Oryctolagus_cuniculus Locus ENSOCUG00000000851
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000000851
Oryctolagus_cuniculus
ENSOCUG00000000851
GeneScaffold_1569
SNORD42, snoZ17, SNORD42
1530..1596, 2653..2724, 3335..3399
4754
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCTGCACCCGCGTGGGAGACCCAGAAGCTCCAGACTCTTGGCTTTGGATTGG
TGCAGCTCTGGCTATTATGGCCATCTGGGGAGTGAACCAGCGGATGGAAGACCTCTCTCT
CTCTCTGCTTCTCTGTAATTCTGCCTTTCAAATAAATAAAATAAATCTTAAAAAAAATAA
ATAAATAAAGGGAAAGCAGCAAGGTCTTCAACAGGTGCTCATGTGGGATGCCGGAAGCTT
AACTTGCTACAACAGCCCAAAAAGATAGGATATTGAATGTTTTCATCATAAATATATGTT
AAATGTTTGGAGAGGTGGATATATGTATCCTGATTGGACATTACATAATATATATAAGTA
TAGAAACATCACATGGTACTCTGTAAATACATACATTTGTAAATATGTGTCTGTTTAAAA
ACTTTTAAAAATACATTTCAAAATTCCCACAGATGCTGTCTGAGGGAGGTGTTCTCAGGG
AAGCTGTGTGACGACATTCCAGTCCTCTGCTTCTCGCTTCCCAATCGATTGTGTTCCGGG
CAGCGTTACCGTTTTCTCGCGTCTCCCTCTGCTCCCTGAGACTCTTACTTGCTCAAGATG
AGAAACGCCCGGGATCCAAACGGCAACCCGCAACGCCAGCCACAAGCCCAAGCCAAGGAC
TGTGTCTTCAAAAAACTAGCTTCCCATAAGTTTTATTGCCTTCCGAGGGGAGGGGTGCCT
TACGCTTAGTCCCGCTCGCGAGAAAACCAGTTAACTACAATTCCCAGCGGGCGCCACGAT
AGATTGTCCAATCAGCTCTGAGTACAAGATATCGCGAGTCTTCCGTGAGACTTGTCTCTA
TAAGCCCACGGGAACGGGCCTGGGAAACCCTTTTCACCAAGATGGCGCCGAAGGCGAAGA
AGGAAGGTGTGTGTTGGGGCTGGGGTCCGTGGTTGGATTGCAAGGGCATCCCTGCCGAGC
AAACAAACTAGGAGGACGGCGACTGGCTTAAGTTGTGCGGGATCTGCTCCAGAGCTGCTT
TCTGTGTTCGTGTCACGCTATGGCGCGTATGGGCCGCGTGGGCCCAACCGCATGGACGGA
GTTCCAGTGAAGGGGGTTGGGGAGGCAACCCGCGCGGCATCACCGGCCGGGGGAGCCAGA
CAGCCGGCTCTGGGAAGCTAGGCGCGGCCAGAGGTCGTCGCTCCGTGCTTCCAGATCTGT
AGGGAGTTACTGTTGAGCCTTACTCATTTTTCTGCTTTTTCGGTGTTGAGCGGGGCTGTC
ACCCGGTAGCTTTGCGACGGCACATATAAAACCGCTAGCACACGTCCGACAGGTATTGAG
CGTTCGCTCGGTGCTAGTTACGCTTTAGTTACGTTTTTCTTATTAGTATCCTTTAAATTA
CTGAAGTGGATCGCTTTAGCCTCCAGCGTCGTGCATATGATGGAAAAATCTTAATTTCCT
GAGACTTATGATGTCTTCAAAGGAACCACTGATGCACATGTGGACCAGGCGCCTGCTGCA
GGGCTTGAGGCTGGAAGTGACCGAATTCTGAATCACGCAGCTTCGTTTTCTTGTCTCCTA
GCTCCTGCCCCTCCTAAAGTCGAAGCCAAAGCGAAGGCCTTGAAGGCCAAGAAGGCAGTG
CTGAAAGGCGTCCACAGCCACAAGAAGAAGAAGATCCGCACGTCCCCCACCTTCCGGCGC
CCCAAGACGCTACGCCTCCGAAGGCAGCCCAAATACCCTCGGAAGAGCGCCCCCAGGAGA
AACAAGTCAGTCGTGCCCCGACCCCGGCGCCTCCATCGGTGGTTGGGGAAACTTGGCCGT
GCTGGAGCGCGGTCTCACACACACCTTGGCACCCAGTGTGCTGCCCTGATGGGAACCTGA
GGGGATTGTTCTCAGAGCAGGAGTCTGCGATCATGGTCAAATTTGAAGGGGTCGCGTGGC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTCTTGTTCATGGCACCTTTTGTAGTCGCCATCTTCGAAGGTGAGAG
TGCCGGTTGATGCTTGATTGATAGTGAGGAGTCAGCTATTTTTGTTTTGCAGTAATGGCT
GACCAACATTGTATAGAAGCTTCTTTGCACTCTCCCAAATACTCGCACACTGTACTCAGG
GAAGGCTTGATTTGGGCGTTTTAGTGTTACGCTGCTGGTCACAGGAAGTGAAGATTAGAG
CCATGGTAGACATTGCCAGCAGCGGGGTGTGTCCATGGAGGAGCAGTTAGACTCAGCATA
GTAAGAGATCGAGATGTGGCCTAGTTTTAGAACAAGAAGGTAGTGTTTGGCTGAGCAGAG
ACTAGCTTCTTGTGAGAGACAAAATGGGTTGGGGGTCTGCCACCAGGCTGAGGGTTTGGG
CCCTAAGTGTCAGGGTGCACGTGATGACATTGTTAAGCGACCAAAGTCTGATAAAGATGA
TTGCTACCTCATGGTCTGATGCACCAAGTCTCCAAACAGGCCTGTCTTTCTGCTCCTTGA
CCCTGGCCAGGTGACTCCATTTTGTCTCTCCTCCAGGCTTGACCACTATGCCATCATCAA
GTTCCCCCTGACCACGGAGTCGGCCATGAAGAAGATAGAAGACAACAACACACTGGTGTT
CATTGTGGATGTCAAGGCCAACAAGCACCAGATCAAACAAGCTGTGAAGAAACTCTATGA
CATTGATGTGGCCAAAGTCAACACCCTGATCAAGGTAACCAGGTGCCTGGAATGCCCCAT
GGCGTGGAAAGGCTGGGGGCCGTGGTCAGGAACAAGACAGCTTGGGTGGCATAAAGCTCC
TCGATGCTGTTCTGGGGCTCAGAAGTGGGTTTCCCAGTGTGCGAGCCCTGAAGTGAGCGC
CCCTGCTGTAATTAGTCCTTGCTGGGGTTAGACATGAGGACACTTACAGGGCTGGGTTTA
TGGGCTTGGTGCTCGCCTGGATTCCTGCCTCTGAGCAGAGGCACACACTGGAGTAAACAG
TTTGTCAGAGTACCTGAGTTCTTAAGTCTTAGCATGGCCTGTGGCCTTTCCCATACAAGG
GAATTGGCGTTGTGATGGCTTCCCTAGCCCTGTCTGCGCAAATGATGGAAAACGCACTAT
TTGGAAAAGAATGACACCTACAAAGGAACCACTGATGCGCCAGGTCAGGGCTGGGGGGCA
AGAGGCTGTGAGCAGCAAGGACTAAGGCTCCCTTCTCTGCCCCAGACCTGACGGAGAGAA
GAAGGCGTATGTGCGGCTGGCTCCGGACTATGATGCTCTGGACGTTGCCAACAAAGTAAG
CTTCCTTTCCGCCAAATTCCGTAACGCGCATCCCCTCCCCTCCGTGCGAACGATGTGTCA
GTGACCAGAGCCTGACTGCTGCGTGATTGACTGGACCCCATCCTTAGCTGACCAGTCTGT
CACTTTGCATTTTGACCATGACATTCCAGCTTAATGTTCACATTGCAGCTCCAATAACCA
AGTCCCCTTTTGTTTTTCAGATTGGGATCATCTGAACGGAGTCCAGCTGGCTAATTCTAA
ATATATGTTTTTTCACCATATATATGCTCTTTGTGTCACATTTCTGGTGGGGCTGGGTGG
AGGCTGTACTGGGATATGATACACAGAGTTACCTGGTGGCCCAGGCTTGCCCTGTTGGAA
CACAGACCTGGCACACCACCATATTTGTTTTCAGATTGATTAAGGGTTAGTTGTCCTAAG
ACGGCTAGGACTTGTTTTCAAGTTTTTTAAGAGCCCCCTTTATTCCTGGAAGAGGCTGTG
TGTGAAGCTATAACACAGAAAGCAGAGAGCCAATTTCAGTTTTCATTAGCATCCATTGGG
TTGGCTGGCTGGCTTATGGGTAGCCTGGTCTTCACACACCTGACAACCAAGTCCGACCGG
TCGGTCAGCTTCCCTCACCCCTTGCCCAAGAAAAGAAAGGACTTCAGAGGAGTGCTTTCA
TTAGTGTTTTCAATAGTGGGTGCAGGTTCAAGGTAGAGAGGCCTGGGTGTCCTGGGGCCG
AGTCCCACTGCCGGTCAGGTGGTTTCTATTGGCTGTATCTGCTGCCCTTGCCACAAGTGG
CAGGCTCTGGGTCTCACTCCGTCAAGAACTTGTCTTTGTGCTGCCCCTTGGGGGCACGCT
CAGGGCAGAAGTCTGAGCGCAGGAGGCGTGAGAAGTAAATGAGGATCATCAAGTCGAGCA
GGAGCAGGGTGACCAGCAGGAAGCTGCCCAGGGTCCTCTGGCCCAGGTAGCGCAGGAAGA
ACTTGGTGAGGTAGGCCTGGGGGGCCAGGCGGAAGAGGAAGTACATGACCAAGTTGACAT
ACTTATTGACCCGGTAGAGGGGGTGGCTCTGCGCGTTGTTGATCTTCATCATCATGCGGA
TGGTGAGGAAGATGTTGCTGACCTCCACCAGGAGTGTCAGGACACCCCCACCGACAAAGC
TGCTCCAAAAGATGCCTGCGAAGAAGGCGCCCATGGCCTGGGAGACAGTGAGGGAGTGCG
TTACCACAAGAGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1681..1864, 2796..2969, 3465..3534, 3740..3754
1001..1025, 1681..1864, 2796..2969, 3465..3534, 3740..3751
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved