAGCACAAAAGGCTGCAG
CAAGCGTGCAACGAACTGAAGCTCCTTTAGGGTTCAGTCTCTAAGAGCTGATTTCCTAAG
ATCATGGAGCTAATATTCTCGATCTGCCCAGAAAAGATTTTTTTTAATTACTTTTTTTGC
TTCAAGCCAAAATTCAGATTGAAATGATAAAGAAAATGGTTAGCGTTCAGGAAGAAAAAT
GGGCACTGAGCCCTGCCGTTCCCACTCAAGATCAAGCAGATCTCCTCTGGTTGCCTTTCC
TACTGTAAGACTGGGAAAGCATTATCCAGCAAGGTTAAGTAATTAGGTTAAAAAATGGTA
AGAGCAGTATATGGGAAACCACGTTGTCACTGGAAAAGCACTGTATACTTACACTATTTC
TATGACTTAGACCAATCTCAAATGCATAATATACAAGTGTATTCCTTATATATATTCAAA
TAAAGACAGTTTGAAAAACACTTGCCAATGCTTTGAGCAGTTATACACATGGGATAAAAT
AATATTGGGCCATTGTAAATGGAGATGAAATGAGTGTCATCTCTCCTACGCAGTCTAGAC
ATTGTGTGGGGGAAAAAAAAAAACCACTTGCATGATATTTGGGGTCCCCACTTCATAACA
AAGTGCCCCCTGTGCAGCATCATATAGAACTCATATTTCATTTCTATGAAAGATACCTTA
AAGGTATAAAAACCTAGAGATTTGATAGCATAAAACTGTTGTTGCCTTTTGTAAGTAACA
GATGCCTTTTATAAATGGCAGACACCTTTGAGATCTGATGAAAGTGGCAGCCCTTTTTAT
GAAAAGAATATTCATTCTCACATATGCAAACCTAGAATATGGATTTGAACCATGGCTGTA
GACATGTTTAAGAACTCTGACGCTCGGTGTTTTTCTGAGGTTGAACAGACTGGAAAGGCA
GCACTGTGTTGCTCTGTGTTAGGGCATGATGATATAAAGGAAGGTGAGGTTGAAAACATT
AAGAAAATTTCTGAATCAGCATCACAGTTAAAGGGAACTTAAATTGTGGACTGCAGTCTC
AGGGGAAACACCTCCACCTCCCCATCTCCTCAGTGATACTCCTTCTCTGTTCATCTTCGA
ATACCCAACGCTAGTTCTTCTCCAAAGCCTTTTCATAACTCCCAACAACTGAGCTCTCTC
CCAGTTCTGGAGCCCCAGCCTCGACTACTAACCTGCCTGTAAGCCATTGGTCTTCCTGTT
CCAGCTGGCTAAACAGTCATCCCCATGCCTGCCTATCACATTTCTGCCTAAATTTCAAAG
GTTGCATCCCAGGAAGGTATGCCTCTCTGCTAAGGTAGATGAAATTCCTTGTACTGATGC
CTCATTTCCTTGAGTGACAAATTATGGACTTGAGTCCCTCCCACTCCCAGTCTACTTGAC
CCCTCTCTCAAACTCTGTAGCCCTATGGTTTTAAGACTCCCAGAAGGGCATCCACTAAAA
TATTAAGGCCAGCTTCTCTCCCTACAGCGCTGGGCTCTGATCCCCACATCCACATGGAAG
TTCAAGAGAACGGGGAGATCCGACTGGAGTGCACCTCAGTAGGATGGTACCCAGAGCCGC
GGGTGCAGTGGAGAACTTCCCGGGGAGAGAAGCTTGCATCCACGTCCGAGTCCAGGAGTG
CTGATGAAGAAGGCCTGTTCACTGTGGCTACTTCAGTGGTCATCAGAGACACCTCCCTGG
GGAACATGTCTTGCTGCATCCAGAATCTCCTGCTTGGCCAGGAGAAGGAAGCAGGGGTTT
CGATACTAGGTCAGCAGGATCACTTCTGGTTCCTGTGCTCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTTTTTAGATTTATTATATTTATTTGAAGGCAGAGTAGGAGAGAGAGAGAA
GGAGAGACAGAAAGATCTTCTATCTGCTGGTTCACTCCACAGATGGCTACAATGGCCAGT
GCTGGGCCAGGCCATAATTCAGGAGCCCGGGGATTCTTTCGGGTGTCCCACGTGAATGCA
GAGTCCCAATCACTTGGGCTATCCTCTGTTGCTTCCACAGATGCATTAGCAGGGAGCTGG
ATCAGATGTAGAGCATTTGGGACTCAACCCAGAACCCATATGGGATACCAGCACAGCAGG
TGGTGGATTAACCTGCTACACCACAACACCAGACCATAGGTTTTCCATTTTAGGAGAATC
AAAGATAGAGAAGCTTCACCCCTTGGGATATTCCTGGCCAAGAATCTTCTCTCCTTAAAT
AAACAAGAAGACAAAGTTCTTTATTTTAGTTTCACTACCTTCACTCCTATCCCCTTCCAA
TCCTCATCCCATGCTAGAGTACAGTCTAGCTTCCCAGGGTCCTCAAGAACACAAATCCTC
TCATTATTTCCCAGAAGCTACCTATGGTTCAGGCAGGAACCTTTCCTGATTATTTTGTCA
ATGAATCCCATTCTGTTGCACACAGAAGTGACATTTCCTGTTCCTTATTTGCCCCCTGTA
TCTTTTTAGCTCCCATTTTGCATTGATAAGGTCAGATTTCTGTAGTGACATGAATCGGCC
CATTATTGCCTTTGTTTCACAAGGGGACAGTCCCCCAAAGGGACTCTCCATTCCTCTTTA
TCTGTCAACTCCTGCTCAAATTTTTCTGCTTACAGTGACACTGAGAGATGGCATGGGTAG
ACTTGCTCAGACTTTCTCAACAGTGTTCCTCTTGGGCATTCTGTTCTAGCTCCCTTCTTC
CCAAGACTGCCTCCCTGGATTGTGGCTGTTGCTGTCATTCTGATACTTCTAGGACTTCTC
ACCATTGGGTCCATATTTTTCATCTGGAGACTATACAAGGAAAGAGCCAAAGAGAGGAAG
CATGCATTCAGCTCTAAAGGTAAGTCACAGAATCCACAAGGCTACCTCTCAGGAGTGCTT
CAGAGGACAAGTGGGTCCTGGTCTTCCAGAATGGCTTCTGACAGGAAGATATTTGACTGC
AGAGCTCTGCAAGTCGGGCGGGATTATAAGGCCTCTGAAATCACAGATGGCCAACATGAA
GAACAGAGGCTTGGGCAGAGTCAAAACCAGTTCTGATTGAGAAATTAGACCTGAGGCCTA
CTTACAACCCACCCCCAGGCCCAACCCCTCACCTCAAACTCCATTTCCGAGTAAGGATCT
TACTATTAAGGATCTGATCCCAAGCCAGTAATAACTTTCTGCATATTTCCTAGAAAATAA
AACAAAACAATCCTTGTTTTTGATTTCTTGATAATGTTTCAGTAGTGAGGTGACCATGAA
GTAAACAGTGTCGCCTTTGTTGTGTCTTCCACACCAGTTCTGTCCATTGAGTTATTTCTG
TTTGTTTTCCAGAGAAACTCCTGGAGGAACTCAGTAAGTTCAGTCTTGTTGTTATCTCAT
GCACAGGGTTTTCTCTGTCTTATTAGGTAATCTGTCAGTGACAACCTCTCTTTTTCATTG
CAGAATGGAAAAAGGCCACCTTGCACGCAGGTCAGTGGCTCATGGCCCAGGAATTCCATC
TACAACATTGAATATGAAAATACCAGCACACTCTAGTGAGAAGAGAAAGGGGAGAGGCAG
TGCACAGGAACTCCACACTCTCCTGGAGACACAGAGGCCCCTTGCTGATGGCCCAGGGAC
AAACACCCTCTGACAGAGTCCCATTAGGGACAGTCAGCCCTTACATCACATGTAGCTACC
CAGGAGGGAGGGGCCCATGGGGATGGAGACCCCTGAGCAGCCCAGCTCCCACCTCTTCAC
CCGTGGTCAGCCCTGCTCTCCCTCTTTCTCTCTCTCTCTCCAGTTGATGTGACTCTGGAC
CCAGACACAGCCCACCCGCACCTCTTCCTATATGAAGATTCAAAATCTGTTTGCCTGGAA
GATTCCCGTCAGAAACTGCCTGAGAAACCAGAGAGATTTGACTCCTGGCCCTGTGTGCTG
GGCCGTGAGACCTTGACCTTGGGCAGGCATTACTGGGAGGTGGAGGTGGGAGACAGGACT
GACTGGGCCATTGGCGTGTGCAGGGAGAACGTGGTCAAGAAAGGATTCGACCCCCTGACT
CCTGAGAATGGCTTCTGGGCTGTGGAGCTCTATGGAAATGGCTACTGGGCCCTCACGCCG
CTGCGGACTCCTCTCCCGTTGGCAGGACCCCCCCGCAGGGTTGGGATTTTCCTGGACTGT
GACGCAGGAGACGTCTCCTTCTACAACATGACCGATGGATCCCATATCTATTCTTTCTCC
AACATCTCTTTCTCGGGCCCTCTCCGGCCCTTCTTTTGCCTGTGGTCCTGCGGGAAGAAG
CCTCTGACCATCTGCCCAACTGCTGGCGGGCCTGAGGGGGTCACAGTAGCTGCTGATGCC
CAGGGCCTCTCTAAGGACATCCCATTGTCCCCTATGGGGGAGTATGCTGCCTCTGGGGAC
ACAGACACTCTCCATTCTAAATTAATCCCTACCCAACCAGGCCAAGGGACACCTTAAGGA
ATGTCCCAGTGCAGCTCTCTTCGCTCTAACCTTCTCCTCCATCACCCTGGGGCTTCAGCT
GCCAGTGCCAGCCAGCCTTCGTGCTTCCTGTTGGGCAGCAATTAACTTGTCTTGGGAAGG
TTACGCTGCTGCTGCTACAGAGTGGGGAGAAGGACCTTCCTAACCTGTTTCCATACCGAT
TTTCGAGAGATGGAGGGGTGACTCTTACACTGCTCTTAGTATTTTCTTATCCCATAAAAT
TAGAAACTGCAGGGGAGGGCTTGAGGCAAACGCAAAGGATAGCTCTGGGATCAAAATGGG
CCCAGGCTGGCATGGAGTTGTGGCAGAAGTGTCTTGGTATCCAGAACAGGGGCATGTGGA
GGAATGGGTTTTAGGCAAATCCACAGGGTACCAGGAAGGATGATTTCAGGCTGAAATTCC
TTATGGGAGTTTGGAGGGGACATCATGATGGAGTAAAGTGACGTGAACCCCTTGGCCTGC
CCCTAGGGTTTTTAGGCCTATATCTCAAATTTTCTAAGACATGTCCTAGAAGACAGAGGA
AGCTGGTCCTACTTCTATGGGAGCTGAGCCAGGGAGTAGAAGAGCTTCACGGGGTTGCAC
AGAAAGTGTGACAGAGGAGATAATTCTGGACAAAAGGCAAAGCGATCTGCACAGCCTTGC
CTTGGGCTTGTCCCTCTCTCTGTACCCTGTGCCCCAGCTTTCCCTCCCTTGCCTGCGGGT
CAGTCTAACCTCGCTTTGTTGACTCCACGAGTTCCATTTCACGTCAAAGATATGTCCAGG
AACCATCCTCCAGTGATAGCAACACTTCATCAGCCACAGTCTCAGCCTCAGGCCCCTCAG
CCCTCACCCCCTTGTGCAAACCCTCCCCCACCTTCAGGCACCTTCCAGGGCCATGCATTC
CCACAATGTGCGGCTGCCCCCCCAGCTCTGTGTCACTGTGCTCAGTCCCTACATTGATTA
CCTCGGTTTGGATTTGCCCCGGAGCGTTTTCCTGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 1269..1462, 1464..1502, 1504..1563, 1565..1611, 1613..1617, 1619..1621, 3447..3728, 4789..4938, 5412..5432, 5523..5549, 5863..6536
1001..1076, 1269..1462, 1464..1502, 1504..1563, 1565..1611, 1613..1617, 1619..1621, 3447..3728, 4789..4938, 5412..5432, 5523..5549, 5863..6533
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved