Oryctolagus_cuniculus Locus ENSOCUG00000000525
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000000525
Oryctolagus_cuniculus
ENSOCUG00000000525
GeneScaffold_3177
SNORA74
8708..8914
12252
CATCCCGCTCGGTCCACCCAGACACACACAACGGGATGCACAAACGACTACGGGCAATT
TCCCAGTCCAAGCAGGGAAAGCAAACAGGTGGCGTCTTTCGCCATCTCCAGCCGGAGGCT
GTCCCACTACCAAGCGCACCGCGGAGAACCGGGCCCTCCGCGGCCCCACGAGTGGCCGCA
GCGCGAGTGCACCCCCGCCCCGGGCCCACGAACTGAGACCAGGAAGAGAGGGTCGGGCCG
AGACGAAGAACACAAGACTTTCACTCCCCCCCGCCACGTACCAAGCGAGGTGGCGCCGCC
TCTGTGCGGTCCCGCCCGCCCCGGGACGCAGCCGGGCGAGGGCGGTGGGACCCTGAACCG
CACCGGGGCGTCCTTGGGGTCGAGGACGCGCCTCTGCCTGCCGGGGAAGCTCCGGGCGTC
CGAGGCGGCCGGCGGAGAACTTGCGGCGGTGCCCCAGCGGGGTCGCTTGCTGCAGGGCTC
ACAGCCGGGGCCCGCGCTCATGCTGGGACCCGGAGCGCGCAGTCCCCGGGCCGGCCCGGG
CAGAGAGCCTCATTCACTAACCCTGAGACGGACAGACTGCGCCTCGTTCTCGGCGCCTCC
CCGCACCATTCCCTCTCTGCCGCTGCCTGCTTCCGGAGTTGCGGAGCCGCCAATCAGGCC
CTGGGCATCGCCTGCCTTCCCTCTTCCTCAGACACCCCACCTGGATGCGCCGCTTTGATT
CCGGCTCCGTTCACTTTCCCACCACCGGAAAGCTGCCGTCAAGCGACCTCGACTTCTGGG
ACGCACACTGCCGCAAAACGGAAGTGTGGCGCTTAGCGAGAGCCGGCGCCTGGAACGTCA
GCGTGTGAAGGAGGCAGTGGCACCGTGGGGCTTCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAGCACACGAGAGGTTGGCAGCGACTACATGTAGGGCGTCGAGAAGC
GCAACAAACCACAGGGGGCTTGGCTGGCTTTTTCGGAGCCGGCGGAGCAGGTTACTCGCA
CGCAGACCTGGCCGGCGTCCCGCGTGAGTATCGGGTCTGAGTCCACGCCGCAAGCCCTGC
TGGTTTTTTTTTTTAATTAGTTAATTTATTTTTTGGTGGTCTGCCCAGGCTTCAGTGTTG
GCAGTGGACCTGCAGGCCGCTCTTTTCAAAATGGCCCGAGCTTTTAAGGCCGCGCGCTCT
GCATCACGGAGCTGGGCTCTGAGAGGGACACGTGTTGGTTTTTTTTTCTCGTCTGTATCC
GGGCCTCGCGTTCCTTTACTGCCATCCATCACGGTCCCGTGGGTTGGCCCCGGGTACAGA
GGCGCACCGGGCTCTGGGAGTCACCGTTTCAGGCTGGGAAGCCCCGAAGTTCGCTTTTAC
TCACTTAAAATCTGGGTCGTAAATCGATTACACGTAAAAGAAAGTCAGAAATAAGACAGG
GGCTGGGGAGTCAGCTCGGAGGCTGTCTTGGAGGAGCCGGGAAATGGGCTGAACCTGACC
GGTGCTTTGTAAACGTGGTGGGGGCAGGGGAGCCGGGAGAGGATTGGGGGACGGGGGATA
ATGTGACATCTAAGTTGGGGAGGTGCGAACGCTCTGCCCTTGGCTGGCCTCGACCCGTTC
CTTGGGACCTCGGCTCGTACTATTTCTCTAAGTCCGTCACCACCGATGCCGAGAATACAG
CTCCTTCCTAAACCCCGGGCCCTGGCAGAGGTGAATTAGGCGCCTGAAGATGCCCTCCTT
TGGATGAAGTGGGACATGGGACAGGGCGGCGCCGACTTTGCTGGGCGCAGGGCTTGGCGG
CGGCTTCAACAGAAAGAGGACTGCTGCTCTGCCGACGCTTGCGTGAGTTAAAATCCTGCA
GGTCGTGCTCAGCCGGGCAAGGGAGCAGGTGTAGAACAGGGTTGTGGGACGGTACCGCTC
GAGAAAGCAACAGCCCAAGAGCTTGCAAAAGAGGTAACCTTCTGGGTTCTCTAAAGATAA
TGAAGTTTCTAAAAGGAGAGAAGGGAGGAAGGTGGAAAAAGCAGAAAACGCCTTCCAGAA
GCAGTAACTTGGAGCAGCCCCTGTCTGGTCTGTTGAGGAGCCGTTTTCTTAGTTTTTTCA
TTTCATTTTATTTTGTTTTCTTTTTCTTTCTTGGACTAAACAGGAAAAGAGGAAGAGGGG
TGGGAGAGTGGGTACAGTGGGAAGAATTACTGTGTTCCAGATGTTATGAGATACATACCA
ATAAAAAAAGACAAAAAGCAGCAGGAGAGCCCTCCCCTGACAGTAATAGCAGGGCCTAGA
AGGGAAGTGCCCAAAACACAGCGACTTGGAGTGTGCAAACAGCTGTTTGGCCAGCAGGGT
AGAAAGTGATGAGAACCAGGTAGCCCTGTTTGGATTGATGACAGGGGAGCCCCAAGGCTG
CTTTCCCTTTGAGGAAGTTCCTCTAGTAGCTGTGTAGAGTCAATTGAAGGAGTGAGGGGA
AGGGACAGGAAAGTTGTTTCTAGCCGGCGCCTCAGCTCACTAGGCTAATCCTCCGCCTTG
CGGCGCTGGTACACCGGGTTCTAGTCCCGGTCGGGGCACCGGATTCTGTCCCGGTTGCCC
CTCTTCCAGGCCAGCTCTCTGCTGTGGCCAGGGAGTGCAGTGGAGGATGGCCCAAGTGCT
TGGGCCCTGCACCCCATGGGAGACCAGGAGAAGCACCTGGCTCCTGCCATCGGATCAGCA
CGGTGCGCTGGCCACAGCGCGCCGGCCACGGCGGCCATTGGAGGGTGAACCAACGGCAAA
AGGAAGACCTTTCTCTCTGTCTCTGTCTGTCTGTCTGTCTGTCTCTCTCTCTCTCACTCT
CACTGTCCACTCTGCCTGTCAAAAAAAAAAAAAAAAAAGTTGTTTCTGAGAGATTTGATG
GTTGGACTAGGATGTTAAATAACAAAATTCAAATTAGATACTGAAAACGGAAATAATAGG
ACTTTCAGATTGATGATGAGAGTGGTGGGCAGCCATCCGAGATAGAGAGGATCCAAAGCT
TCAATTTAAAATTTGGTAAAGTTGACTTTTCTTGATAGATTTTTTTTTTGCTTGCCTGTT
GTCAAAGTTGGTGGAATTCAAGTCTGCATCAAGTTTGCATTTGCTTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGTTCTGTAAAAAAGCTGAAGCAGTACATTTTTCTCTTGTTAGTCCAGATGATTA
TCTGGGATAGAAACAATGTAAATATTTCCAACATTGACCGTGTCCACTGCATGTGATCTC
AGCCTTCTGTTTCCTCACGTACACTGCCGTGCATTCTTGGGCTTGTTGCTCTTCTGTATT
AGCAAACGCTGGCACTTAGAGTATTTAGTGACATGGGTTTCCTAGAGTTCGGCAGTCCAA
GTTCAATGAACACTTTCCCACGTATCTTCCCTGGATTCAGTGCTGTGACGTCAGCCTTGT
TTGTGCGGGATTTGCTTCAGCTCTTGTGACTTCTCACTGTGATCGACACTAGCTTGCTTG
CTTGCTTTTTTTTTTTTTTTTTTTTTTTTGACAGACAGAGTTAGTGAGAGAGAGAGAGAC
TGAGAGAAAGGTCTTCCTTTGCCGTTGGTTCACCCTCCAATGGCCGCCGCGGCCGGCGCG
CTGTGGCCGGCGCACCGCGCTGATCCAATGGCAGGAGCCAGGTGCTTCTCCTGGTCTCCC
ATGGGGTGCAGGGCCCAAGCACTTGGGCCATCCTCCACTGCCTTCCCAGGCCACAGCAGA
GAGCTGGCCTGGAAGAGGAGCAGCCGAGACAGAATCCGGCGCCCCAGCTGGGACTAGAAT
CCCGGGGTGCTGGCGCCACAGGTGGAGGATTAGCTAAGTGAGCCGCGGGGCTGGCAGCAC
TAGCTTAACACTAGCACTTACTCTTGCTGGATGATGGTCATTACAGCCATTTAAAAAAAT
TTTCTGTGTTTACTCCGTGGTGTGTTTCTGGATTGAAGGATAATTATTTACCTTATGTGG
TTAAATATAACATTTCTAAAAATCTCAAACAAGAACATTTGGTATGACAGTGAAGAAGGA
CACTGCTAGCAGTCACTACATCCCATGTCGGATGCCTGGGTTTGAGTGTCAGCTCTGCTT
CTGGGTCCAGCTTCCTGCTGGTGTGCACTCTGAAACGCACCGTTTAATGGTTCAGTACTT
GGATCCTTGCCACCTTGTGGGAGACCCAGATTGAGTTCTGGGCTCCCGACTGGCCTGGTT
CAGCACCAGTTGCGAGGATTTGGAAAACGAACAAGCGGATAGGAGCTCTCCCTGCCACCC
CGTGTGTGTGTATGTGTGTGTGTGTGTGTGTCTGCTTTAAAAGTCAAAAAGCCCCCAAAA
TTGATAATATGATGTACAATATATCATGACAAGGAGCCTACTCAGCTTACTTATTGACAC
CCAACAGATCATTTTTGTGTGATAAAACTAGATATGCTTGTTTATTTATTTATTTTTAAA
GATTTTATTTTTATTTATTTGAGAGAAAGATTTACAGACAGTGAGAGGGAGAGAAAGAGA
GAAAGGTCTTCTATCTGCTGGTTCACTCCCCAAATGGCTGCAACAGCTGAAGCAAGCCGA
TCTGAAGCCAGGAACCAGGAGTGTCTTCTGGGTCTTCCACACGGGTGCAAAGGGCCCAAG
CGCTCAGGCCATCTTCTGTTTCCCCAGGCCATAGAGAGCTGGATCGAAGTACAGCACCTG
AACTTGGAACTGGTGCCTGTATGGGATGCCGGCACTGTAGGCGGAGGATTAACCTACTGT
GCCACAGCCCTGGCCCCAGTATGCTTATTTATTGTGGGTTTGGTGAGGATGTGTGCATGT
GCTTAAAATCAGAAATCCGCATCAGAAATGCATTTACCAAGGTTCTTGTTAGTGGTCTCT
ACTGTGTTAATTGTGGCACTTTTGTTGGCCATTTTTGCATAAAAAGCTTGGCAAAGAGTT
GAGTGTGATCTTCAAGGTCAGTCATTTTGTTGTGCTCAGCGCAGGGTTTTAGATGACCTT
CCAGGGAATTATGCCAAGTTTTTGTGTGCATTTACTGGAAAGAGGGTCTGCTGTTTTCCA
GGATAACCAAAGTCTGACATGTTCCTCAGACTCTGAAGAATTGTTAAGGGAGTAGTTGAG
TTTTAATGGTCTTAGCTCATTTTTATGATCATGTGGTCGTAAACACAGCAAGATTGTGCT
CACTAAATAGCTGTGAAAAATGAAAGTTACTGTCTCCTTCCAGATGGGTAGTCAGCCAGC
TGCTTCTCCTGGTTTTCAGTATACCATCTTCTAGAACTGTCCTTTTTAAACTGCTTAACG
CTGTTACTTTAAATGTATCGCTTAGTAAGGCAGATGACAATCAGCCACATTTACATTAGG
AAGGAAACACAATGATTTATTCTTTTCTTTTCAAAAAGTTTGAGAGGAGTTCTTCCCTCC
GCTGATTTACTTGCTAAAAGCCAACAGCTGGGGGCTAAACCATGGCCAGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTATTGGAGGATGTTGCATGACAGG
TGGGTGTAATAATTTTTCTTTTTTAATTAATTAGAGAGGCAGAGTTACAGAGAGAAAGGT
CTTCCATCTACTTGTTCACTCCCTAGATGGCCGCAACAGCTGGAGCTGGGCTGATCCAGA
GCCAGGAGTTTCTTCCAGGTCTCCCACGTGGGTGCAGGGGCCCAAACCTGGGCCATCTTC
CACTGCTTTCCCAGGCCAAAGCAGAGAGCTGGATCGGAAGTGGAGCAGCTAGGACTCCAA
CCAGTGCCCATATGGGATGCTGGTGCTGTAGGCAGAGGCTTAGCCCACTATGCTACAGCG
CTGACTCCAGTAATTTTTTTCTTAAGTGTCCTCTGTTCAAGTAGTTGATGGCACTTAAAA
AGCAGTTAGAATACTAGATTCAGGGGTTCTTGTGAAAAATTATTTATCATCATATTAAAA
TTTTAAAGTCAGAAGTGCAGTTTTTAAATGTAATGCTGTATCATTTGGCTGAATTATTTA
TGATTTACCAGGGGCTGCATTTGGGGCAGTGAACGGTCTTCGGCTAGGATTGAAGGAAAC
CCAGAACATGGCCTGGTCCAAACCAAGAAACGTACAGTAAGTCTTGTACCCGTCTGATGA
AGTGGTGGCAGGATAGCAGCGTCTGCTTTGTTGCTTTGATGGGTATAACCTTGCAAATAC
ATGAGCTTTACAAATGTTTGCAGTGTATGTTAGTTTTTTTTTTATCCCCTCCCCCCATTT
TTAAATCTTACCCAAAATAAAAGGCAAAAAGAAGATCAGATTGATGAGTGCAAGTCGGTG
TCTCGTAGGCAGCCGCTGCTCCCCTAGCCCGACTTCCCTTGGCCCACATGACACGCTCGT
CAAGTTGCTGGTTGCTGATGAGAAATGCGTGGGCCAGGGCTGTGGGAAGGGACATGAGCA
GCATGTGAGCGTGACACTGGGTCTGCCGTCCTTGAGCTCGCTGACTTCACTCCCGGCCTG
AGGTGGAGCTCCACAGAAACTAATGCCATTCCTGGACCCCAGGGGCAGTTGCACAAGGAG
AGGGCAGTCTTGGTTGGGGAACTGCGCAGTCCATGGGCAAGGGAAAATGCCATTAGAAGG
GTTGGAAGGTGTCTGAGATGTGTTTTCATCCGACCTAAGAAGTAGACAGGCTCGAGTCCC
CGTTGGTAGTGCATCGTGCAGTTCTGCATGTGTTTGTACTGCATGTAAGTGGAATTGCAT
AGTAGGTGTTCTGCGATGGCTCATGGTTCAGTTGCTGGGATTCTGAGCTCTTAACTTCCT
TACATACTGTTCAGCCAGCAGGTGGCAGCAGGTGCACTAGAATTAAACTTGGGAAACCAA
CAGGCCTGTCAAGTTCTTCATATTCCTGTCACTGTGTGGATTGCTGTACTTACAATATCA
GTGCAGAATCTTCAATTTTAGCTTTTTGTATTATGGGGCATTTTAAATATATTCAAAATT
AGGCATATATATATTCAAAAATATATTCAAAAGTTGGTATAATGAACACGTAAATCATAG
TCCTCAACAGCTGTCAGCCATGACCAGTTGGGTCCCATTGCCTTCTCACTCCTAATATTT
GAAACAAAGTTTTAAACATTTAAATATGAATTCGACAGTAGACGGTATCCCAGAAAAAAT
AACCTTCATTTTTTTAAACAATAGTAGTTATATAATTAATTAATCCGTTCTCCTTACGTG
GGGAGATAGCATTTAATAATGGAAAAAAGGTGGGATTTAGAGCCACGCACACGCAGGCAG
CTGCAGAATCCTAGTTTCATTACTGCTTTGTGATCTTGGCTAAGCTTTCTGTACTTTCTG
CCTTTAAGAACTGAGAGATGATATAAAGTGAGAAGTAGGTAAGGACTTCATAAGTACAAG
TATGTTACCAAGTCATACCCCAAGGAGTTTTGCCAGTACAGTGCCACTAGCAGTACAATA
ATGACATTGGCTTTAAAGCTTATTACAAAGGGAAAAACAGGCCGGCGCCGCGGCTCACTA
GGCTAATCCTCCGCCTAGCGGCGCTGGCACACCGGGTTCTAGTCCCAGTCGGGGCGCCGG
ATTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCCCTCTGCTGTGGCCCGGGAGTGCAGTG
GAGGATGGCCCAAGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAAAAGCACCTGGCT
CCTGGCTCCTGCCATCGGATCAGCGCGGTGCGCCGGCCGCGTCGCGCTGGCCGCGGCGGC
CATTGGAGGGTGAACCAACGGCAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTCTCTCC
CTGTGCACTCTGCCTGTCAAAAAAAAAAACAAAAAAACAAAAAAACAAAGCAAACAAAGG
GAAAAACAGTGTGCTGAACTTAAAATATTTATTAGTGAGTAAGTAACATAGTTACTAATC
TTTTAGAAGTAGTACCACATTTATTAGGGTAGAACATTAATTAAATGAGTAGTTTTACTT
CCATAATTTCCAGCAGTAGTCAGCTGTCCGGACAGATCCATTCCTGTGACGGTGTTACAC
TGCTGGGAGAGCAATGTCTTGCCTTCTTCATCTAGTTGCTTCCCTCACCGTTCTGGTGGC
AGGTGGCACTGGTGCAGGGCAGAACTGTGCTTCCTTGAGAGTGTGCTAAGCATTTCGTTT
TTTGGCTGCTTAGTTCTAGTCTGGGAGCAGACACAGAGTGCTTGTCTATGTGTTCTACTG
AGACAGCTCTTTGCTTTTCTTTAATTCTACTTTGTAATTCTTTAATACTATTTAGTATTC
TAAGTATATACTCCTCTCCCAAAAAGAGAGGGTAGTTTGTCATAATTACAGTGATATTTT
TTACATAAGTCAGTTTCTATATGCTTCTTTATAAAATCTGTTCCAGGCTGTTCCATGAAG
CTTTGCATATTTGGTATGTGTTTTATATATTTAATGAGAGAGTTTTCCTCAGTGATTGCT
CACACTGTTGAATGTTTTACCCTAACTTCATTGGAATATAGCCATCATAAAGGTGACATC
TGAAAAGGTATTAAAAAAATTTTAATTTAGAAAACTTTGAGACTTATTTACTGGCATTTG
TAATAGCTCCTGTTACGGTTTTTGAAGATTACTAGAGAAATAATGATTCTGAATGCTGAT
TCTTTCTCCTTGTTCTCCCCTGGTAGGATTTTGAATATGGTGACTAGGCAAGGTGCACTT
TGGGCTAATACTCTAGGATCTCTGGGTAAGTAGAGCTCTCCTTTGATAATAAATTGTTAA
TGTAAAGAAAAAACATGCAAGTATCATGAACAGTTTGATCAACCAGAATTCTGGTCTTAG
TACATGAAACGTCTATGTTTAGATCTACTGTGGTGAACCGTGTAGATCCAACTTAGGGAA
AGACCATGAACTATAGCACAAAAACTCAGGTGCTGAGACCTTTCTAAATACCATTTTGAA
TGTTTTAAATCTTTAAAAATCCCTGCATACTTTCCCTGTCCAAGCAGGATACCACATAAA
ATCATTTGTTCACACTAAATGTAATCCAGATATTTAGGTACAAGGCAAAGGGCTTTGTGT
GTGAGGAAGGGTTCAAAGTCCTGTCATGGGGCCTGGGAGATTAACCCAGCCTTCCTACTA
TGTTTTCTTAATAGCTGTTCAGTCTGTTCCCTGAGTAGATTCTGAGGCCCTAATGGGTTC
TTTGTAGATAATAGAAACATTTGCAGTTGTAGGCAAGGGGTAGTGTAGTGATGCCTAGTC
AGAACCAGATGCCTGTCACACCATATTGCGTGTGAGTGATTGGCTCTCCTGATTATAGAT
GACTTACAGTAGACCTACTTGGGGCACATATGCCCTGAGAGTCAAGGTTTTCACAATGTA
TTAATGTGGTTGAAAGTCCAAATATCTTTTAATTGTGGTAGATTAAGTAAGGCAGAGTGT
AGATAATTTAAAGCTAGGAAAAGCCTCTGTTGTGACTAAGACCCCTGCCGGTTGTGGGAT
GTGGAGGCTGTAATCAGATTGGTGTATTAGATCTTTAGTGGCTACTTCATATGCACCTGC
GTTCCTCTGACCCCCTTCACATATCACTCCTCTTTCTGTGGTTTTAATTGGATACCTAGA
GTAGCCAGGGACTTTCTGCATCTTGGCACTGCAGAGTCCCCCATTCCAGGAACTTGTCCC
ATCCTCTATACATTGGTATGGCTCATTGCACACCTGTTCCCTTGTAATGTGACCGGTCCC
AGTGTTCTGTTCATGTTCAGTTTCAGGTAAGTTTGAATGTGAAGATGATTATCTGTAGCA
GTGTAAAAATACAACCACAGAGGCTGAGCTTAAGCAAGTGTTGGAAGGGTCACGTGTAGC
TAGAGTTTTGAAAAAGAGTAAGAAGGTTTAATATGTTCATGCCTGAGAAGAATCTGCGAA
GGCATGGAGGAAGGGTGATTCGGGGACTGATCTTTAAAGCTAAATGGTGCTTGTGTTACG
GTTTTTATACACATGGGAATCAAACCTCCCATTTTTTAAAATTGTGTTTTTTCTTACAAT
AGAAAGAGAGTGTGTGAAATCCAAAGTAGAGCTGTTATGGGTGACATATGAGTGAAAATT
TAAAATATTCTTGGGATTCCCCGGTGGTGCTTCCAGAAATAGCTTCTGGTTTTGAATCTT
TCCAGGCATCCCTGCTACTCAGAGTCATGCTGCAGCACACGTGTGCTTGACCGTGTGATG
GTGAATACAGCTCACCCTGTGTTTGCTGAAGTGACTCCATAGTCTCACACTGTGTGGGAA
GTCCCTTTCCAGATCAGTGCAGATGGTGTCAGTGCTCTTGATGGCCATTTTATTTATTGT
TAGAAGCAGTGTTTCTACTTTTGGATAGATGTATTTAAGCGTAGTGGCCATACAGACCTT
TTAATTACATTTGCATCACTATGCTCTTCCATTTTCCCTTTAGCTTTGCTCTATAGTGCA
TTTGGTGTCATCATTGAGAAAACTCGCGGGGCAGAAGATGACCTGAACACAGTAGCAGCC
GGAACCATGACGGGCATGTTGTATAAATGCACAGGTACTATTGATTGAGAGCTATCTTAC
TCTGCTTGAAGTGTGCTTTTATCTATGCTGTAAGTTCAAAAGCGTGAAGTGTATTGACAT
TGTTATGCAACCAATTCCCAGAACTTTCTCATCTTACAAAAAAGATACTCTGTAGCCATG
AAACAGCAACTCCCTATTAACCACCTGCCCCAGCTCCTGGCCATCTTGTACTTTCTGTGT
GATCAGTAGTGCGCCACTAAAGAGCTGTGTGAGCAGGTAGCAGTAACTTCTCTGAATTTC
AGTGCAATAAATAATAATAATAAAGACTGAAAAATCAAGAATAGTAATAGTTACTTAGAC
ACATGAAGATAAAGATCAAAAGAATTAGGCACAGGTATGTGGCCGAATGGTTAAGACACT
TACATCCAGCATCAGAGTATCTGAGTCCTATTCCTGGCTCTGGCTCCTGACTCCAGCTTC
CTGCTAATGCAGGCTCAAGGCAGTAGTGCCGGCTCGAGGAATCGGGTTCCTGCCACCCAC
ACGGGAAACCTGGGTTGAGTACAGAGCCTGTTACCTTTTTCATGGTACCCAGTTGCCCCC
AGGGAAATTTTCTAGAAAAGGGAACGATGGGAACGGTAAGCTAGGCTTTAAGAATAGGCT
GCATTTCAAATTATGGGAGGGGAAAGTCCAGAAAAAGAGTTCAGGCTTCAGGCATGGAAA
GCCAGGGTGAGAAATTCAGATTTAGACCAGAAGGTTGCGTGTGTCTCATCATCAGAGGTT
TTTGGACAGGGAGTGTTAGAATCATATTTGAGGAAGATTAACCTAGAAATAGTAGGTGGA
TAAAATGAACTAGTGGTAGAAATCTGAAGGAGGTTTATTTTGGTTTCCCAGCTTTGCATA
GTCACAGTCCAAGATGGGGTGGTCTCCAGTGAGCTGAGCACTTCTCCCCTGGCCCACATA
GTCAGATTAAATTCCCACCTTCTTGGTGCTATCCAGTGTATGACCTTGAGATTTGATCAT
CTGAATGAGTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1007..1012, 1014..1019, 1022..1024, 1027..1102, 3266..3324, 6145..6238, 6731..6815, 9386..9444, 11143..11252
1001..1003, 1007..1012, 1014..1019, 1022..1024, 1027..1102, 3266..3324, 6145..6238, 6731..6815, 9386..9444, 11143..11252
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved