Oryctolagus_cuniculus Locus ENSOCUG00000005442
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000005442
Oryctolagus_cuniculus
ENSOCUG00000005442
GeneScaffold_5031
SNORA3, SNORA3
1997..2126, 2975..3104
4335
GGACTTAAAAGGAGGATGTGGGGGCCATCACTGTGGCAAGGCAGGTTAAGTTCCTGGCT
TCCAGCTTTGATCTGTCTGGACCTGATGTCGTGACCGTTTGGGGAGTCAATCAGTGGATG
GAAAATCTGTCTCCCTGTCACTCAGCCTTTCACATAAATAATAAACCAATCAACATTTTC
TTTCAACAATTATTTAAGAGGAACTCCAGCCCACAGCAACCCCGGAGCGCTCAAGGAATG
TGATCTGGTAAGGAAGACCAGTGTAGCTCCCTAAGGATCTAAGAGCTGCGTATTAAGCGG
CTTAGTGAGAAACCAAGGCCGAAGGATCAGAGAAGTTTCAGGGAAGATGCCTGCATCGGG
CCTGGGTTGGGCAGTGGCTCTCTGTACAGAGGAGGGGGTCACAGCACGTCAAGTCGGGTT
GGGAGAAAACGTAACATGGCTTAAAAAGTACTGAGACGGGGCCCCTGAAGCACAGCACAC
TGTTTCAACTACAAGGAGAGCGCATGGCCAAAGGAGAAAGGGGTGTGCGCGAGGGCGTCC
CCGAGGCGGCAGAGGCAGAGTGTCTCGCGCCTCCTCACCATGGCCCCGAGACAACCAACC
AATGTTACCAGGCCCGAACAGAACACTAAGAGCAGGGGAGACAGGAGGGACCGCTCCACG
CAGAGGCATCTGGTGAGGAGCGGAGGCACACGGAGGCCCTCCGGCTCTGCCCAGGCGGCT
CCTGGGCCAAGGTGGCTCCCGGGCCACTTAGGTCGCGGTGGCGTGCGCCAAGGCGCCCCG
ACGCCCCACATTTTCAACAGCTCTCACCCGAGAGCCTGGTACAACCAGCAGCACAAAGGA
AAGCAGGAAGAGGAAGCAGTCACCCGCCCGCGAAACCCGCGAGACCGAAAAGGCCCCGCC
CCGCCCCCTCCCTGGCCGGACGTGAGGCGCTTGGCCCCGCCCCGTGCTCGTTACCTCGCG
AGATTTCGCGCAGGCCTCCCTCTTTCGTCTCGGCAGCCGACATGGTAGGTGGGCCCTTTC
TTGCCTCCGCTTCCTTGCCGGCCGGGGTTTCGCGCTCTTCTCCCATCGCTCCGCGGCCAC
CTACTCCGGACGTTGGCCAAGTTCTCCTGGCTGCGTATGGTCGGCCGGAGAGCAGGATGG
CGGGCGTGAGCCTGAGGCGGAGCTGGGAGCCTGGGGCCGCGTGTCCGGCCAGGGGCTCGA
GTCTCGAGCTGCTGCACGCGGGCCGGGGTGCGGCCCCGGGCGAGACTGCAACTTCAGCTT
TGCCGAACTTGCTAGAGAGCAGGCCCTTGTCCCCCCAGGCCTGCCGCCCTCTCAGGGTGC
CAGGCATTGGCCCCCGCTCTCTTTCCTTCGGCCTTACCACCGGGATCTTTTTCCCACACA
GCCATCCAGACTGAGGAAGACCCGGAAACTGCGCGGCCACGTGAGCCACGGCCACGGCCG
CATCGGTAAGTACCGGCTTCCCCTGCTGATCGGCCTCGGCGCGCGCTTTTCGAGTGGGAT
AGGTAGCTTTAGAAGTCGAGTTGTACGGACCAGCCGGGCTCCCTTCCCCCAAGGTCTCCT
AGTAATCCGGTTTTAGAGAATTTAGTACCGGTAAGGACTAGGAATGAGCGGGGCGCAGTC
CGGAGTCAGTTGCAGACGTGGACTGTTGGGGGAGTGCTGTGGTTGGGACGCAGTCCTGAA
GGAGCAACAAAGAGGGCCTGTGGGCTGGGAGCAGCGGCGTGGAGTGTGGGGAAATGTTCT
GTGTCTGCGGGTCTGGGGGAGGCTGGGTTGGCCATGTAGGTAGCTTTGTGCTTTTGCAGG
CAAGCACCGGAAGCACCCAGGAGGCCGAGGTAATGCGGGTGGCATGCATCACCACAGGAT
CAACTTTGATAAATAGTAAGTGTTCATAGGCCGTGCTTTCCCTGACTCGGAAGTGTCGGG
CCGGGCGGGACTGGCAGTAAGGAAGCAGGCATCCATAGCTCACAAACCGAGGTAGCTGGG
GAAAGCGAGAACCGGTCATCGAGGCTAGAGTCACGCTTGGGTATTGGCTGTTGCCTTAGT
GTGCTAGAGTCCTCGAAGAGTAACTGCTGACCTTATTCACTGGCTGTGGGCCTCATGGCA
CAGTCAGTCACCAGGTTAGTGACATACTTCAGATCGACCTCTGCAACTGTTAGGTCCCCT
TGTGCTTAGTGTTTTCACATTCTCCCGTGGAACGCTGTTGTGGGCCTCAGTGACTTTGTG
CTCCATGAAAATAAGGCTAGCCTTTTCCACTTGATATTTAATTCAGCAACTGTATAAACT
GTATAAAGCCAGTCACTCCACCAGTGAACAGTTTGACACTGTAGTGGGGGAAGGTAAGAA
AGATGATCCAGATTAACTTCTTACCTGCAGCGCACTTATAAAGGTGGTGCTTTCTCTTCC
TAGTCACCCAGGTTACTTCGGGAAAGTTGGCATGAGGCATTACCACTTAAAGAGGAACCA
GAGCTTCTGCCCAACTGTCAACCTTGATAAGCTGTGGACATTGGTCAGTGAGCAGACACG
GGTAAATGCTGCCAAGAACAAGACTGGAGCTGCTCCTATCATTGATGTGGTGCGGTCGGT
GAGTGAATTGGATCCTTCTTACTGCTCGTTTGTAGTTCTACCTCCCATGCACAAGGCACT
CTGGCTTAATCTTACTAGGTCTCCCACCTGAAAATCTAAACCTATACTTAATTTCCAGTT
ACCTACTAGATAATTCAACCTTCTGGTGGAACTGCCATGGTTAATTATGACCAAATGGAA
GGCCCAGCTATATTAGTTAAGACCTCCCCAAACAGGCACTGGTGTGCCATTGGGGAGCTG
TGGTCCTTGTAAGTAGGGAGGCAGAGGCTGAGTGTCTTCACAGCCTCTACTGTCTGTTGA
GCAACTTTGGTGGTCAAGACTTGGAACATATTCGGAATGTGATTTTGTTTCTGTTTATTG
GTAATAATTGGCCAGCAAAGGGAGGTTTGTGCCTTGCCGAGACTAGAGTCACATCCCGAC
ACAACCCTTGTCGTGGTGTGCTAGCGTCCTCGGAGAGAATCTGCTGGTCTTGATTCACTG
GTGGGGCAGCCAGTGCCCGCGTTAGTGCCCAGATCAGAAACATGCCTCCCTGGTCCTGGG
AAGGGTGGGTTCAGGGGCATCTTACTTGAGCGCATCAGGAGTTGGCGCCCGCTTTGCAAT
ACTCTAAACCTTCTTCTCTTCCTGCAGGGCTATTACAAAGTTCTGGGAAAGGGAAAGCTC
CCAAAGCAGCCTGTCATCGTGAAGGCCAAATTCTTCAGCAGAAGAGCTGAGGAGAAGATT
AAGGGCGTGGGGGGAGCCTGTGTCCTGGTGGCTTGAAGCCACGGTTCATTAAATGCTAGC
AAATGCTTTTCCCTGGTGGTCTGAATGTAGGTTCTTTGACTTCACATCCCTGTCCCTGCC
GGAACCCACCTTACAGCATCCAGGCATTCGAGGTATGCAGAGCCTGGGTTACTGCTAACC
CACCTCAGTGCTACCAACAGCACTTACAGGCACTGTGGTTAAACTTTTTCATTTGTGAAG
TGAAACTGATAATCTACCCTAATTGAAAAGCATTGTGACTCAGTTTCAAGGGTTACTTAG
GAGAGGGAGAGGTATCTTCCCTTTTTTTTTTTGAAAGATTTATTTGAAAGTCAAGAGTTA
CACACAGAAAGAGGAGAGGCAGAGAAAGAGAAGTCTTCCATTGGCTGGTTCACTCCTCAA
ATGGCTGCAGCGGCTGGAGCTGTGACGATCCGAAGCCAGGGTCTCCCACGCGGACGCAGG
GGCCCAAGGACGTGGGCCATCCCTACTGCTTTCCCAGGGCATAGCAGAGAGCTGGCACAG
AGCAGGAGCAGCCAGGACTCCAACTGGCGCCCATATGGGATGCCATTGCTTCAGGCCAGG
GCGTTAACCCACAGTGCTGGCCCCAAGGTATCTTCCCATTCACTGGGTCACTCCCAAATG
GTTGCTGTGTCCAGGGCTAGCCCAGGCTTAAGGTCGTGAGCCCAGAACAACCCATCATCC
ACTGCTTTCCCAGGCACATTAGTAGGGAGCTGGGTTGGGTCAAGAATCCAAACAGGACTC
CTTTGTGCTCTTTTTAAGTAGATTTTATTTATTTGATAGGTAGAGACAGGGAGAGAGAAA
GGTCTTCCATCCACTTACTCACTCGCAAATAGCCACAAGAGCTGGGCTGATCCACAACCA
AGGCCTCTTCCAGGTTCCCCATGCAGGTGCAGGGGCCCGAGCACTTGGGCCATACTCTGC
TGCTTTCCCAAGCCACAGCAGAGAGCTGGATCTGAAGAGCAGCAGCCAGTGCTGCAGATG
GAGGCTTAGCCCACTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1381..1444, 1799..1874, 2403..2577, 3207..3335
1001..1003, 1381..1444, 1799..1874, 2403..2577, 3207..3332
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved