Oryctolagus_cuniculus Locus RPS13
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus RPS13
Oryctolagus_cuniculus
RPS13
GeneScaffold_1647
SNORD14
2066..2155
4449
CAAAATTGAAGACTGTGTACCAAAGGGTCTTCTCAAGATAGCATAGGTAGGGGCTGGTG
TTGTGGCATAGCAGATGTGTCAGCATCCCATAGGAGTGCCCATTTGAGCCCTGGCTGCCC
CACTGCTAATGTCCTGGGAGAAGCAGCAGAACATGGCCCAAATGCTTGTGCCCCTTCCAC
CCTTGTACGAGACCCTGAGGAAATTCCTGGCTCCTGGGTTTGGCTTGGTCCAGCCCTGGC
CACTGAAGCCACTTGGGGAGTGAATGAGTGGATAGAAGATCTCTGTTTCTTGAGTCTGTG
TAAAAAAGAGAATAAAGATGACCCACCGAATGGGAGGAAAATTTGAAAACAGTGTATCTG
AGAAGGATCTAGTACTCAGAACAACTCAGAACCCACCTTTAAAATGGGCAGAGAACTTTA
ATTAATTTATTTGAAAGCTAGAGTTCCAGAGAGCTCAGAGAGAGGTCTTCCATTCGCTGG
TTCACTCCCCCATATGGCCACAACTGCAGAAGCTGTGCTGATTTGAAGCCAGGAGCGTCT
TCTGGGCCTCCCACGTGGGTGCAGGGACTCGAGGACGTGGGCCATTTTCCCACTGGTTTC
CCAGGCCATAGCAGAGAGCTGAATCGGAAGTGGCGCACCTGGGTCTCGAACTTGAGTTAA
CATGGGATGCTGGCGCTTCAGGCCAGGGCATTAACCCACTGCGCCACAGCGTCGGCCTCA
AGGCAGGGAACTTTGATTGGATGCTGGCGTCAGACTCCCGCTCTCGCCTGGCGCCTCATT
GAAGCCTAAGTACGCCGGGAGGTGTGGCCTGCGGACGAATCACCGCCTAGACCCAGAGGC
ATTTCGGGACTTGTAGTCACACGGACGCAGCGGCTGCGCAGCGGAGCCCCGCCTCCTGGG
AGCGAGGACGCGGGAACGTGTGAGGTCACTTCCGGCGTGCCGGGTGGCTTCCTGCGGCGC
TTCCTCCCTCACTCTCTTTTTGCTCCCTGCCCGCCGCCATCATGGGTCGCATGCACGCTC
CCGGGTGAGTTCGGGGCGGCCGGCCGGATTGCGGGGCTGGGAGGCGAGGGAGAGGACGGG
TGATGGTGTGGGCAGCTGACCGAGGGGCGGATGTTCTGAGCTGCTGGGGCACGAGCCACC
ATTTCACCCGACACTGCTTCTCTTCCTAGGAAGGGCCTGTCCCAGTCCGCTCTGCCCTAT
CGCCGCAGCGTGCCCACCGTAAGTAGCTCCCGGGGGCCGGGCCCGGGGCCTTGCGCGGCG
TTGAGTCGGGAGGGGCTGCTGTGCCGGGACACGGTCCCGGCCTTCCTGGCCTAACAGGCG
CCTTCGCTCCCTTCTACAGTGGCTGAAGCTGACGTCCGACGACGTGAAGGAGCAGATTTA
CAAACTGGCCAAAAAGGGCCTGACTCCCTCGCAGATCGGTGAGTGCGTGCGTGCAGAGCG
GCCCCTTTCGCTTGCTCGTGGGACCGTGGAGGCTGCACGCGCGCTTTGGGGGTGGGGTGC
GGTTACTGTTGGGGACTGAGGTTTATTCGTCATTGCGCTCTCCGGCCCCTGGGTAGTAGG
TGGTGAAATCGGGAAAATTCCCGACAGAGTCTATGGAGCATCCTCCTGGGTGCCCGATGG
CGAGCGCTTTACAAGTTCTGACCGACGCGAACTGAGGCCGCAGTACTGGTAGCTGCCGCC
TAAGGCCCCTTGCAGCCGATAGCCCCAGGGTATACAGCCGTGAAGGCGGGTGTCGGTGTT
GACTCCAGAATGCTTGACACATGAGCGCGCCCGCCGTGTGGCCCGTGCAGGTGGCTCCGT
TCAGCCGAGGTTCGTTGCTGCGTGGGGAACATGGCTTCTGGGCCCTTGGATGCCTGCCCT
CTTAGAGTGTGGTGGAGGTGTGACACAAAGTACTAGATGATCCAGTAGTCAGGGACTCCC
TTGAGGTCTAAAAGGACTAGCAGGGTATGGGAAGCTTTTAGAGAAGAGTGGGTACGAGTT
CTCGGGTGTTAGCTGGTTTTAATCACAGGACAAAGACGTGCCAATGCGGGGACCCTGAGT
GTTGTGGTCGGCTGTACTCAGCAAGCTCACCGTGATGATGGTCCTCCACCATTCGCAGTT
TCCACCAGAAAGGTTTTCCTTAGTGTTGGGTAAACCTTCCTTGGATGTCTGAGTGAGCTC
CTGGTACAGGTTTCTGTGGGGACCACCACCCCCCAGCTTACAAGGGGAGCGAGTTGGTTT
CCGAGCCCCTGCGCGCACATCACACGCCGCAGTGTGTTTGGTGCTGGAGTAGAATTCGAG
GTCTCCCTTTCAGGTGTGATCCTGAGGGACTCCCACGGCGTGGCGCAGGTGCGCTTCGTG
ACCGGCAATAAAATCTTGAGGATCCTGAAGTCCAAAGGACTCGCTCCTGATCTTCCCGAG
GACCTCTATCACTTAATTAAGAAAGCTGTTGCTGTTCGGAAACACCTGGAGAGGAACAGG
AAGGTAAGGAGAGGATGGAAGTCGAACTGGAACTGCTTGGGGACTCGCCACAGTGCTTTC
AGCAGCAGCGGTTTTCTGTGGTGTCGCCTGTGCAGCTGGTTGTCAGTGTTGGGGAGGTGG
GTGTTTGGCTTGCCAGCCATTGTGTTAGTCTTTCCTAGAAGCCTTAAACTCCCTCAGTAG
TCCAGTCTAGCCATTCTGTTCGAGAGCGTTGGGTAACTTCATTAGGAAAAGTGCGCTGTG
ATTCTGTTCCCTCGCTAGATGAATGTTTGCTAACCTGTTATTTTGAGTGGTTTTCTTAGA
GTTGTTTCAAATTTTATTTTTAGGACAAAGATGCCAAATTCCGCCTGATTCTGATAGAGA
GCCGAATTCACCGGTTGGCTCGATACTACAAAACCAAGCGGGTCCTCCCCCCCAATTGGA
AATAGTAAGTATCTACCTTTCTGTTAATGGGAACGGGAATTAGCCAGATAGTAAGTATTA
GCAGCAGAGAAATACTTGAGGCTCTTTGAGCTTGGCCGTGGTAATGGGAAAGCAGCCGTG
GGTGGTACGTGAACAGACGGCCTGGCTGTGTCCCATGCCCAACGCCGTGGTTTGTATTGT
TTGGACTGCAGAAGCCCTGTCGCTTCTTCAGGGTAGTATGTGAGGGCTCGTTTCTCACCT
CTGCTTCCAGATGTTAGCGCTGTTTTGATTTCTGCGTGAGGTGCTCTGATCACTGATACC
CAGCCATGCACAGCTTTCACCAGAAATGTTTTTCCCAGAGTTGGCCGGTTCTTCCTCGGC
TGGCCGAGTGAGCACTGAGCAGTGAGCAGTGTTGAGCTGATTGGGCAGCTCCATCACTTG
GTGCCCTTCATATTGATTTACTTTAGCCATTTGGAAAGAGCTCCATTAGCAGGGGTGTGT
GTGAATGGATATGGACGACCAGTATTAATCCCTATTTCCCCTTTTTTCCTTTTCAGTGAG
TCATCCACAGCCTCTGCCCTGGTGGCATAAATTTGTTTATGCGCTCAAGCAATAAAATCA
TTGTTTAACTAAAAATGTGTTTTGTGGGTTTTTTTCCTAAAAAAAAAAAACTGTATCACT
GATCCATATGTGATTGTTTCTGGTGGGGAGCAGTGAGAATCTTTCATCCCTGGACTGGCC
CCTAAACTAGTTAAGCAGCATAACCTGATTGGAGGGTTCCTATATACAGAAGATAAAGAT
TTAATGGAAAACTCATATTAGGAAAACCTGGATATTCCAAAAATACANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1169..1217, 1339..1417, 2293..2462, 2783..2883, 3416..3449
1001..1023, 1169..1217, 1339..1417, 2293..2462, 2783..2883, 3416..3446
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved