Oryctolagus_cuniculus Locus ENSOCUG00000006704
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000006704
Oryctolagus_cuniculus
ENSOCUG00000006704
GeneScaffold_5854
SNORD85
10883..10951
45229
TGCCACCATGAAAGATTTCAGTACTTGTTTTGGTACTAGTCCTGGCAAATGTTAGTCCG
CTATGGAGGTATTTGGATTCATTTTTTGCTGTGATTTTTATGCATTGTGATTTGCTTCAG
TGAGCTTATTAGGAAGTCTTATTTAGGAATTTGTAGTTGCTTTAATTCTTGTTTTTCTTT
TTTTTCAAGCTGTAAATTTAATCATCACACTTTTGAATTCTGAGAATATTAATTTTCTTT
TGTAGAGCTGTTCATTATCTAGGTCAGTGACAGAGTATACATTTTCTTTTTTTCTCAAAA
GCGCGAGTGATCATCAAGGAAGGTGACATAGATGTTTCAGATTCTGATGATGAAGATGAT
AGTAAGTATAATAATGGATAAAGCCAAGAATGCATACTGTGTCATAGAGAATGAATGTAT
GCTGAATGGTAAATATACTGGCCTTAGGGCCAGCACTGTGGCACAGCAGGTTAAGCCTCG
GCCTGCAGTGCTAACATCCCATATAGGCGCCAGTTTGAATCTCAGCTGCTCTACTTCCGA
TCAAGCTCAGTACTAACGTATATGGGAAAGCAATGGATGATGGCCCAAGTCCCTGGGCCC
CGACCCACATGGGAGACCCAGAAGAAGCTCCTGGCTTCAGCATCTTTTCTAAAAGTAGAC
TGAAGCAGTGATAACCTTTAATGGAATCAGTGTTTTATTTTGGTATTAATATGTAATCAT
TTGCCTTAATTGTGTTAATTATGTAATTAGACCATTTATTTAATCTTTGCTGGTGGATGT
GACATAAAACTTGAAATTATTTTTCTGATGAATTATTCAGTCAGTAAGCACATGTTTTAG
CTTCAAGTATGTAATTTTTCAGTTTTCAGTGTTTTTTTTTTTTTTTAAAGAATTTATTTA
TTTATGTGAAAGGCAGGGTGACAGAGAAAGAAAGATGTTCCACTTATTAGTTCACTGCAC
AAAGGCCCACGGCCAGGCATCCGGAACTCTATCCAGGTCTCCCATGTGGGTGGCAGGGAC
CCAAGTACTGTCATCCACCCAGGGACATTGGTAGGGAGCTGGATGGGAAGTAGAAGAAGC
TGGTTCCTGAACCAGCACTTTGATAGGGGGCACAGGCATCCCAAGCAGCGGCTTAACCTG
CTGCACCACAACGCCCGTCTGTTGGTTTTGTTTTGACGCTCATATGCTCAACTTTTCTCC
TTATAGATCTTCCTGGAAATTTTGACACATGTCACAGAGCCTTGCAAATAATAGCACGAT
ATGTCCCTTCGTGAGTACTTTTGTTACTTTGGATCCTAATGTTTAAATCCTTAAGAAAAT
TATAGTCCATTGGCAGAAAATTATAAAATGTTAATAGCATCAAAATTCAGATCTTAGGAA
ACAATCACCATGTACAGAAAATGGCATTTCAGCTTTCTGTTCATTATCTTAATTGCTTTT
TGCAAGCGATACATGTATAGTGGATGGAATTTTGCTTTTATCTTGAAGAGACAGGATATC
TAAAAGTTTTCAACCCCTGTGTGTGATGCCATATGAATAAAAATTTTAGTACAAGAAAAG
CTTTTCCAATTTCTGCATTTCTTTTGAAGGGGTAGACTTCTAGTTCCTTTTATTTAATGC
TTTTAACTTAATCCAAGTTGATAGCTTTTTTCACATTTAAAATAATGTGTATGTGTAGTG
GGAAATTTGTAGATTTTAAACTGAAACTCTGTTAAGCTTTTGTAAGGAAAAAACTCTCTC
TTTACTGTCAAAGTTAATAGAAAATTGTTTTCTCTTAAGTAGTTTTAGATTTAATTGCAG
CTATATTTTCATTTTATTTCAGTTGCTTGAGGTTAGGGCTACTAATTGCTCGTATCAATT
CGTATTTGCTCATAGAATGGAAATGTTATCTTCCTGCAACACTCAGTTAAGGTGGATTGG
TTGATTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTGG
GGCATGCACGTTATAAGTCATACGTATCACATACTATACTGCTGGTGTGTACAAGCAACA
TAGTTAGGACCATGCAGTCAAACTGCCCTGCTCAGACTCCAGAACTGCCACTTACTAGCT
TTGGAACCCCTGTGCCTCAGTTTGCTCAGCTGAGAAATGGGGGTGCTAATGTCTATTTTA
CTGGATTGTTGTGAGAATTAGCTTAGTTAACATACGTATATAAATGAAGTGCTTAGATTG
TTCCTGGTGTGTAGTCAGTGCTAAAAAAAAAACCCTCACAGACATCAAATAAGGATTCAA
ATCAAACAGATGATGTTTCTTTTTGCATTCTTATCAGGCGCCTCTCATCTGCCCCAGATA
TTGCATAACGGAGTCCATTGGTGATAGAGGTGACTGCCAGGGGACAAAGACGGATGATAG
AAGAACTGCTCACTGGGAGATAATTAACTGACTCTTGGGTGGGCTGACTTTAGGGCTGAC
TGGCTAAGGGTGAGGAGAGGAATTGGAGTAGGGGCTGCCCCTTTGTCTTGACCACATGCG
TCTTATAATCTCTTCTTTGATATCAATCCTTACTACCAGCAAAGAAGCAGCCAGCCTTGG
CCTGCGTGGTTTACTCACTCATTCAACAGTCTTAAAATTGATTTATTTATTTGAAAGTCA
GAGTTATAGAGAGAGAAGGGAGAGGCAAGACATAGAGAGGTATCCCATCCGTGCTCATTC
ATACTCCAAGTGACCACAATGGCCAGAGCTAAGCCAGGCTGAAGCCAAGAGCCATGAGCT
TCATCTGGGTCTCCCAGCCATCTTCAATGCTTTTCCTAGCTCATTAGCAGGGAGCTGTAT
CAGAAGTGGAGCAGCTGGGACTTGAACCAGTGCCCATGTGTGATTCCGAAGTTGCAGGCA
GCAGCTCTACCCACTGTGCTACAATGCTTCCCCCAAAAAGTAAAACTGTTTTGCAGATGA
TGTGATTTTATGTGTCAATCCTGAACAATCCTAGGAAATATTAGAGCTGATAAATGAACA
CATTGTAGTTAAGGGATTTGAGGTCAGTATGCAAAATTCTGCTGTTCAAGGTAATTTAAC
TGGGTTGAAAGAAATATTTTCAAGAAATGGTGCTGTGACAGTGGAAGAATACATGCAAAA
CAATGAAGTGTATGTGAGCAGTTGTTTAGCCTTAGCAATTTGGATGCCTGTCTGCCACAT
TGATGTGCCTGAGTTCAATTCTGGCTCTGGTGCCTGGCTCCAGCTTCTTGCTCAGGCAGA
CCCAGGGAGGCAGTGGTGATGGTTCAGGTGATTAGGTTCCTGGCACTCACCTGGGAAGAC
CTGGATTGAGCTCACATCCATCCTGGCCCAGCCTTACTCATTGTGGACATCTGGACTGTG
TACCAGCTAGTATGTCTTCTCTCTTCCATCTCCCAAGCCACTTCTCATATAAAAGAAAAA
GTATATGGATATCCACATACAAAAATGACTCAAATGGATAAAAGAACTAATTGTAAGAGA
TAAAAATCTTAGAAGAAAACTCAGATATAAATTTCCATGCTATTAGATCCAAGGGTGGGA
AACCTTTTCTTTGACCAGCGCCATCTGGAGATTTATAACATTGTTCATGAGCCATATAAA
AATTACCAGTTTAATACTTGGTATAGTGGGTGAGGCCTCCACCTGTGGTGCCTGCATCCC
ATGTGGTTGCCAGTTCAAGTCATAGCTGCTACACTTCCGATCAAGCTTCCTGCTAGTGTG
CCTGGGAAGGCAACAGAAGATGGCCCAAGTCCTTGGGTCCCTGCAGTCAGGTGGGAGACC
TGGAAGAAGCTCCTGGCTCCTGGGTTCAGATTGGCCCAGCTCTGGCCATTGTAGCCATTT
TGGGAGTGAACCAGTGGATGGAAGACCCCTTTCTCTCTGCCTCTGCCTTTCTCTAACTCT
GCCTCTCAAAATAAATGAAAATAAATCTTTAAAAAAATATTAACTTAAAAATTAACCAGC
TGTAGATTTACTGAATTTTTTAGTTCTACCTGTGGTTGCCTTGGCAAGGTCAGACCAGAT
GAGCTGGAAAGCCTTATATGGCCTACAGGTCAGACCCCACCCCTCCCCAAGGCAGTCATT
TCTGGATTGAGAGCTGGAGCACATGCCATCAAAGAAAAAATATGTAATTTGGACTTCAAA
ATTAAAAATTGTTGTGCCTTTTAAAAAATCAATAGACATCCCAAATAATGAGAGAAAATA
TTTGCAAATCATAAATCTGATGGATTTGTATACATAAAGAATTGTTATAATTTTAATATT
AAAGGGGAAAATAACCAGCCACTGCAAGATGTGTACCCCAGAGAAATGAAGATATGTGTG
TGTGCTTTGGTGCACAGCAGCATTGCTCATAATAGCCCCAGAGGAGACACTGCTTGTGTC
CATCAGCGGATGGATAGAGAAAGAAAACATGGTGTAGCTGTGCAATGAAATACTATTTGG
CAATGGAAAGGAATGTTGTGCCTGTTTCAGCATGAGCGAATCTTAGAAATGAGCTAAAAG
GCCATGTTATATGACTTAACATACAAAGTGTCTAGAATAAGCAAATTTATAGGAAAGAAA
GAGTAGTGCATGTCTAGGACTGCGCTTTTTAGGAATATACTAATGGATATGAAGTTTCTC
TTAGGGCTGATAAAAATGTTTTATAATTGGTGATGGTGATGATTANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCACATCACACTGAAGCTCTGAGGGCGGTGAAGGAT
CTTCAAAGTAATCTATGTTCTCTGAAGAACACATTGAGACGACGACACTAGGAGTAATAC
ATCGACGGGGAGAAGCGATCTTTTATCCAACCATCTAAGGACCACCTCTGCCACTACTTA
GAGCACCTCCTTCTAGGACAGGCATCCCCTGGGTGTCTGCAGGACATCCGTCCCGTCCAA
TGACCCCCCCACCTCCATAGCTGCCCAGGTCCCTTACTGAAGTGGCTCAGTATTTGCACA
GAACGTCTGCACACGCTCCGTGTGCTCCCCATCCTCTCTGTGTTACCGAGACACCTAATG
CAGTGCAAATGTTTTGCACTTGGTTGTTATACCTTCTTGTTTAGGGGGACAGACAACTTG
AAAGAGCCTGCACATGTCTGGTGCTGATGCGGTTTATTTCTGTTTCTAATATTTTTGATC
CACAGGTGGTTGAATCGGGGACTCAGAAACTTCAGGGTCAGCTGTGATTTTATTCCACTT
TTTTCTTTTATCCTCAACACATCTGGGAATCAAATGAAGCACAGTATTAGACCCTGCCTT
TTTTGGCTTCATGTTATATTAAAGGCATTTCCTACGTCAGTGCAGTCTCTTAGTAAGTAT
GGTTTCTTATGACTGCCTAATAGTCTGTAATTTGTGTATGCACTAATTTCCTAACAAAAA
ACCTACTAATCAACTTTTAAGTTCTTTAGGACATTTTATAGCTATAAACACCACTGTGAT
GGAGAATCCTGCGCAAAACAAAATTTGTAAATGTTTCATCTTATTGCACTAGTAGATTTA
GAAAAGAGGTTTGAGTAGGATTTTTAAAAAATTGTGTGTAAGGGCCGGTGCTGTGGCGTA
GTGGATAAAGCCGCCACCTGCAGCGCTGGCATCCTATATGGGTGCTGGTTTGAGACCCGG
TTGCTCCACTTCATATCCCGCTCTCTGCTGTGGCCTGGGAAAGCAGCAGACGATGACTCA
AGTCCTTGGGCTCCTGCACACACATGGGAGACTCGGAGGAAGCTTTTGGCTCCTGGCTTT
GGATTGGCCCAGCTCTGGCCATTGCGGCCATTTGGGGAGTGAACCAGAGGAAGGAAGACC
TCTCTCCCTTCCTCTGCCTCTCCCTCTCTATAAATCTGCCTTTCGAATAAATAAATAAAT
CTTTTAAAAATTGTGTATAACATAATATTTTTCACTTTAACCATCTGTAGGTGTAACTCA
GTAGAATTAAATGCATTTGCAATGGTGTATAACCATCACCACTATCTGTCCCAAAAACAT
TTCAGTGTTCCCACCATAAAATCTGTACCCATTAAACAGTAACTTCTCATTTCTCTCTTG
CCAGCCTCTGGAAACCTCTATTCCAATTTCTGTCTCTTCCTTTTCCAGGGGTTTCATAGA
AGTGGAATCACACAAATTTTTCCTTCTCTGTCTGGCTTATTTCATGATGTTTCCAAGGTC
CACCCATGTGTTAGCAGATATTAAATTTGTGTTCCTTTCTGTGGTTGAATAAGACACACA
GAACACACACACAAAAAGACACACAGCACACACTCTGTTTATGCATCTACTGATGGAAAT
TTTGGTGGTTTCCACCTTTTCATTATTGTGAATAAAGCTACAGTAAACACTGGTGTACAC
ACGGATCTGAATCCCCGCTTTCACTCCGTGTGACTATATACCTAGAAGCAGAATTGTTGG
ATCGTTCGATAATTCTGTTTGACTTCGTGAGGAAGCTCACATGATTGTACAGAGACCCAT
GCTGGAAATTACAGACGGGCTTTGCATGGTATCTGTGCACTAAGGGCCAAGGGGAACTCC
TATGGGTAGACCGCCCTCAATGTCCTTGGTCTGCCATCAAGACTGTGGAATGATCACATG
GTTATATGCTTTAAGTTAAATATTTAGAGAATGTATGGTCATTTTTAATGTTTCTTCATT
TTAACCAACATTTTATTCACCAACTCATCCCAAACCAGGCTTCAACTATATGGTGAATAT
GAAGCCAGTTCAAAGCAGGGGTCTTGATCAAAATGCCTTAGACGTCAGCAAAAGTAAACA
GATCTGTGAGTGCCTGTTGTGTGCATCGTGCACTGTTTATTCTCCTGGGAAATACAAGGG
AAGCTTGGAAAACTGTTCCTTTTTCATTCATCTATTCAAAAGCATTTATGAAGAAAGCGT
CATTATGGGTAAAGCCCGGTTCTGTGTTCTATGTAAACACGTCTTACATTAGCTAAGTCA
ACCAAGGTGTTTAAGAAACAGCAGGAGGGGCATGCGTTTGGCACAGCAGTTTAAAGGCAG
CTCGGGACCCCTGCCTTCCACAGCAGAGAGCCTGGGTTCCAGCCTTGGCTCCACCCCCAT
CCCAGCTTCCTGCTAATGTGCACCCCAGGAGGTGGCGGTGGTGGCTCCGGCAGCTGGCTC
CCTGCCAGTAGGCAGGAGACCCAGATGGAGCGCCCAGGTCTCAGCTTCAGTCTAGCCCAG
CTCCGGCTGTTGCGGGCATGTGGGGCGTTCACCAGCAGACAGAAGATCTCTCGACTTTCA
AATAAATAAACATAAAAATTTTAAATCCTCCACATTACATTAAACAGAAAAAGGAGGAGG
AAGATGAGGAAGAAGAGGGAAAAAACCAGAAGGCACGTCCCCCGGCAGTGAGGTGGCGGC
ATTCAAGTAGCTGGATAGGGAGTGCTAGGCATTCCTAGACTGGAACAATCGCTGAGGGCA
CAGCTAAGGCCTGGCTGCGTCACTTTTCTGCAACCTGAGGGGGTTCAGCAGGTGCATTAG
CTTCCATTGCTGCTGTAAGAAACTACCACACACTTAGTGACTTAGAATAACACAAGTTCA
TTGTGTTATAATTGCAGAACTCAGAAGTCTGAAATGGTCTTCCAGGCTAAAATAAAGGTG
TTGGCAGTGCTACGTTCCTGGGTGGAGATTCTATGGGAGAACCTTGTCCTTCCTAGATTC
TTTAAACTTTACTCATACAACTTGATCTTAGCCAAAAGGTCAAGAAGCGATTGATTCTTT
AAACGTTTAACAAAGATTTATTTTATTTATTTGAAAGGCAGAGTGGCAGACAGAGAGGTT
CACTCCCCAAAAGACTTCAACAGTCAGGGGTGGGCCAGGTCAAAGCCAGGAGCCAAGAGC
TCCATCTGGGTCTCCCACGTGGATGCAAGAGGCCCAAATACTTGGGCCATCTTCCGCTGC
TTTCCCAAGTGCAACAGTGGGGAGCTGGATCAGAGCAGAGCTGCCGGGAATTGAGGAGCG
GCAGTCCCCCATGGGATGCCAGCATCGCAGGTGTAGCTTAACCCCCTACACCAGTGTCTC
CCCACCCCCAAAACAGTCCTTTGGTGAACTTTGCTGGACAAGTAAGTCTTGCATCTTTAG
TTTAGAAAATCCTATGAGCGTGCATTCCTGCCATCCCTTCCAACCCTAAATCCGCATTTG
GGAAGGAACAGGAACAAGAGTTGTATTGGTGAGCCTGCCCGAAACACTACCTGTACCATG
AGGGCTGTGAGCTGCCCAACACTTTCAGAGCAAAGAGGGATCCAAACACNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTCCCATCATCCCAAGAACAAGGATGACC
AGCCATATATGTATTCCTTGAGGGCCCTTGGATGTCCTGCACAGATCTTGACATAGCATC
TCGCCTAAAGCATGGCCCACTTCTACGGTGACAGCCACTATCCCCGAGTCTGCTGTAGCC
TCCTCCCACTCACCGTCTCGCCGTCTCTCTCAATCTCAGAGCCCAGATGCCACGTCCCCA
GCATGCACCACCTTGGGAAACCCTCTTGCTCCTATGCGTCCTTGCTTGACTGCCGCCTAT
TGTCCTCCCCTTCAAGCGTACGAGGTCCAGGGAAGGAGGGAGCTGCCCTTTCCTGCTCTT
TGCTGCATACCCCGTGCTCGGCATGGCCTGGAGCACAGTAGGGCTGACAATACACACTGA
ATGGATGAGGGCTGTGCTTAGGCCACGGCACAAGCTCCCGCATGCCTCACATCTCTCGAA
TTCCGAGTGTGAGTTTTTCCCCGCCTTCATCTCCCACATCCGTCTCTTCCCCTCTGTCTC
TGGGACTATTGCGATGGTCATAACTGCTCCGGTCGCCCCACGTGTTACTCCTGGGTCTCA
CCCTACCGCTTCCCCCTCTGTAAGCCTCAGCCTCGGTGCCACTCCACACACACCAAGGGG
CTCCACACTGTGGTGTGTCGGGGAGGCTAGAGGAGCTCCCCTAGGAGGGTGGGAGGAAGG
AGGTGCAGATGGAAAGCCACCAACACAATGCTTCTCCCACTCCTTTGCTTTGTTCTCTTC
CCACGGGATTTAAATTTTTTTGTGTCAAATTTTGCTAAGGGGGAGTTGGAGGTTTTGTGT
TTACCAAGGGGACTGGAGTGTGGGGTTTAAAAGTATAGAGAGGGTGGCAAGGATGATATG
TACTTGCCCTCACTTAGATCATAGTTGGTTGATGACAGCATTTTTCTGATCCAGTCTGGA
AAAAAAAAAATAATGAGAAGGCCCGCCTGTGGTGCAGTGGGTTAAGCCTCTGCCCAGGGT
GCCAACTTCCCACAGGGTGCTGCTTCGAGTCTACTTCTGATCCATCCCTTTGCTAATGCA
CCTGGGAAAGAAGCAAAAGATGAGCTGAGTGCTTGGGCCCCTGCGCTCAAGGGAGAGACC
TGGATGGAGTTCCAGGCTCCTGGCTTTGGCCTGGCCCAACCACAGCCATTGTGGACATTT
GGGGAGTTGAACCAGCAGGTCAAAATTCTCTCTCTGTAACTCTGCCTTTCAAATAAATAC
ACAGCTCATTAAATAAGTTAATGAATTAAAGAGCGCTGTTTGCTGTAAAGTCTTAGCCTC
TGCCTCAGCCCACGCAGTCCCCCACCCCCACCCCGACCTGTCCCTAGGAACCCTTTGCTG
ACTTCCGGGGCCAACTCAACTCTTCTTCCCCTTCCCTGGTAGAGCTGACCGGCCCCTCCC
TGGGCCCCAGTGCTGTCTCCACAGCTCTGATGGCTCCATCTTTCACCCTGGTTCAGAGCC
CCATCAGATCCGATGGCCCTTGAGAGGGAGACTCAGTACTTTATAGCGATCAGGAATCCA
GGCTTCCCTGTTCCTCCTGACAGAGGGCAGGGCCGATCCCACGGCCCACAGCAGGGCTGC
GGCTGCAGGCGGCTGCAGATCACGTGTCCGGCCTTTGAAGGTCAGAGGCATGCCGGGACT
TGGGCTCTTCGCTGCAGAGTTGGTGCACACTGCTCTCACGGCCTGGGCTCCTCTTTGGTT
AGGCTCTCAGGGGCAGGCACTTGGGCCTGGCAGATGAGACATCTACATTCTCGCATCAGG
TGCCCGACTCGCTCTGGACTGCAGCTCTCTGCTGTTGTGCACCTGGGGGAGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAGCCAGCTGCTGGAGCCACCACCGC
CACCTCTCTGGGGTGCACATTAGCAGGAAGCTGGGATGGGGGTGGAGCCAAGGCTGGCAC
CCAGGCTCTCTGCTGTGGAAGGCAGGGGTCCCGAGCTGCCTTTAAACTGCTGTGCCAAAC
GCATGCCCCTCCTGCTGTTTCTTAAACACCTTGGTTGACTTAGCTAATGTAAGACGTGTT
TACATAGAACACAGAACCGGGCTTTACCCATAATGACGCTTTCTTCATAAATGCTTTTGA
ATAGATGAATGAAAAAGGAACAGTTTTCCAAGCTTCCCTTGTATTTCCCAGGAGAATAAA
CAGTGCACGATGCACACAACAGGCACTCACAGATCTGTTTACTTTTGCTGACGTCTAAGG
CATTTTGATCAAGACCCCTGCTTTGAACTGTCTTCATATTCACCATATAGTTGAAGCCTG
GTTTGGGATGAGTTGGTGAATAAAATGTTGGTTAAAATGAAGAAACATTAAAAATGACCA
TACATTCTCTAAATATTTAACTTAAAGCATATAACCATGTGATCATTCCACAGTCTTGAT
GGCAGACCAAGGACATTGAGGGCGGTCTACCCATAGGAGTTCCCCTTGGCCCTTAGTGCA
CAGATACCATGCAAAGCCCGTCTGGAATGTAAGGAAGGAAGGAAGGAAGGAAGGAAAGAA
AAGTCAAGCCCCGAAGAAGTTCTTGTACTCCATCAATGTCCTACTCATCCTCTACTCATC
TCCACCCAGAATGAGACATTCCTTACAAAATCATCTCCACTTACTCAGAATATGCACTGC
TCACCCACTGTGTGCCAGGAACTGGGTTACCCTCCAGAAGGCTGGTGGGGGAGAGAGCCC
TTTAACCAGCCAGGGAAGGGGCTTATAACCCAGCTGGGGACAGAGGAGGTGTCTGGGGGA
GGTGCCAACTGAGTGGTGCCTCCAAGGATGAGGAGGAGCAGGGCAGGCAGAGGGCCAGAG
GCGGCTGTTCCAGGCAGAGGGGGCGAGCGGAAGAACAGGGCTCCCCGGGGAGTTGCAAGT
GACTGCTGAGGAGTCAGCGCGTGTGCCAGGCACCGCTTCCCGGGGTGGAACACAGGGCCC
CGCCCTCAGGAGCGTGCAGTAAGCGATACCGAAAAGTGAAATGTTCGGAGCAGTTTCTTC
AGCCTCGCCGCTTGGGAAGCCTGCATCCCACGTCAGAGTGCCTGCGTTTGAGCGCAGGGT
CCGCTCTGACTCCAGCTTCCTGCTAAGGCACACAGCAGGTGAAAGCCCAAGTACTCGGGT
TCTTCCCACCCATGTGAAAGAGCCGGAATGGAGTTCCTATCTCTTGGCTTTGGCCTGGCC
CAACCGCAGCTGTTGGAGGCATTTGTGGAGTAAACCAGCAGATGGGAGCCCTCTCCCCGC
TCCTGAAATAAATAAAATTTTAAAATCTAGAAATCAGGAAAAGTCAACGGGTCCCCGGGG
GTGGGGTGAGGGTGTCCTCCACCGCTCGTGTTGCCATCGCTGCCAGCAGGGCCACAGCTG
AGCCCTCGGAACCTGTGTCAGGGCTTGTCCAGGGGAGGGGTGCTTCCACGCAGAGACAGG
TGCTGTGGTCAGGGAAAGAGGGCGTAGAGGCCCCTTGGCTCCCAGGGCCACCCTCAGCTC
CCAGTGCCTTCTGGCCCCTGGCCCTTTCCGGGTCTGAACACAGACACTCATGCGTGTACA
TGTGCACACGCATGTGGAGTCGTGCTCCGGGCCTGGGGACCCAAGCTGAAGCCACGTGCA
CGCTGGAAGCAGCACCCTTCCTCAGGGACCCTTCCGTCCCGAGCAGGGAAGCCCCGGCCT
CTCATCTCCCACCCCAGGGTGAGTGGCGTCTCCTTGTGGGGAGGGAGGGGACGTAAGTCA
CAAGCAAGTGGTGGGAGAAGCGCCTCAGCCTGCACTGGGCACTGACTGTTCCGCACCTCT
CACCCCTCCTAAAATCGGCCTCTACCTCCGTCCCCTCTGTGGTCCCCTGGAGAGCTCCAA
GCCTCTGAAGCCACGAGGCCCTCTGCCCACAGCGGGCAGTCAGGTCCTTCCTGGGGGATG
TCTGGGGACTTGCAACAGAGATGATGATGGAGATGGACAAATGCACCACCCGGGAGCTGG
TGGCAGCCCTGTCCTGAAGCGAGGAAACGCAGCCAAAGCCACAGTGAGGGACCATGTACC
TGTACCCATCACGGCTGCCTTGCCCGTGGTTCTGGCCGCAAACTGCACCCCTTGAGGTCT
TCATATGAGTCTGTCCCTTGTAATGAGGGTGACCAAGTGATTTCCCATCCACACAAGGCA
GGGGTCATTGGCAATAATTACTCTGGGACTGCAGATGTAACCAGGGACAGTCCCTCCCTC
ACAAGCCAGAAGTCTTTCTGTTCACCCTGCTCAGAACCCACTAATAATACTGTGATGGGG
ATCCCAAGCTGCCCAGCATTGGGTACCACAAACAAGGCCCTGAAGAGGGAGGACCGCCGC
CTCTGCTGGACCCTTCCTCAACCAAGAAAGGAGGCAGGAGGGCACCCAGGGCCGCCAGGG
ACGCCGTCCCCAGCCCCTCTGCTCGCCCATTCCACCTGCCACTGCCTCCAGAGCTGCAGA
CTTTCTGCCATTTCTTAAAAAACTCCTTCTGAGGCTGGCACTGTGGCACAGCGGGTTAAA
GCCCTGGCCTGAAGCACCGGCATCCCATGTGGGCACCGGTTCTAGTCCTGGCTGCTCCCT
CTTCCCATCCAGCTCTCTGCTGTGGCCTGGGAAAGCAGTGGAGGATGGCCCAAGTCATTG
GGCCCCTGCACCCACATGGGAAGACTGGGAAGAAGCTCCTGGCTCCTGGCTTCGGTTAGG
CGCAGCTCCAGCCGTTGCAGCTATCTGGGGAGTGAACCATCAGATAGAAGACCAACCTCT
CTGTCTTTCAAATAAATAAAATAAATCTTTAAAAAGAAAAATCCTTCCTGGGGTAGGCAT
TTGGCCCAGCCGTAAAGATGCCAACATCCCACATTAAAGTGCCTGGGTTCGAGTCCTGGC
ACCACTTCCAATTCCAGCCTCTTGCTAATGCACACCTTGGGAAGCAGCAGGTGATGGTTT
GGGTCCCTGCTACACACATGGGAGACACAGACTGAGTTCCAGGCACCTGGCTTCAGCCTG
GCCCAATCCCAGCTATTGCAGGCATCAGGGGAATGAACCAATGGGTGGGTGATTCTCTCC
GCCTTGGAAATTAACTGAATAATTAAAAATAATCTAAATATATGTTTCTTTGCTGTGGGG
CTTTGACCACGAGCACCACTCTTCACCTAAGCCAGGATGACAAGAGAGTCGTCCTCTGGG
GCTGGGCAGTATTTGGTCATCTGGGGCAGGGGGCGCACTCTATCTCTTGCTGAGGCCCTG
AATGAGGCCTGTCCTGGCCAGCAAGTAAAGAGCCACTGGCAGGATCTAAAAGGTGTCAAG
AAAGGGTCCCCTGGTGGCCACGGGGGGGACACCCCAGCCCCTCCAGTGACCCTAGCTGTG
GCTGAGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCACAGGTGCAGGGGCCCAAGGACTTGGGCCATCTTCTACTGCTTTCCCAG
ACCATAGCAGAGAGCTGGATAGGAAGTGGAGCAGCCAGGTCTTGAATCCATGCCCATACG
CTTAATGCTGGCCAGGGCATTAATCTGCTGTGCCACAGCGCCGGCCCTATACTGAGTTTT
TTGCCCATGTGAAACTGTTAGTCTAGAGGGTTTGCTGTGAACAACACAAGAGTTTTTCCA
TTCACATTGCTCAGATTTAGGAATGAGCTCAGTGGGGCAGGCATTTGGGTACACCAATTT
AAGCCATTGTTTGGGACGCCTGCATTCCATATCCAAGTGAACTAACAGATGAAAGATAAC
TCACTCTGTCTCTCTCTCTTCTCTGCCATATAAATAATGAAAATAAACTTTAAAAAGATG
AGCTCGGCCGGCGCCGCGGCTCACTAGGCTAATCCTCCGCCTTGCGGCGCCGGCACACCG
GGTTCTAGTCCCGGTCGGGGCGCCGGATTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCC
CTCTGCTGTGGCCAGGGAGTGCAGTGGAGGATGGCCCAGGTGCTTGGGCCCTGCACCCCA
TGGGAGACCAGGAAAAGCACCTGGCTCCTGGCTCCTGCCATCGGATCAGCGCGGTGCGCC
AGCCGCAGCGCGCTGGCCGCAGCGGCCATTGGAGGGTGAACCAACGGCAAAGGAAGACCT
TTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAAAAAAAAAAAAAAAGAT
GAGCTCAATGTTTCTGATTAATAGAACTTGAATCTGAGTTGACTGTTATGTGTTGATTGT
TTTGCTGTTACAAATTGAATACATTGATGAGAGAAAATTTGGAAACTACTGAAAGGTAAA
GACAGTTTAAGTGTCTGCATTCCTGCTCTTCTGAGAACCATTGTTAGTGTGTTGATGCAT
GTCTTTTTCTTAGCCTGTGAATATGTATATTTTTTGTACATTTAGGGGGTCACACTAATT
GTTATATTTCATATCTGTGCTTTATATGTATTGAGAATACTTTATGATGCCATTCACTGT
TATAAAATATTGTTATTGGTCATATTGACCTTATTTGTCAAGATTACAAATAACAGTCTA
ATGAACATCCTTACACACATATTGTCAAATTATTTGTGATAAAATTCCTAGCAGTAGAAT
TACTACCTCAAAGAGCTTCAGCTAAATAAATTGTAAAGAAGGGTTCATGTTTATGACATC
ACAGCAGTATGTGTGGGAAGTCCTGCTTCCTTGGCAGTAGTGGATTATATTTAAAAAGGA
AAATCTGGAGTGAGCATTTGGCCTGCTGGTTCTGAAACCGGTTATGACACCCGAGTCCCA
CCCTGAAGTGCCTGGGTTTGATTCTTTGCTCCAGCTTTCAGTTTCCCCTGCCTGTCATTT
CTGACCCTGGGAGGCAGCAGTGATAGCTTGAGTGCTGAATCCTTGCTACCCAAGTGGGAG
ATCTGGATTGAGTTCTTGTGTCCTGGCTCCAGCCCCAGGCCCATCCTGGCCATTATAAGC
ATTTGGGGAGTGGACCATCAGATGTGAGGGGAGAGAGTGCTCACACTTGCTGTCTCTCTC
TGCCCCCAAATAAATTAAAAACAAAACAGAAGTTTGTTCATGGGAAAAATAGAAGTTTCC
CAAAAAAGAAAATCAAAGCCTAAAGTTTGAAAGTTTGGATCAAAATGTTGGTTTGAGGGA
CTGATCGTGCAGTGTGGCTGGTTAAACCACCGTTTATGACACTATCAGCTACTCCTAGTC
CTGGCTTCTCTGCTCCTGCTCCAGCTCCCTGCTAATGAATTTTGTTTTCATTGTAGCTTA
ATGGATATTGCACAGATTCTTAATGCATTCTGTTTTAAAATTTGGCAGATGAAGCTTATA
GCTTGAAATATGTATCTATAAAACTAAAATACCAATTTTTCTCTATAGGTAAGATTGATA
ACAACAAAACAAAGGATTTATACCGTGATCTGATAACCATCTTTGACAAACTCCTGTTGC
CCACCCATGCTTCCTGCCATGTACAGTTTTTCATGTTCTATCTCTGCAGCTTCAAACTGG
TAAGTAAAAATGTCATTTAATCTAAACTGAGGGTATTTGATTCTTGCTGGTAATTTTTTT
GTTTAGACCTGGGGTGCAGGGAGACCATGAATTATTTCTTCCCCTGAGCTCATTGGTTTA
ATATCTTTAATAAAATTACCTTCCTTTTTTTCTTTTGTTAAGAAAGATTTGTTTTATGTG
TTTGAAAGACAGTTACAGAACGAGGTAGAGACAGAAGGTTTTCCATCCATTGATTCATTC
CTCAAATGGCCGCAATGGCTGGAACTGAGCCAATTTGAAGCTAGGAGCTAGGAGCTAGGA
GCCAGGAGCTTGTTCCAGATCTCCCATGTGGGTTCAGGGACCCAAGGACTTAGGCCATCC
TCTCTTGCTTCCCCAGGCGCATTAGCAGGGAGCTGGATTGTAAGTGGAGCAGCTGGGGCT
TGAACTGGCACCCATATGGCACCTGATGGCTGCAGGTGGGGCTTTAACCTGCTGCACCAC
AGTGCTGGCACACACATACCTCCCCCCCCCCTTTTTAAAGATTTATTTATTTATTTGAAA
GGCAGAGCCACGGAGTAGGGGTTGGAGATCTCCCATTCACTGGCTCACTCTCCAAATGAA
CATAATGGCCCAAGCTGTCCCAGGAGCTTCTTCCAGGCCTCCCACATGAGTGCAGGGGCT
CAAGCATTTGGGCCATCCTCCGCTACTTTCCTGGGCACACCACATGGGATGCGGGCATCA
CAGGTAGCTGCTTTACCCACTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTTTCCCAGGCCATAGCAGAGAGCTGGAT
CAGAAGTGGAGCAGCTGGGACTAGAACCAGTGCCCATGTGGGATGCCCGCACTGCAGGCG
GCAGTTTTACCAGCTACACCACAGTGCTGGCCCTCTTTTGCAACTATTGTTTAGCTCTCA
AGAACAGTTGGGAGAGTACTGATCCTGGATAAAAAGGCTAAATCCAGTCTTCCCAAACCG
TTGTGTCCCTGGCTTTAGAAATGCTCTGTTTTTGGCAAAGTTGGAGATTGTGCCTTTTTC
CAAGAAATGTAGTCTGTTTTTTCTATGATTAGCATAATGGATCAAATACCAGGTATGCTG
TAGTCCATGTTGCTGTTCAGTGTGTGAAAAGAATGAAAGGATGCTTTGCTCGCAAAAGGA
GTCCCCTTGTGGACTCCAAAGGACATGAGTGCTCACTGGTTTCCAGTTCTGCTGAACTTC
AGGCTCACTTCGAGATTCTTACAATGTGCTAGTTCCAAAGCTCTGTCCCAGAACTGCTGA
TTCAGAACTTTAGACTTTCTGCCTGCTCAACGATGTCTCAGGTCCATTGGATTATTTAGT
ACCCAGAACATTTTCTATTTTTAATAGAATTATCTCAGGTGTTTTTTTTTTTTTAATGGA
AGTCATGACAGCTGTATTCATTATTCATCTAGCAGTATAGGGGCTGGCCCTGTGTCACAG
TGAGCTAAGTTGCCACCTGCAATGTTGGCATCCCATATTAGAGCACTCTTTTGAGTCTTG
GCTGCTCTGCTTCTGATCCAGCTTCCTGCTAATGTATCTGGGAAGGCAGTGGAAGATATC
CCAAGTGCTTGGGCCCCTGCCACCTACATGGGAAACCTGGGTGGAGTTCTGGGCTACTGG
CTTTGTCTTGGACTGCTGTGGTCATTGCAGCCATTTGAGGAATGAACCAGTAAACCAGTA
ACTTTGCATTTCAAGTGCATAAGTAAATCTTCAAAAAAAGAAAAATATCTAGCAGTATAA
TTGAAATACTAGAATTTTCTTCACATACAGATAAAGTAAAAATTTAAGATTCTGATCACT
GGGACCAGCACTGCAGTGTAGCTGGCAAAGCCATTGCCTGTGGTGCTGGCATCTCATAAA
GGCATTGGTTTGAATCCTGGTTGCTCCACTTCTGATCCAGCTCCCTGCTAATGCGCTTGG
GAAAGCAGCAGAACATGGCCTAAGTCCTTTGGCCTCTGCACCCACATGGGAGACTGGGAT
AAAGTTCCTGGCTCTTTCATTCAGCCTGGCCCAGCCCTGGCCATTTGGCCATTTGAGGAG
TAAACCAGTGATGGAAGATATCTCTGTTTCTCCCTTGCTCTATAACTCTGCCTTTCAAAT
AAATAAAATAAATCTTTAAAAATATTTTGATCACCAGAATGTCTTTCATTTATTTATATT
TACTTAAGAAAGAGAGAATGAAGAGCTGATTGACTTCCCAAATGCCTGCAGTGGTGAAGG
GCTGGGTGAAGGTTGAAGCCAGGAGGCAAGATCTCAGTCCACATTTCCCACGTAATTAGG
TGGCAGGAACCCAAGTACTTGAACCACTACCACTGCCTTCCAGTGTCTGCTTTAGCAGAA
AGTTGGAGTCAGGAGCTGGGAGCCAGGGACCAAACCTAGACAGTCAAATAGGGGACACAG
GTATCTTTCATTGCTAGGCTGAGGCCTAACAACCCCAGAACCAGAGTATCTTAAGCAGTG
AAAAAGATCATACCAGCACCTTCTCTTTAAATAGGGATTCGCAGAAGCATTTTTGGAACA
TCTCTGGAAAAAACTGCAGGATCCAAATAATCCTGCCATCATCAGGCAAGCTGCTGGAAA
TTATATTGGAAGCTTTTTGGCAAGAGCTAAATTTATTCCTCTTATGTAAGTAACCTAATT
TTCCAAGTACTTTTTAATATCATGCTTTAAAAAGATTATAGCCTTGTCTCAAGTCAGAGA
AATACCAGCCTTACTTTTGGTCTATCTTTAAAGTGGTGATTTTTCCCTCAAGTCTATGCA
AGATGCTTGTGTTTCCCAAAAGGAGTTTCACAATAATGTTTCTTCTTCTTCTTTTTTTTT
TTTTTTTTAAGATTTTATTTATTTGTTTGACTGGCATAGTTACTGAGAGAGGGCGAGACA
GAGAAAAAGATCTTCCATCCACTGATTCATTCCCCAAATGGCTGAAACGGCTGAAGCTGG
GCCTGCCAGGAGCTTCTTCCGGGTCTCCCACATGGGTGCAGGGGCCCAAGCACCTGGGCC
ATCTTCTATACCACTTTCCAGGTGGTAGCAGAGAGGTGCATCAGAAGAGGAGTAGCTGAG
ACATGAACCAGCACCCATATGGGATGCCAGTGCCGCAGGCAGAGGCTTAGTGCACTATGC
CATAGCACCAAACCCATGTTTCCTTTTTTAAGCCTAAAATCTTAAATGTGAGGATTTTAT
CATCTGTTCTGTGTGAGCACATTTGAACATGAAGATACATTTATTTTCATGGATAACGTA
CAGTGTTGTGTACTGTGTGATTCTTTTGTAGGTTTCTCATTTTTCTTTTGTATTCCGAAT
CAGTTATATCTAGTAAGGCTGAAAAAAACCCCTTGTAAAGGTAATAGAAAGCTCTATGTA
GAAGGCCGGTTTCTGCCAGTGACCCATAAGGATTTCTTGGGGTAAGGGTATTGTTAAACA
CCCTTCCCAACAAGTGAAAGGTGTCTAGCTCAAATTGGTGGCCCTGAGATTTCAACAGAA
TTCCATAGAGAATAGTGAGGTTAATCGGACTGTTCTTATCTTGTGAGATATTGGCAAACA
TGTACCATTCTTCAGCCATATCCCCTTAGTCGGGTGGGGCGCCCACAGTGAAGCCCTACT
GAGTTGATGGAGAAACTTCTGCATCCTGTGGGACATTCTTAGGGGCTTCTCTGTTTCTAG
AAGGTGGGTGCTGCTCTGCTTTGTAATTGGAAAGTTGTCTTCCCTCCCACCCATCCATTA
CCTTCCTCTGTTTGCTATTTATGTGTTCCCATGGCTAATATTTACTGAAGTCTGGGAACT
TTAAAAAAAATTTATTTCATTTTATTTGAAAGGCTGAGTAACAGAGGAAGAGAGAAAAGG
AAAGATGTCTTTCATCTGCTGGGTCACGAGCCAAGAATTCCATCTAGTTCTTCCATGTAG
GTGTCAGAGGTCTAAGCACTTGGGCCATTATCTGCTGCCTTCCCAGGTGCATTAGCAGGG
AGCTGGATCGGAAGCAGAGCAGCCAGGACTCAGACTGGCACTCTGATATGGGACGCTGGC
ATGGGCATCGTAGGCACAGCTTAACCCACTGCGCCTCGATGCCAGCCCAAAACCTGGAAC
TCATATGATTGTAAGGAAAGGTGTGTGTCTATCTTTATGTATGTAATGTTTTAATAAAGT
TGACTTGAATTTCTCTTTTCTCTAGTACTGTAAAATCATGCCTAGATCTTTTGGTTAATT
GGGCTGCACGTATACCTTAATAATCAGGATTCTGGCACAAAGGCTTTTTGTGATGTTGCT
CTCCACGGACCATTTTATTCAGCCTGCCAAGCTGTATTCTACACTTTTGTGTTTAGACAC
AAGCAACTTTTAAGTGGAAACTTGAAGGAAGGTTAGTGATACGGGGTTGATGGACTTGAC
TGGGTCTTCCTTGTGTACTTCTTACCTGTTGGAATAACAGTTCTTTCCTTGAGAATTTGA
TCAAAACAAAACTATGATTCAGAAAAGCACACATGTACTCAGACTTTTATAGATATTTCA
TGTAGCTCATAGGCCCCTGAAATTCCCTTCGGCCCCCTCCTTGACTGCTGATGGATTTGA
GAACACCTGTCTCAGAAGGGGTTCAGTGTGAAGACATCTTCAGAGGTGAGGCTGAGCAGG
TGACTGAACCAGTGCCTTGCGTAAAGCTCCTCATGCCCCTTGGCCCCTGAAGGGCATTCC
CACTACAGATGAGACCAGCGCGCAGGCCCAGGTCGCACGGCTCCATCCGTAGGATTCCGC
ATTGAAGCCCAATGAGGGTTACTGTGTGGCTGCGATCTCAGTTAGGCTCCCATATCTAAG
ACTTGAAGGTTTTTTACCATTTTTCAGTTCTGCTCGTTTCTATCATTATTTATGATTTCA
ATCTACCAAATGAAACTTATTTATTACATTAGTGTATTTTAGTTGAAGAGCGTCCCTAAG
AACAAGGTAGGGAACTTGCTTTGGTGATTTTCACAGATTAATTCAAACAGCTTCCCAGAG
CAAGTCCTCTAAGCCAGAGCTTCTCAGTCTCAGCATTGTTAGCGTTTGGACTGGAGACTC
CTACATGTGGGGGGCTGTCCTGTGCCTTGAGGGGACTTAGCAGTGTCCCTCTCCATGCCA
GCAGCAACTCCCCCACCCCACCCAGGTGGGACAGTCATCTGCGGGGCACAGCTCCGAAAC
TGAAACTCGGGGTGGATTGTATTCATTTACTTGTATCCTGCGTGCTCTTGAGGGTTAAAA
TTAACTGTGTGAATTAGGCTGCATCACAAGGTAAGTAAAATGTTTATACTTCTTTCTATA
AATAATTGAAGTTGGTCTACTAGACTCTTAGAGGTGAAGTGTCTTTACCAGTGTAGAAGA
GAATTATATTCAGTAGTTCCAAAACAGAGATTTGTCTAAAATTTGCCTTTACCTTTCGAG
TTTTCTTTTTCTTTTTAAAGGGCGATGGGGCAGGTATTGTGACGCAGCGAGTTAAGCTGC
CTCTTGTGATGCCCTTGTTCCGTATTGGAGTGCCTGTTCAAGTCCTCACTCCTCCATTTC
CCATCTAGCTTCCTGCTAATGCATCTGGGAGGGAGCGGATGGTGGCCAAAGTACCTGTGT
TCCTGACACCCACACAAGAGAGAAAGGGAGAGAGAGGATTACAACTAATGTATACCTGAA
CATGCTCACTCTTCATGGATTATTTAAGATGTGCAAATTCAAATGAGGTTGCTGTTTTGT
TTTGCTTTATTGTCTATTTTGGTTGCTGTCTGAACGCCATCCCTCCAACCCCCCCATAAA
CTCAGCATATTATAAGCTTACAAATGTGTGGATTCCAAATTGTTTTATAATCTTATAGCC
TAGGAACACGTGCTTACTTCCTGGGTCTTTTCTGAACTGCTTTGTTTAGAAAAACTGCCT
TTCTTCTTGGAGAATGCAGTTAGCTTTGTGAAACTCTGGGCCACACACTGTGACTCTGTG
GACTTTTTTTTTCTTGTCTTTTTTTTTTTTAAAGATTTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCTTATCTTTATGTTATTGTAATGTTTTAATAAAGTTGACTTGTATTTCTCTTTTCTCTA
GTACTGTAAAATCATGCCTAGATCTTTTGGTTAATTGGCTGCACGTATACCTTAATAATC
AGGATTCTGGCACAAAGGCTTTTTGTGATGTTGCTCTCCACGGACCATTTTATTCAGCCT
GCCAAGCTGTATTCTACACTTTTGTGTTTAGACACAAGCAACTTTTAAGTGGAAACTTGA
AGGAAGGTTAGTGATACGGGGTTGATGGACTTGACTGGGTCTTCCTTGTGTACTTCTTAC
CTGTTGGAATAACAGTTCTTTCCTTGAGAATTTGATCAAAACAAAACTATGATTCAGAAA
AGCACACATGTACTCAGACTTTTATAGATATTTCATGTAGCTCATAGGCCCCTGAAATTC
CCTTCGGCCCCCTCCTTGACTGCTGATGGATTTGAGAACACCTGTCTCAGAAGGGGTTCA
GTGTGAAGACATCTTCAGAGGTGAGGCTGAGCAGGTGACTGAACCAGTGCCTTGCGTAAA
GCTCCTCATGCCCCTTGGCCCCTGAAGGGCATTCCCACTACAGATGAGACCAGCGCGCAG
GCCCAGGTCGCACGGCTCCATCCGTAGGATTCCGCATTGAAGCCCAATGAGGGTTACTGT
GTGGCTGCGATCTCAGTTAGGCTCCCATATCTAAGACTTGAAGGTTTTTTACCATTTTTC
AGTTCTGCTCGTTTCTATCATTATTTATGATTTCAATCTACCAAATGAAACTTATTTATT
ACATTAGTGTATTTTAGTTGAAGAGCGTCCCTAAGAACAAGGTAGGGAACTTGCTTTGGT
GATTTTCACAGATTAATTCAAACAGCTTCCCAGAGCAAGTCCTCTAAGCCAGAGCTTCTC
AGTCTCAGCATTGTTAGCGTTTGGACTGGAGACTCCTACATGTGGGGGGGCTGTCCTGTG
CCTTGAGGGGACTTAGCAGTGTCCCTCTCCATGCCAGCAGCAACTCCCCCACCCCACCCA
GGTGGGACAGTCATCTGCGGGGCACAGCTCGAAACTGAAACTCGGGGTGGATTGTATTCA
TTTACTTGTATCCTGCGTGCTCTTGAGGGTTAAAATTAACTGTGTGAATTAGGCTGCATC
ACAAGGTAAGTAAAATGTTTATACTTCTTTCTATAAATAATTGAAGTTGGTCTACTAGAC
TCTTAGAGGTGAAGTGTCTTTACCAGTGTAGAAGAGAATTATATTCAGTAGTTCCAAAAC
AGAGATTTGTCTAAAATTTGCCTTTACCTTTCGAGTTTTCTTTTTCTTTTTAAAGGGCGA
TGGGGCAGGTATTGTGACGCAGCGAGTTAAGCTGCCTCTTGTGATGCCCTTGTTCCGTAT
TGGAGTGCCTGTTCAAGTCCTCACTCCTCCATTTCCCATCTAGCTTCCTGCTAATGCATC
TGGGAGGGAGCGGATGGTGGCCAAAGTACCTGTGTTCCTGACACCCACACAAGAGAGAAA
GGGAGAGAGAGGATTACAACTAATGTATACCTGAACATGCTCACTCTTCATGGATTATTT
AAGATGTGCAAATTCAAATGAGGTTGCTGTTTTGTTTTGCTTTATTGTCTATTTTGGTTG
CTGTCTGAACGCCATCCCTCCAACCCCCCCATAAACTCAGCATATTATAAGCTTACAAAT
GTGTGGATTCCAAATTGTTTTATAATCTTATAGCCTAGGAACACGTGCTTACTTCCTGGG
GTCTTTTCTGAACTGCTTTGTTTAGAAAAACTGCCTTTCTTCTTGGAGAATGCAGTTAGC
TTTGTGAAACTCTGGGCCACACACTGTGACTCTGTGGACTTTTTTTTTTCTTTTCTTTTT
TTTTTTTTAAAGATTTATTTATTTGAAAGTCAGAATTACACACAGAGAGAGGAGAGGCAG
AAGAGAGGTCTTCCATTCGATGGTTCACTACCCGATTGGCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTT
TTTATTTTTGTATCCAAAGGTTTGAGATATCTTCAAAGTCTGAATTTTGAACGTATCGTA
ATGAGTCAGCTAAATCCTCTGAAGATTTGCCTACCCTCAGTGGTTAACTTTTTTGCTGCT
ATCACAAAGTAAGTTATTTACATTTTCTTCATGGAAGTTATTTAAAAGTAAATTTGTTTC
ATATTAGTATTATAAAATTGCATTAGATTTCTGTGAAATTAATCTCAATAAAACATAAAA
AAAAAAATCAGTTACCCAGTCCCTGCAGGAAGTACTGTGCTGGAGCTATTGTTTTTATAC
TTAGTGGTAGTGGAAATTACCAGTGCTGTTTGACCCTGAGGAGAGCATGCAAGTAATCCT
AGGCACTTCAAAATAAATAAGGAAACTGGGAAGCTGAGAGGTGCATGCCAGAGGAGCTTA
ATAGGGTGGCTTCTGTAATAGTAATAAATAATCTGGTCATGAGACACAAACCCACCCACA
GGAGATTAGTTCTGAGAAGGACTGTGTTACCTCAGGCCTGGTAGCTGTTGTAATACCTGG
CTATGACCGTGACCAGGCGACTCTGAGCGCTTCATCCAGAACTCCTTCAGTCCTCACACA
GCCCTGCAACTGTATCGCTGACCCCACTTGCAAAGGAGGGGATGGAGGCACAGAAGTAGC
TGTGTAGCAACACTGCAGAGCTGAGGTCTGAGAGCATAGTGGCGGCTGTGCACGCTTCGC
TTGGTTCTGCTTCGAGGAGAGAGACCTGGAGAGCCTGGCCGTTTAATGAGGCTGTTCAGG
TGGGGTCCTCACTGATGAAGACAGTTAAGGCTATGGTTGTCTTCCTGCCTCAGTCCCCTT
TAGGCAGCTTGCTGCTGTCATCCAGGAACCCTCATGTTCTTTCAGTAGGCATTTAGTTCA
AGGTGTCCTGTCTCTCGGGGATCTCAGAAATGGTAAGGAAGGATTCCAGAAAGGAATAGA
GAAGCCGACGTGTAGCCACGCTTAGTGGGGAAAAGGTTTCTATACTGCTGAAGAGGGGGA
GCAGCCGGCAGAGTGAGGATAGATGAGGCGGTGACCCCAGAATAATTTAGGGGTTAGGGC
GGAGGACTGCACTCTGGATTTGAGGTTGGCACGTGCAGCAGACAGAAGCGTAGGAGATGA
GGCTGAGAGTAGGAGACAAACAAAGGTCTGTGCCCAGTGGTCCAGGGACCATTATGTTGC
TGCTGTTTTTCTTCATGGTTTTGGGATGCAGCCATAAGACGTGTCTTCACAAAGTTTACT
GAAGGTGTGGGTATTACAAAAAAACTATGCATGGATTTCAGTTCTTTTCAAACCCAAATA
AATTTGTCTTTTAATACCATTTTTCCTATGAGGTTTTTGAAATCCCCTTGTATTGACAAC
TATAGCTTGTTTTGATTTTAACTGCTGTGGTATAGCCTATTAATATTTTTAGAATTAAAA
AAGTCTTTGTCGGAATTTGATTTGTATTTGGTTTTTTGCTTCAGTACTGGGTACAACAGC
ATAAGATTATTCTTGTGTGTGTGCCCTCGTGTACAGGCACATGTTTCTTGTCACACAGGT
TGTAGGAGATGTAGATCTCATACGGTTATGTTGGTTTTTATTATGTTCTTCTGTTTCACA
TCTCTAGCCTCACCGTGCCTATTCCTTTTCCTACCCATTACTTGGTCAACCCCTTGCCCC
GCTTTCAGTAAAGTCCCAATTTTCTATTCAGAAGCAGCTAAGTCTCCTTCAGCAGCCCCT
GTTCCCCCTCACTGACTCTGGAATCCGTGGTGTTTGTTCTTAATGTTTATTATTTAAAGA
AAATCTTTTTAACCTTTTACCAACTTGAAAGGCAGAACAGTACAGAGACAGAAAGATTTT
CTGTCCTGGGCAAGCACTGTGGCTTAGTGGACTAAGCTTCTGCCTGTGGCACCGGCATCC
CATAAGAATGCCAGTTCCTGGCTTCTCCACTTCCTAACCAGCTCCCTGCTGATGGCCTGG
GAAAGCAGTGGAGGATGGCCTAAGTGCTTGGGCCTCTGCACCCACTGGGGAGACCTGGAT
GAAGCTCCTGGCTCCTGTCTTCAGATCAGGCCAGCTCCTGCCGTTGAGGCCATTTGGGAA
GTGAACCAGCAGATGGAGGACCTCTCTCTTTGTTTCTCTCTCTCTCTGTAACTCTGCCTC
TCAAGTAAACAAATAAATTTTTTTAAAAGATTTATTTACTTATTTATTTGAAAGGCAAAG
TTAGAGGCAGAGGCAGAGAGAGAGAAGTGTTCCATCTGCTGGTTCACTCCCCAAGTGGCT
GTAACAGCTGGAGCTGCACCAATCTGAAGCCAGGAGCCAGGAGCTTCCTCTAGGTGTCCA
CGTGGGCCCATGCACTTGGGCCATCTTCTGCTGTTTCCCCTGGCGATAGCAGAGAGCTGG
ATCAGAAGTGGAGCAGCTGGGCCTTGAACCAGAGCACATATGGGATGCCAGCACTGCAGG
CTGCGGCTTTACCTGCTCTGCCACAGTGCTGTCCCCTAAATAAATAAATTAAAAACAACA
AAAATAGATTTTCTGTCCACCAATTCACTTCCTGAATGCCTGTAACAGCCAGAGCCAGGC
CAGGCCAGGCCAAAATCAGGAGCTTGTAACTCCATCCAGACACAGCCATCATCTGCTGCC
TTGCAGGAAGCTGTATCAGAAGTGAAGTTGCCAGGACTCAGACCAGCCTCCAGTGTATGA
TGCAGGCATGCCAAATGATGGCTTAACCTGCTGTGCCACGATGTCCGTCCCAAGAATCCC
TTTTCCACTAACCCCGGTTCTTTTGCAAACAGCAGAAGTAAAGATAGCTATATAATTATG
CGTGTTAAAAGAGTTTTACCTGGCAGACATACTGATATTTTTTTTTTTGGTAATGCCTAT
TGATCTAAGTCCAATTTCATATTTTAAGTGAAAGCCACATTTTCTTTTTCCTTAAAAGGC
TTGTTAGTCCTAGGCTCAAAGTACCCTGAAAGCATTACTTCCTGCTTTGTGTTGTTTTTT
TCATGCACTTGTTCTGTCAACATCTGTGTGCTCCGTGCAGTTGTGACATGTAAGTCACAT
CCATGCAGTGATTCCAGCATGGTAATGCCTCCATCTGTGTTGATTTTGGTGTCCACAGCA
AATACCAGCTCGTCTTCTGCTACACTATCATTGAGAGGAACAACCGCCAGATGCTACCAG
TTATTAGAAATACAGCTGGCGGGGACTCGGTGCAGACCTGCACCAACCCACTTGACACCT
TCTTCCCCTTTGATCCTTGTGTGCTGAAGAGGTGAGTACCTTAAACAGTCAGTGCTGCCA
GTGGTGAGTTTGAATGTGATGTGTGTTTGCTCTTCCCAAGGTTGGCTTTACAGTTTCTTT
GCTGAAGCGACCCTTCCTAGCTCGTTATTAGAGTCACATGCTCTCTTGGCATGGATTTCC
CAGGCCACATTAGAGATCACTTGCAGGGTCTGCTGCGTGTCACAGGCATACCAGGGTCTG
TAGATCTTTTCTTTAGTAGGAACACAGATGGACACAAAATGGTTTTCTGTTCTTTAGGGG
AAAAAAAAGTTGATTGAAATGTATGAGGGGCGGCAGTAAAGGCACCAGGATAGGGAAGTG
CTATGTGCTCTTGGTTTATAATTTTCTGCCGACCTGTTCCTTCCTCCCGAGACCACGTCC
CATTCTGTTGCATGGGGTAAACAAAGGCAGGTGGTTTATCTAGGGGGTTATTCTGGAACC
CTCCAAACGAGTCTTAACTCTGTATTTAAATAGGGAAGCAAGATTTTTGCTTGTTACACG
GTTTTTAACTAGCAGCGGGCCCTTCTGGAAGTGTGTGGTCTCCCAGGCCTTGATGGACTG
GAAACAGAGTAGTTGTTGTTCCTAGATGTGTTTTTCAATATGAAAGAAAAAAAGATATTC
TAGAATATTGTGATTTAGTTTTCATTTGGTTTTACTGTGATTCAGCTGGCAGTTACTGTG
AATCAAGAATTTCACCTGTAAATGTAAAGAGGAGAAACAGTAGGTATGACTGTCCATCTA
AGTGCATATGTGAACCTCTTAACACAGCATATTAGCCAACTGGTATTTTTGGACATTATT
ATTATAACTGTGATTTTTACTCTTGTTTTTTAGAAAGTAACTCTTATGGAAAAGAGCTAA
ATACACTTTTATTTGTGTTGAATTATTTAACTTGACTATGAATTGTGGTCTTTGTTGACA
GGTCAAAGAAATTCATTGATCCTGTTTATCAGATATGGGAAGACATGAGTACTGAAGAGC
TCCAGGAGTTTAAGAAGCCCATTAAAAAGGTGAATTTGTCATTCAGCATGCTTTCTGGGA
ATCTCCCTTATGGTCAAGGTCACAATCAAATGTCCCACTTAAAAAGCATTCCATTTTGGA
GTGAGTATTTCACCATCTCACCTTGGAGTGCCTGAGTATGATACCCGTCTCCAGCTCCTC
AGGTCAGCTTCCTGCTAATGCACACCCTGGGAGGCAGCAGTGACGGCTCAAGCAGTTGGG
TTTCTGCCACCCACGTAGGAGACCTGGGTTGTGTTCCCGCCTTTGGCCCCAGCCTGGCCG
ATATGGGCACTTGGGGAGAAACAGTGAACGGGGGTTCTCTGTTTCTCTCTTCATGCTCTG
TCTCTCTGCCTTTCAAAACAAAACAACACGAACAACAACAAAAGCTACATTTTTACTCAT
TTTGCATTTGTAAAGTTCCAAGCCCAGATTATGTTCTTACAATTAAGTTTTTGGAGGATT
TTTAAAATTTATTCAAGAGGCAGAGAGATAGAATGAGAGAGCTCTTAGCTGTTCCTTCAC
TCTAAATGTCTGTTGTGGCCAGAGCCGGGGCCAGAGTCAGGAACGCAATCCAGGTTATCC
ACGTGGATGGCAGGAGCCCATCTAACTACGTGAGCCGTGCCCGCTGCCATCCAGGGTCTG
CGTGAGTGGGAATCTGGACTCAGGAACCAGAGCCAGGACTTGAACCCAGGCGCTCCATGT
GGGGTGTGAGCGTCTTAACCACTAGACTGAAACCCACCCCAAATTCTTCGTGTTTTGATG
AATTATATAAACCAGACACTTCACATACTGACTTCAGGAAGTGGAGATGGAACTTAGCTG
AACACATTTTTAGATCTTTACCACTTGTTATCTCCCCTAAGTAAAATCTCCAGTTGATTG
CTTTATGTTAAGGTTATTTCAGAAGTTACATCAGTTGTCTTGGCCTTCAGGAGTGGGGGT
GAAGAGGCAGATCCGCAATGTGACCTCCAGTAGCACAGGGGCTGTGGCAGAAACACGAAG
GCCAAAGGAGACAACAGAACCTCATGATGATGGCATTATTCTGTGTTTTTGTTGCACGTT
TATTTCCACGTTACAGCTCAGCCATAGTGTGCCTAATCAGTGGAATGCCCTGCCACGTGC
CAGAACCAGACTTTACACAAGCCTTGGGCAAAATGAGAGAAGCCGTCATAAGAGTGATTT
GGTTTATTTTTTGCTTGTTTTATTTGTTTATTTTAGATTTTTATTTATTCATTTGACGGG
TAGAATTACAGACAGTGAGAGAAAGAGAGAAAGGTCTTCCTTCCTTTGGTTCAACCCCCA
AATGGCCACAACAGATGGAGCTGCGCCAGTCCAAAGCCAGGAGCCAGGTGCTTCTTCCTG
GTCTCCCATGGGGGTGCAGGGCCCAAGCACCTGGTCCATCCTCCACTGTCCTCCCAGGCC
ACAGCAGAGAGCTAGATGGAAGAGGAGCAGCCGGGACTAGAACTGGCGCCCATATGGGAA
GTCGGCGCCACAGGTGGAGGATTAACCTAGTGCGCCGTATGAGCGATTTGTACTGTGGAA
CTGGGTTTACTTTTTGAAATTAAGATATTTTCTTCGTCAGCCGGTGCCGCGGCTCACTAG
GCTAATCCTCCGCCTTGTGGTGCCGGCACACCGGGTTCTAGTCCCGGTCAGGGCGCCAGA
TTCTGTCCCGGTTGCCCCTATTCCAGGCCAGCTCTCTGCTGTGGCCAGGGAGTGCAGTGG
AGGATGGCCCAAGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAGAAGCACCTGGCTC
CTGCCGTCGGATCAGCGCGGTGCGCCGGCCGCAGCGTGCTGGCTGCGGCGGCCATTGGAG
GGTGAACCAACGGTAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTGTCCACTCTGCCTG
TCAAAAAAAAAAAAAATTAAAATGTAGTTATAAGAAATTTTTTTTTCTTCGTCATTTTCA
CATTAGTAGCACATTCCTGAGGAAAGGAATTCTTAAGCTTTTCAAACTGCCGGTGTATCC
CAGCGCTCACCTCTGTGCTTTCTGCAGGAGGTGGTGGAGGATGAAGATGATGACTTTTTG
AAAGGTGAAGTGCCCCAGAATGACACGGTGATTGGAATTACGCCCAGCTCCTTGGATCCG
CATTTCCGAAGCCCTTCAAGTAGTGTGGGATCCCCGCCTGTGCTGTACCTGCCCGACCAG
TCCCCTGTGAGCACGAGGATCTGTGACTGAGACAGACTTCTCCGCATTGCAGCCATCAGG
ACCCAGGTGCACAGTGTTAGGGTGGCATTGAACCGCAGTGAGTCGAGGTCTCAAGTGACA
CTTCACCCAGTGTCTGAGCAGACGTTTTGCTTTGTTTTTATTCCCTGTAGAGACAGAAGT
TGGGAAGACTGAATATCATGTGCAATATTTTACTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTATCTGTGTGTTGGGATCTCAGTAGGTGCAGAAAAGATAGAAGGAGAGTGGG
AGAGGCCAGAGCTGGTCCAGGACACTCAGGTTTGGAGCTGGCCCTGACGGTGATCCCAGG
GACTTCAGAGACCCGTAACAGCCAGAAGTGGGGAGAGAAAGGATTGAGGGGAACAGAATG
ATAACAGATATATAACAGATAATATACTCAGCACAGTAAAAAAACGGATTTAAAAGAAAA
ATGGAGGTCCAGGTGACTGCCATTGATAAAGACTGGAAATGAGCTTGAACTCTGACTGGC
AAGATCCCATTAGACCTGAGACTTCACACCTGCAGCAGGTATGTCGAGTTCTTGTTGACC
AGCATCAGTTGGTTTTTTTGAGCATTTTGTCCACATGGAAAAAAACATTTTGTGCGTGAT
TTGGTGGCAGTGTTTTGCCAGATGGGCCCAGAGTTACCGTGGCTGTGCGTGGTACGGATG
CAGCCCAGTGAACTCTTTTCTAGCAAAGACTGCGTTTTTATAACTAAACCCTGAGGGGGG
TCTCCGACATCCTCGCTGTCAAACCACTTGTGTGCAAAGTCTGCCAGAGGCCTTTTGGAA
CTCCAGCATATGCTCCCTTGGTTCCTTCTGTGTATACTTCTTTATTTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1058, 1904..1967, 15567..15636, 15737..15835, 15936..16028, 16129..16267, 18326..18456, 21312..21442, 22983..23019, 23021..23168, 38457..38565, 41556..41708, 42639..42726, 44765..44908, 44910..44927
1001..1058, 1904..1967, 15567..15636, 15737..15835, 15936..16028, 16129..16267, 18326..18456, 21312..21442, 22983..23019, 23021..23168, 38457..38565, 41556..41708, 42639..42726, 44765..44908, 44910..44924
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved