Oryctolagus_cuniculus Locus NCAPG2
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus NCAPG2
Oryctolagus_cuniculus
NCAPG2
GeneScaffold_2688
SNORA38
13105..13236
65451
CGCTGCGGCCGTTACCGCGGGAGTGGGAAGCGGGGCGGTCAGCCCGGCGCCCTGCATCG
CGCCTGGGCCTGGAGCGGACGGCAGCGGCCGGGGTTGGGCGGAAGCAGAGCGGGCAGCCT
TGCCGCGCCCCGGTGTGTGCGTGGCCGTGCTGGTCAGCGCTCCCCGGGGGGTGGTGACGT
GGGGGGTCGCGAGTTTCTGCCTGGACACGAAGATCTAGGGTTCCGGGTTGTGACGACGCC
TAGTGCCATCCGTAGCGGTCATTATCCCAGCGCGGGCGATTTTTATTTATTTTTTTAAGC
GGACGGCCTGTGCTGCACAGGTGCACCCTCACTGGCTGTGGCTTCATCGTTAGGTGCTTG
TCTTTCTAGCGGGGTACCTGTTAGCATCAGGTGGCGCACGTGTAAACCGGGGTTCGCTGG
GCAAACAGGCTGGGAGGAGCGTGCTCACTTAGTTTCCCCTGGGCGCTCATTATCCTGCGG
GATGCGAGGACCTGCCAGGGCGGGGCACTAACGAGCTCCCCAGCGACCCCCCCGCGCTGT
TTTCCTTCTCACTTGGAATAACAAGTGACTCTAAGCCCGGGGTTTTGTTGATGGAGGTGA
ATGATGCCTTAGAAAGGAAGTCTTCAGAATTTGGAATCAGCCCGTTCTTTGGTTGAATTG
ACTCAAATCTGCCTGAACCAGCGGCTTGCTAAGGCACTAAAGAGGGCGAGAAGGTGAGCT
TCCTGGGGCCCCGAGGATTTCTTGATGAAAACATGTCATTAACGTTATGTTGGTAATACT
TTCAGTAAACAAAGTAAGTTGTGCTTTAGATACTATAACTTGTTTTTATGTCAGAATGTT
GTTAGAAACTGTCTAGATGGTGCAGGAATTTTCTTGTAGTTCTTGAATGTTTTAATAACA
AAGCTTGTAGGAAAAGGCACATTTGCAAATTTAAGTTCCAGAGTGATTGTGTTTTCCACC
AGGGTTTCAAAATAAATGCCATTTGAACAGTCTCATCTGTCATGGAAAAACGTGAGACAT
TTGTGCAAGCCGTGTCTAAGGAGCTGGTTGGAGAGTTTTTGCAATTTGTTCAGCTTGATG
TAAGTTTTATGTTTTAAACTTATTCTGATTTTGGCTGTTACTGTATAAAATAATGATGTA
GAAACATCATGTCTTCCAAGTGAAATACAGTTTTTTAGTGAAATTTTTTAAAAAGGTTTG
TTTATTTATTTGAAAGGCTGAGTTACAGAGAAGGGGAGAGACAGAGAGATCTTCCCTCTG
CTGGTTGACTCCCCAAATGACCGTTTTGGCTGGGGCTGGGCCAAGCCAAAACCAGGAGCT
TCATCCAGGTCTCCCACATGGGTGCAGGAGCCCAGGCACTTGGGCCATCTTCCACTGCTT
TCCCAAGCCATTAGCAGGGAGCTGGATAGGTAGTAGAGAAGCTGAGATTTGAACTGGCAC
CTTTTTGGGATGCCAGCATTACAGGCAGAGATTTAACCCACTGTGTCACAGCACAGGCGC
CTTCAGTTACTCTTTAGAGACCAATGTTTATTTGTAAAAAGAGAACAAAATTCAGTAGGC
TCAAATAGACGTGCTAATGGGCTAAGCTAAGATGTAAAACATAAACAGAAGGCAACCCAT
CAATCATGACATTGAGGAAGGACTCATTTAGCTGATGGAACATCTGAAGACTAGAGAAGG
CGGGTTGTATTTGAACCTAAAATTTTGCAGAGCCAGAGTATGGAAATGTCAGGTGAGGGG
GGGCAGGAGGTGAGGCTACGGGGCTGGGTTACTTGGGCCTATATACACCATTAGAAGGAG
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTTTTACTTTTTTTTTTTTTTAAGAGTTAATTATTTGAACAGTGGAGTGAGAGAGGA
GGAGGGAGGAAAGACTTTTCTCTCTGCTAGTTGGTTCCCAAATGTGCACAGCAGTTGGCT
GGGCCAGGCTTGAGCGGGGAGACAGGGACTCCATTTGGATCTCTGCTGTAAGTGGCAGGA
ATCGCAGCACTTGAACCGGCATCTGCTTTCTCCCAGGGTCTGCATTAACAGGAAGCTGGA
ATCGGGAGCTGGAGCTAGCGATAGACTCATTCACTGCGATGTGGTGATGTGGGATGGACA
TCCTTTCTTCCGTCCACTGGTTCACTCCCCAAATGGCCACAACGGCCAGAGCTGGGCCGA
TCTGCAGCCAGGAGCTTCTTCCAGGTCTTCCATGTGTGTGGCAGGGGCCCAAGCACTTGG
GCTATCTTCTCCTGCTTTCCTATGCACGTTAGCAGGGATCTGGATTGGAAGTAGAGCCGC
CAGGACACAAGCTGGCGCCCCCATATGGAATGCCAGCATTGCTGGTGGTCACTTACCCAC
TGTGCCACAATGCCAGCCCTGGGATGAGCATTCTAGCTCCTAACCTCTAAAGTATGCACT
CACCTCATCAGGCAGTTTCTTTACCTAGCCCCTACAGCTTGGGTAATGGTCTGTAATTTG
CTCTGACAGAGAATGGGTGGAGCCATCTGCTCATAGAGGAAATGAGGACAGTTGTGAAGA
TCACAAAGGGTCTCGTTTGGCTGAGGGGAGAGAATGATGTCGGGGTGACTGGAAGGCGAT
GTTGAGGGTCCACATGGGGTTTAAGTGGAATCAGCCGACATGGCTGCATTTTTTTCTGTT
ATTGTTGCTGTTATTATTGAACTCTTTTTTTTTTTTTTTTTGTAACCTATTTATGGGTCT
CAAGATGGTATACATATGGTTCAATTTTAGGCAAGATTTTGCTAAATGGATGAAATTGTA
AACTCCCAGATTAGAATACTAGGAAAGAATAGATGGAGGAAAAATTTGCTACTTTCTATT
TCATAATCTGTACGTTTTCCCTTTTAGCAATAAATTTTGAAAATACACCAAACTTTTTTT
TTTTAAATATTTATTTATTTATTTGAAAGGCAGAGTTACAGAGAGGCAGAGGCAGAGAGA
GAGAAAAAGAGGTTCTCCATCCACTGATTCACTCCCCAGATAGCCACAATGGCTGAAGCT
AGGAGCCAGGAGAGCTTCGTTTGAGTCTCCTACGTGGGTGCAGGGGCCCCAGGACTTGGG
CCACCTTCTACTGCTTTCCCAGGCACATTATCAGGGAGCTGGACCGCAAGTGGAACAACC
AGGACTTGAACTGGCGCCCATATGGGATGCTGGCGCTCCAGGCTAGGGCTTTAAGCCACT
GCTCCACAGTGCCAGCCCCTACACTAGGCTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGAATCTAAATGCAGCATTCTA
CTAAAAATCTCCCCTAATCAACATAACAGTGACTCTCAAATACTTTGTGAATTTTACTAT
CAGTTTGTTTTCAGTCTCCAAAAGCTGATAAAATGATGAGCACTACCTTTTATGTTAGTA
TAATGGCTTTCAGAAAGTCACAGATTATAACTATGCATATATTATTAGTATTATAATTTG
ATTATAGGGCTTTTCTGTTAATAACAGCACTATAATTTTTATATTCATTATAATGGCAAC
TTTTACTATTTTTCATCTCTAAGCCAAAATTTGAGGGCTGCCCAATGAGATAGTAGTAAA
TAGACCTGACCTGGCTCATTCATTTACATTTAGTTAGCTTCAAGATCTGCCTCTCAAATT
TGGGATTTGGGCAATATCTCTCTGAGGCTTACAGTTCTAAAATTCTTTGTTCTAGTTTGT
CTTTTTTTTTTTTTTTTTAAAATGACTGACTTATTTGAAAGAGTTATAGAGAGAGAGAAA
GGAAGAGACAGAGAGAGAGATTTTTATTCCACTGATTCACTCCTCAAATGGCCACAGTGG
CTGGAGCTGGGTCAGACTGAAGGCAGGAGCCAGGAGCTTTGTGCAGGTCTCCCATGTGGG
TGCAGGTGCCCAAGTACTTAGGCCATCCTCTGCTGCTTTCCCAGGTGCATCAGCAGGGAG
CTGGATAAAAAGTAGAGCAATTGGGATGCAAACTAGCACCCATGGGGAATGCCAGCATTG
GGAATGGCTGCTTAACGCACTACGCCACAATGTTGGTCCCTGCCTCTGGTCTGTTTTTAT
AACAGGAGTAAAAATTTTAATTAATAGGGCCGGCGCCGCGGCTCACTAGGCTAATCCTCC
GCCTTGCGGCGCCGGCACACCGGGTTCTAGTCCCGGTCAGGGCGCCGGATTCTGTCCCGG
TTGCCCCTCTTCCAGGCCAGCTCTCTGCTGTGGCCCGGGAGTGCAGTGGAGGATGGCCCA
AGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAAAAGCACCTGGCTCCTGGCTCCTGC
CATCGGATCAGCGCGGTGCGCTGGCCGCAGCGCGCCGGCCGCGGCGGCCATTGGAGGGTG
AACCAACGGCAAAGGAAGACCTTTCTCTCTGTCTCTCTCACTGTCCACTCTGCCTGTCAA
AAAAATTTTTTTTTTAATTAATATTATTCAAGTTCTATAATAATTAGCAGAAATTTTGGC
AAGGTAAACATTAGTTAATATTCACTTGGGAAAGCTTTTCGATATACAAAGTCAAAATGC
TCTCAACTATTGAATCTGAACTAATAAGAATTTGCTTTATAAACTGAAAAATTACTGTGC
TTTGTTTTAGGTATTTTATACGCATTACCTGAATCTGAACGAAAACTACAGAACTCCATT
CAAGATTTGTGTGTCAGATGGTGGGAGAGAGGCCTACCTGCCAAGGAGGATATGGGGAAG
ACTGCTTTTATCATGCTACTAAGGAAGAGCCTTGAGACCAAAAGAGTGTGTTTACTTTCT
TAAGTATACACTTTAATAGAAATGGGTTGTTTTGACTATGCGTGGCCTGACTATGGTAGT
TTTGAGTTGGAGGATTTTTTTTTCAAGATTTATTTGTTTATTTGAAAGTCAGAGTTACAG
AGAGAAGGAGAGAAAGAGAGGTCTTCCATTTACTGTTTCATTCCCTAGATGGCTACAACA
GCTGGGGCTGGGCCAGGCAGGAGCTTCATCTGGGTCTCCCCTGTGGGTGGTAGGGACCCA
AGCACTTGGGCCATGCTCTACTGCTTTTTCCAGGCCATTGGTAGAGAACTGGATTAGAGT
GAGCACCAGCACTTGATTGCACTCATACTAATGCTGGCTTCTAGTGCAGCTTACTACTAC
ACTGCATACCAGCTAGAGGTGTTTAAGGCCAGCGCTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTT
ATTTATTTGAAGGAGTTACACAGAGAGAGGAGAGGCAGAGAGAGAGAGGGAGAGGGATCT
TCCATCCGATGGTTCACTCCCCAGTTTGTTGCAACTGCTGGCGCTGCGCTGATCTGAAGC
CAGGAGCTTCTTCGGGTCTCCCACGCAGGTGCGGGGGCTCAAGGAGTTGGGCCATCTTTG
CTTTCCCAGGCCATAGCAGAGAGCTGGATCGGAAGTGGAGCAGCCAGGTCTCGAGTCGGC
GCCCATATGGGATGCCAGCGCTTCAGGCCAGGGTGGTAACCTGTTGAGCCACAGCGCCGG
CCCCATTATCCCTTTTTTAGGATAGATTTGGTGGGTCAGTGAGTATGAATTTGAAAGAAA
GAATTGGAAAAGAAAAAAGACTTTGAAAATAAAACGTTTGCCTGTTTACACTCCCACCAG
TGCCTGAGTGTGAGTCTGCTCTCTTTAGGGAGCAGCAGATTTTAAGACAGAAAAGCCCTT
TTTGGCTCTGTTTAGAGTTTTCCTGCTGGCCAGAGGAGTGATAGAAACCTTTTTTTTTTT
TTTGGATCATGATTTGTTTTTATGGTATCATTTATTTGTCTTTTTAAAATCCATTTTCCC
TGTCATTATTTAGCTTTTTTTTTTTTTTTTTAAGATTTATTTATTTATTTGAAAGCCAGA
GTTACACAGGGAGAAGCAGAGGCAGAGAGAGAGAGGTCTTCCATCTGCTGGTTCACTCCC
CAGATGGCTGCAATGGCTGGAGCTGCGCCAATCCAAAGCCAGGAGCCAGGAGCTTCTGGG
TCTCCACATGGGTGCAGGGGCCCAAAGTCTTGGGCCATCTTCTGCTTTCCCAGGCCACAA
CAGAGAGCTGGATCGGAAGTAGAACAGCTGGGACTAGGACCAGCACCCATATGGGATGCC
GACATTGCAGGCAGTGGCTTTACCCACTACGCCAGAGCGCTGGCCCCTATTTAGCTTTTA
AATCAAGGCTCTATTTTTTTTTTCCTTAAGGCTCTATTTTTAGTGACTTTAAATTAATTA
TAGTAGTTGTACTCATTTATGCAGTACATTGTGGCATTTCAGTACTGTGTACAGTGTGTA
ATGATCAGAACAGAGAAGTAATTGTACCCATCACTTGAAACATTAACCATTTCTTTGTGC
TGAGAACATTCAGAATCCTCTCCACTGTCAGTTTGAAATAGGCAATTAGTTGTTGTCAGC
GTGGTTCCCTTACTGTGCCACAGAACATCAGAAGTCACTCCTCCTGTCCAACTGCTTCCT
GTTCACCGTTTTCTCTCCATCCTCCTCAGTAACCCTTCCCAGGCTCCAGTAACCACTGAC
TACTTCACCGAGATCAGCTTTGTCGATTCCACATAAATGACAGTACTTGAAGTTTTTGAA
AAATGGGATGAATGATAAGTTTTGGGCAGACATTTAGCCCAGCAGTTAAGACACTGCTTG
GAATACCTGTGTTCCATGTTGGAGTACTGGGTTTGGTGCTTGGCTCCAGCTCTTGACTCC
AGTTTCCTGCTAATATAAACCCGGGGGACAGCAGTGATAACTCAGCTAATTGCATTCCTT
CCATCCATGTGGGAGACTTGGATTGCGTTTCTGGCTCCTGGCTTTGACCTGGCCCAGTCC
AGCCATTGAGGGCACTGGGAGAGTGAACTAGTGGGTGGGCACTCTCTGCCTCTTAAAATC
AAAAATTTTATTTATTTATTTTTAATCTTAAAGACTTATTTATTTATTTGAAAGAGTTGC
ACAGAGAGAGGAGAGGCAGAGAGACAGAGAGGTTGGTCTGCCATCTGATGGTTCACTCCC
CAACTGGCACAATGGCCAGAGCTGCACTGATCTGAAGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTTCCCAGGCCATAGCAGAGAGCTGGATAAGAAGTGGAGCAGC
CGGGACTCGAACCAGCACCCATATGGGATGCCAGCACTGCAGGCGGCGGCTTTACCTGCT
ATGCCACAGCTCTGGCCCCAGAATATTTGTCCTTAAAGTGTTTTGTCCCCTTTTCTCCAG
TAGTATTTTAAAAAATAGGGGTTTGTAATTAACCTATTTATTTGACTATTTGATACAAAA
TTAGCACTAACAGCGTGCATTTCTCAGTCTCATCCCCTTCGCTTCCGCCCTTTTTAAGTT
TTTAAAGCAGTTCCAAGTATGATATTTCATTTCTACATGCTACATATGTGTCCTAAAAAG
TGTGGCTATGTAATTTCCTTACAATGTGTAAAAAATTCATAGTAAGTCCTCTGTGATTTT
TAAAGTAATCAGGGCATATTTTCCTTATGAAACAGAAGTACAGGTGCAGCCTCAGACCTT
TGTTGTGCTCTGTGGCGCTGCTTGTCATGTGGACTTTGGGGTGCACACACCAGGTTCTTT
ACGTTGTACTTCTTGTTTTAGGCCATTGAAAATGATTGCATCCAGGACTTCATGTTCCAT
GGGATCCACCTTCCGAGGAAGTCTCCAGTGCACTGCAAAGTACGAGAGGTGAGTGACACA
CTTTTAATCAGACTGATTGTTAACAAATTGTTTTTGAAATGATGTCTCATCTTTTTTGTC
TTTAGATTATTGTTTTGTTCACATTTAAAAATGAGTGAAGCTTTCACATCAACAGAAGGA
TTTCTCAGAATCTTATATTGGGTGTCTAGCAGTTTATTTCTGCCACTGAAGTTTTAATGA
GGAAAGCAAAATTATCTGCTATTGTTAATATAATCGCAACTTTGAGTACTTTTTTTTTTT
TTTTTACAGGCAGAGTGGACAGTGAGAGGGAGAGACAGAGAGAAAGGTCTTCCTTTTGCC
ATTGGTTCACCCTCCAATGGCCGCCGCGACCGGCGTGCTGCGGCCAGCGCACAGCGCTGA
TCCGATGGCAGGAGCCAAGCACTTATCCTGGTCTCCCATGGGGTGCAGGGCCTAAGGACT
TGGGCCATGCTCCACTGCAGTCCTTGGCCACAGCAGAGAGCTGGCCTGGAAGAGGGGCAA
CCGGGACAGAATCTGGCGCCCCGACCGGGACTAGAACCCAGTGTGCCGGCGCCACAATGC
GAAGGATTAGCCTAGTGAGCCGTGGCGCCAGCCTGAGTACCTTTTAATTTAGTCTTTTTA
CATAGAAATCTAGAATCATCACTTTCTAACTATTTTTTAGAGATCTCAGAAAATATTTGA
AATTATTACTGTTTTTTAAAGATTTATTTATTTGAAAGGCAGCGTTATAGAGACAGAGGA
AGGAAGAGAAGATGGGAGGGAGAGGGAGATGGATATTCTTTTGATTTGCTCTCTACATGG
CTACAATGCTGAGGCTGGGCCAGGCCAATGCCAGGAGCCTGGAACTCCATCCAGGTCTCC
CAAATGGCTGACAGAGACTGAAGCACTTGGTCATCTTTTTTTTTTTTTTAACTTTAAAAA
AATAATTTAATTGAAAGGCAGAGTTAGAGAGACACGGAGAGCTTCCTTCTCCTGGTTTAC
TCCCCAAATGACTGCAATGGCCGGGCTAGGCCTACCCAAAGCCAGGAGCTTTTTCCAGGT
CTCCCACTTGGGTGCAGGGGCCCAAGGAACTAACCCGGTTATCTTCCACTGCCTTCCCAG
GCGTATTTGCAGGGAGCTGGATCAGAAGTAGAGCTGGCCCCCATATGAGATCCTGCATTG
CAGGCAGTGGCTTACCCACTATGCCACAACGCCAGCCCCACTTGGGTCATCTTTTGGTGC
TTTCCCAGCTCCATTAGCAGGGAGCTGGATTACAGGTGGAGCAGCCAGGACTTGGCTCGT
GCTCATGGGCTGCTGACATTGCATGCAGTGACCTAACCCCCTGAGCCATAAAGCTTGCCC
TGGGAATTATTTTTGTTACTGACTTTTATACATTAAATTTGTATTTTGGAAACAAAATGG
AATAAATGTTTTGATATTTTCTCTTGATAAGATACTTTGTTTTTTAAAAAGTAGTCTCAG
AATTGAGATACGAATTTTATCCTTATGTTGGTAAGTGTTCTGACTATATAAGGATTTGTC
AACAGTGTCATTATTAGACTGACAGGTATTTGATTGATCATAATGATCCTGGCAGGAAGA
ATTGGCAAGTCTGGTCGGATGTACTTGCTTAAATTAACAGATGCGATTGCTCAGCATCCC
AATCCATGGGAAGCCTTGTTTGCTTGCTGTTAGTTCTGGCAAACATGTCAAGGAGCTAAT
TGAAGAAAGACTGTATCTTTACATTTATGTATGGTGGAATTATTATTTGTAGGATGTAAA
TACACATATACTAACTATATTCGTTTTGGGTAAGAAGACTTTTGTTTTTAAATATTACGG
ATGACTTAATTTAAGTTACCCAACAGTGAAGAACCTGGAGGTTTATTTATACCAGTGAGT
TTTCCAAGGGGCTTAAGAATTACAATTTCAGGGCCAGAGTTGTAGCACAGCAGATTAAGC
AGCTTCCGGTAATGCCAGCATCCCATATGAGTATCGGTGTGGGTTCTGGCTGTCACACTT
CTGACCCAGCTTCCTGCAGTGCATCTGGGCAAGCAGTGGAAGATGGCCTGAGTTCTTGGC
TTCTTGCCACCGAAAAGGGAAACCTAGGTGAAGCTCCTGGCCCCGAGCTTCTGCCAGACC
CAGCCTTGGCTGTTGCGGCCGTTTGGGGAGTGAACCAGCAGATGGAGGATCGGTCTGTCT
CTCTGTCTCTTTCTCTCTAACTTTGCCTTTCAAATAAATAAATAGATAAATAAATAAATC
TTTTTTAAAAATGTGATTTCACCCTCCCTCCTACAAAGGCGTGTCTGTGACTCCCTGTGT
TTGGACACGTAAGAATTGGAGGCAAAGAAATGTGGACTTGGGGAAGTTCTGGGACCAGCT
TGTTCCGTGCAGGCTCAGGATCAACCATCCCACAGAGAGAAAATTGTGATCTTATGTATT
TAGTATCGATATGTTCTTTGACTCATTGAGTCCTCCCTCACCCACCAACGATCCCGGTGT
GGCTTTGTTAAATTGTAGGGCAGTGGGGTCATTGTTTCACATACATGATTTGGTGTTTCA
AATTCTGTTTAGCAATGAAGAATGGGTCATGTAAACTCCCCAGAAATTGTGGCATACTCA
CTTAACCCTTGGTACCAAAGGACTGTGTGTGTGTGTGTGTGTGTGTGTGTGTAGAAGCTG
TGGCGCAGCAGGTTAATGCCTGCTGAAGCGCCGGCCTCCCATATGGGCGCTGGTTCAAGA
CCCGGCTGCTCCACTTCCTATCCAGCTCTCTGCTGTGGCCCAGGAAAGCAGTAGAAGATG
GTCCAAGTCCTTGGGCCCCTGTACCCACGTGGGAGATCCGGAAGAAGCTCCTGGCTCCTG
GCTTCGGATTGGCACAGCTCTGGCCGTTGCGGCCAACTTGAGAGTGAACCAATGGATGGA
AGATCTCTCTCTCTGCCTCTCCTCTCTCTCTGTAACTCTGACTTTCAAATAAATAAAATA
AATCTTTAAAAGGTACTTCACGTACTTTAGCTATCATGTGCCACTTCCCAGGTTGTGCAT
CAGCTGGAAGCTGGATTGGAAGTGGAGCCAGGACTCTATCCCAGACATCCAGTTTGATGT
GTGATGTCACAAATGCCTTTTTTTTTTTTTTTTTTGACAGGCAGAATGGACAGTGAGAGA
GAGAGAGACAGAGAGAAAGGTCTTCCTTTTGCCGTTGGTTCACCCTCCAATGGCCGCCGC
GGCCGGCGCGCTGCAGCCGGTGCACCACGCTAATCCGATGGCAGGAGCCAGGTGCTTCTC
CTGGTCTCCCATGCGGGTGCATGCCCAAGCACTTGGGCCATCCTCCACTGCCTTCCCGGG
CCACAGCAGAGAGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCCGGCGCCCCGACCG
AGACTAGAACCCGGTGTGCCGGCGCCGCAAGGCGGAGGATTAGCCTAGTGAGCCGTGGCG
CCGACACAAATGCCATTTTAACCTATTGTGCCACAGCAACCACCACCTGTTTTCTGATTA
TTATTAAGTTTTGGGAGGAACTTGACACCTCAGTTAAATTTCTGGTGTGAATCGTCACTA
AATAGTGTTATATATATTACAGAATATATAGAATAGCAGAGAGCTGTGTGTGTGTGATAA
TAAACCTTGGGTTTAATAAGAGCCTTTTAGAATGAGCTGCAGGGACCACTTTGATAAACT
CTTCTTTATGATCTTGAAAATGATAGTGCTTCTATTTTACTTTGAAGGGTAGAGGTTGAA
ACGACTATTTTTGAGATTATTTAGCTCTTTTAGAATAGTTGACAAGGAGCCCATATCATC
TCTATTAAACCAAAGTTTCGGCCTTTATATCTGCCATAGATTTAATTGTGTGATTCGCTG
TCTGTTGCTGTCAACAGTACATAGTAGTAGTTCTTTTGAAGATCTCAAAAGTATAGCTTA
AAAATAACACCCGTGGCCTTAGAAATAAGCTGTTAAATTTCTGTCAGGGGATGGCCGGCG
CCGCGGCTCACTAGGCTAATGCTCCGCCTAGCGGCGCCGGCACACCGGGTTCTAGTCCCG
GTCGGGGCGCCGGAATCTGTCGCGGTTGCGCGTGTTCCAGGCAAGCTCTCTGCTGTGGCC
CGGGAGTGCAGTGGAGGATGGCCCAGGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGA
GAAGCACCTGGCTCCTGGCTCCTGCCATCGGATCAGCGCGGTGCGCCAGCCACAGCGCGC
CGGCCGCGGCAGCCATTGGAGGGTGAACCAACGGCAAAGGAAGACCTTTCTCTCTGTCTC
TCTCTCTCTCACTGTCCACTCTGCCTGTCAAAAAAAAAAAAAAAAAAAAAAAATTTCTGT
CAGGGGAAAGTGTTGCTGTTCCCCATTACTACATAACATTTGAAATTCCAAATAAATCTT
GTAGGTCTTTTTAAATGCATTTTTTAAAAATATTGATTTACTTCTTTGAAAGTGAGAGTT
AACAGAGAGAGGGGGAGAGACAGAGGTCATCTATCTGCTGGTTCACTCCCTAGATGTCTG
CAATGGCCCAGGGCTAGGTCATGCCAAAGCCAAGAGCCAAGAGCGTCTTCCAGGCCTCTC
ACATTGGTGCAGGGGCTGAAACACTGGGGCCATCTTCCCCTGATTTTTCCAGGCTGTTAG
CAAGGAGCTGGATCAGAAGTGGAGCAGTGGTCCATGACTAACACCTATATGGGATACCAG
TGTTGCGGGTGGCAGCTTTACCTACTGTGCCTCCACGTTGACTATGTGGTTTTGTTGGCT
TGTTTGTAAGATTATGTATCATGGCTTTTCTCTTTCTTTTTCTGGCCCTCAGGTGCTGAG
TTACTTCCACCATCAAAAGAAGGTTCGACAGGGAGTGGAAGAGATGCTGTATAGATTATA
TAAGCCCATCCTATGGAGAGGATTAAAGGTCTACATTTTAAAGAGCTTATCCATGTGTAG
AATGTACTGATTATGCTTTGGAGTTTAGCATGCTGTAGTTCAAAATTGTAATAAAGCTGT
AAAAAATGAGACTGCATGCTGTGAGATTTTGGAACAAATGTGTTTTTTTGTTTTGTTTTG
CTTTTTTTTTTTTGCTTTTGTTTTTATTAAAAGCATTCTTGGGATCCATTTAACTGGAAG
CCTGAATTATTTTGGTGCTAATTAGTGCACAGTTTTGAAGTTACCCGTTGGGGAAGGAGA
TCAGTGGCAGACTCTTAAATGAATTGTGGTAATAAGGGTTCTGCAAAGCTGGGCGCAGCC
ATCCAGTCTTCATCTCTTCAGTAGAAGGGGAGGCAGAGTATACACGCTTCATGTGTGTCA
AGTGTCCTAGTGAATACACAAGTCTCTCTCTCTCTCTTTTTTAAAGATTTATTTTATTTA
TTTGAAAGGCAGAGTTACAGAGAGGCAGAGAGAGAGAGAAAGGTCTTCCATTTGGTGGTT
CATTCCCCAGATGGCCACAATGGTCAGAGCTTTGCCAGTCTGATGCCAGGAGCCAGGAGC
TTTTTCCAGGTCTCCCACATTGGTGCAGGGGCCCAAGTAGTTGGGCCATCCTCTACTCAT
ACTCTCCCAGGCCATAGTAGAGAGCTGGATGGGAAGTGGAGCAGCTGGGACTCGAACCAG
CGCCCATATGGGATGCCAGCACTGCAGGCGGTGGCTTTACCCACTACCCCATAGCGCTGG
CCCCCGCACACGTCTCTAACACAGACAACTTTGATGTCACCAGGACATGATGGTGACCAC
TTCCTAATGACACAGCAAGATGCTGAAGAGAGGAAGGTGATTTTTTTTTAATATCTGCTG
ACATTGCACTGTTCAGCTTAATTTAAGGAAGGTCTTACAAAAAGGTAATTAAAATGTTGT
AATGGCCTTTAATTTGTAAATCTGTATTGAGATAATAGAGGTGTTATTTGGTAACACTCT
TTCTAAGCCTGATATCTTACCTGTCTGGGATTGTGAAGTACTCCTGCTATTCTTTTATTA
TTACAGGCCAGAAACTCTGAAGTTCGATCAAATGCTGCATTGCTGTTTGTTGAAGCGTTT
CCTATTAGAGATCCAAGCTTTCATGCTATTGAAATGGACAGTGAAATTCAGAAGCAATTT
GAAGAGCTCTATGTATGTATTCATGTGGTCAAGCTTCTTATGGACTTTGGCTCTTTCCAG
GCTGGGTCACTTAAAGCTTTGAATAATATTTTATAATATTATAATAATATGTAAATTTAA
AATGAGTAGCAAGTACTTAGCTCAGTCTCTATTGCTAACATGTAATGGCAACATTACACA
TAAGTGATGTGATAAGTCTAATATAATATTAGGAGTATGTAGATGAATTCTGTGTATCAT
GTACTCGAAATGCAACTGAGTTTTTAGAGGTGAGTTAGACAAATTACAGAGTTAGGGATG
TAGGGTGTGAATTCTTTGTGGAAATGTAGGTTTTGTCTTTGTTGCTCCCTATTGGGTGTG
TGAGGATTTGGGCTAAATAGTGAATAGTGACTTGATTTCTCTTCTGATGTTTATATTTTT
ATTCCATTAAATCCTTCAAGTTGATGTAAGTTGAAGTCTAATTCTGAGAATCTTAATAGT
TGGTAGAAATATTATCTGCATAAATATATTTGCAAGGTTGGAAGGTTAATAGATTTTGCT
CATTAACCATTCTTCAGTGGATAACATGTACATGCTAGTAAGTTTAAGAGCAGAACCAGT
TAAGAAGTTTTTTACAATAAAAAATGCATATAGGAATGACAAATTCTTTTTTTTTTTTTT
TTTAAGATTTATTTATTTGTTTGAAAGTCAGAGTTACACAGAGAGAGTAGAGGCAGAGAG
AGAGAGAGAGAGAGAGAGGTCTTCCATCCAATGGTTCACTCCCCAGTTGGCTGCAACGGC
TGGAGCTGTGCTGATCTGGAGCCAGGAGCCAGGAGCTTCTTCCAGGTCTCCCATGTGGAT
GCGGGGACCTAAGGACTTGGGCCATTTTCTGTGTTCCCAGGTCTTAGCAGAGAGCTGGAC
TGGAAGTGGAGCAGCCGAGCAGCCGAGACTTGAACCGGCACCCATATNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACTCCA
TCTGGGTCTCCCAGATGAGCGGCTAGACCCAAACACTCCAGCCATCTGCTGCTGCTTTCC
CAGGTGCATTGGCAAGGAGTTGAATTGGAAGTGGAGCATCTGGGACTGCAACTGGTGCTC
TTATGGGATGCTGGTATTACGGGCAACATCTTAGCTAACTTTCTATAGCACAACACTGAT
CGTATACTTGGAGTTTTTTTATTCTGGGCTCTCTGTATTGTGACATTTGAGAATTCAAGC
AGGTGGACCACAAAGGCTGTGTCTGATATGAATGCTTGCTGTAGTCAGCTAAACCTCTGC
GTGTCCCAGCGATTGACGGAGCTGGTACATCAAGTCTGGTATCACTGAAGTTCTGTACAT
AGCATGTGGCAGTAAGGCTGCTCGTATATCTGGGCTGTTATTTTAAAATACTGCTTTAAA
AATGGTAAATCATCTGAAATCACGGAATCTGTATGTGATCAGTATTTCTGTAACTTTAAG
TCTTAGTAAATTGTGAAACCTCGCAGTGCTAATAAAGTCTTTTCCTCCTCCTACTTATAG
AGCCTTTTAGAAGATCCTTATCCGATGGTCCGTTCCACAGGAATCCTTGGAGTTTGTAAA
ATAGCTTCCAAATATTGGGAAATGATGCCCCCAACTATTCTTATTGATCTCCTGAAGAAA
GTAACTGGGGAACTGGCATTTGATGCAAGCTCTGCTGATGTCCGTTGTTCTGTCTTTAAG
GTAAGCTTAAACAATTTTTTTATTTGTTAAGAGATAATGCAGGAAATCGGCTACCTTCCA
CGGATTGATTCACAAACCCTGCAACAGCAGGAATGGGAGCCAGGAACTGCAGCAAAAGGA
GCTTGAAACGCAATCCAGGTGTCCCGTGTGGGTGGCAGTGACCCAGTGATTTCAGTTGTG
ACTGATGCCTCCCAGGGTCTGCGTTGACAAGAAGCCGGAATCAGGAGCTGGAGCTGGGTG
TTGAACTCAGGCACTCTGAGTTCTCAACCCACTTGGCTAATCACCACTGTACATTTTAAA
ATTATCCAGCAATATTTGTTTATTATAGAATGTTAGAAAATACAGATGGAAAACATATAA
AAAACCCTTGTAATCCTACCCCATGGAGATAATACTGTGTGTATTTTTGTTGTCTATACA
ACGTCAAGTGTTTAAAAACCAAATTAACAATGTTTTCTACAAAAACAACTATTGGAAATA
ATACTATTTTTTTTCCAGAGGCATTTTGAATGCTTTGTGAAGAACCTGTATATAGACCAT
ATTTGGATTAACTAAAATGATGTTTTTATACTCATACCCATCAGTAACATCAGTAGTGCC
TTGAACTTTGCAGAAAAATTTTCACACTTTATTTTCTTAGTCACCTGAACCAAGTAGTTC
TAGATTCAATGAAACTGAAATGAAAGGTGGGTGGTTGTGGCTGACCCGGGGAAGTGATGA
CTGAGGCTACAATGACAAATGCCCTCTGGAGTTGGGTTTGGAGGATCTGTAAGGATCTCA
GGCCAATTCACAGAATCTCTGGGGGGCATCAGATTAGCTAAGAAATGATCTTACTTTGCT
ACCCTTAGACTCAGTTATGTAGAACTTCTGACCCTTGTGAGCACAAAGCCATCGGATATC
TCTTCCCTCAGATGGAACACAGACATTTCAGAGAAGATTTTGTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATTTG
GAATTCCTGTAGATCCTCTTAAAAATGAGACTTTGCAAAAACATCCTTTCTCCTAACAAT
AAGGAGAGAAAAGCTGTAGAGTTGAAAGCGTGCAGGAGCTAATCTGTAGGTTATAATTTG
GTGCCTCATCTGAGTCTGAGCATCTTACCCTAGCCCTCTTGTCCCGAGAAAGGGTCCTTG
CCCATCTCTGAGCACCAGAGGGGTTCAAGTTGTGGGTGTACTAGTTAAAACAATGTGATT
ATCAAGCAGGGAAATACAGAGAGTTTATGGACTCTTTTTTTTTTTTTTTTTTTGACAGGC
AGAGTGGACAGTGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTTTGTCATTGGTTCAC
CCTCCAATGGCCGCCGCGGCCGGCGCACCGCGCTGATCTGAAGCCAGGAGCCAGGTGCTT
ATCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCGCTTGGGCCATCCTCCACTGCACTCCC
TGGTCACAGCAGAGAGCTGGCCTGGAAGAGGGACAACCGGGACAGAATCTGGCGCCCCGA
CCGGGACTAGAACCCGGTGTGCCGGCGCCGTAGGCGGAGGATTAGCCTAGTGAGCCGCGG
CGCTGGCCTAGTTTATGGACTCTTTAAAATGAATGAATTCTTGTATTCCAGCTTATGCTC
TTGTCTATAGAAAATACTCTGTTTCTTTTTTTTCTGGAAAGGAAACTTGCAGAGAGAGGA
TAAAGCAGAGAGGGAGGAAGGGTGAGGTCAATCTTCCGTCGGCTGGTTTATTCCCTAGAT
GGCCCTTGAAGCCAGGTCTGGGTCAGCCTTGAACTTATCTGGGTCTCCCCTATGGGTGGC
AGGTGCCCAAGCACTTGGGCCCTCTTCAGCTGCTTTCCCAGGTGCATTAGCAGGGCGCTG
GATTGGAAGCAGAGCAGCCAGAACTCAAACTGGCACTCTGATGGGATATCAGCATTGCAA
GTGGCAGCTTAACCTGCTGTACCGCAGTGCTGTCTCCCTCTGCATGTTTTGACTCAAAAA
CCCTTGCATTTTAGCAAGTAGCATTGAAAATTTCTTTCATAACTGCTTTAATCTGGTTTG
AACAAAATAGTGGTTGGGCTGATTATCAGTTGAAGAGACTATATGCACTAAAAGTATACT
TTTCATAGGAAACATTAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCTTGTGAGCACAAAGCCATCGGATTTCTCTTCCCTCAGATGGACCATAGACATTTTTCA
GAGAAGATTTTTGTCCTCTTGTCCTTTTGTTATCTCTTCTCTTCCCACCTTCTCTAGAAC
CTGTGTGCTGGTTACTTTCTGTATTTCCAGTGCGTGCTCCACACTCTATGTCAGCAGCAT
CCTTACTGCAGCATGCTCACCCTTCCCGGTAACATTCTCAAATCTCCACCTGAATACAAG
CCAGCATGTTCCCTTGACGTCATATCAAGGTGTAGGCACCACCCTGCTTAACCTCTTTCG
AAGGTCATCTGTGCTTTGTTGGGTAACCATCCATTTAGGGTTAGGCCTCTTTGCTGTAAT
TGTTGGTAGAAGCCTTTTTATTGTCAGAAGAGTCTCAAGTTTGTGTTAAATTATATGGTA
ACCTCAATGTTCTATCTCCCATGTTTTTTGCTTATTCCCTAATCCAGTATAAAGTGCCTT
TCAGCTCCATGACCCAGTGCAGCATTTCTAGCCAAGGTTAATTTCACAAGACCGTTTCAC
TGTTCTTTTTGATCGATGAGCTGAATTTGACCCCTAGACTAGTTTCTTGTGCTTCTGAAC
ATTGTTGTAGACCATCATTTGCCCCTTCTTCTCTTCTTGTCCCTTCTAGTTCTTCTTCTT
CTTTCTTCCTGCTCTTCTTCCTTTGTGTTTGTGTGTGTGAGAGAGAGAGACGGATTTCTT
CTTATGCTTTCAATGTTGGTCAAGGGCAGAGTTCTGAGAGGTCCACCTGCTTCTTGCACT
GTTAGGCTCCCTCTGGGACATCTGATTCCCATCCTTTGCTCCAGCTGCAGCCTGTGTGTA
GTGGATCTCAGTTTATAGAAAATGTCTGCTTGACAGTTCTGCTTGAATAATCAGCCTGTT
AGCTCAGAGATGGAGATTATTTTGCAGAATATGGATTAGGAAGCTACTCCTGGGGTGTAT
ACTCATGGAAGGGAGAGAAGAAGTTAAGCAGTGACCGCCTATGAAGACCTCAGGTACAGC
CTCAGGCAGCTCTTGGAGCTGGCAGAACCTCATATCACATGTTGATCTGCCCTGTGCTCT
GACTGCTTGGAAGGAGGCCGTCCCTGCGTGTGCGCTGACAGTTGAGGGGCATTTCTTGTA
GCAGATGGCTGAGGGGGAGGGAGGAGTGGACATTTTATTCCTGATGAGAGTCCTTGGGGA
CGCGTCTCAGTAACTCTCCCAATCTCTAGACCTGAATTTCTTGCCTACTGTTCTAACCGA
CTGCTTCCCGAGAAGATTGTTTTCTCTTTCCCCATCATCCCTTCTCTCTCTTGGAATGGT
AAAGTTGAGCATTCCTAATCCAAAAATTGGAAATCCAAAATGCTCCAAAATTGGCAACTT
TTTGAGCAGCAGCATGACACCACAAGTGGGAAATGCCACGCCTGACTACATGTGATACAT
TGCAGTCAAAGCATAGGCACAATAAAAATATGGCACAAAACTACCTTTAGGTATGTGTAT
AAGGTATATTTGAAACATAGATAAGTTTTATGTTTAGCCTTGAGACTCTTCCTCAAGATT
TCTTATTATGTACATGCGAATATTTCAAAATCCAAAGAAGTTCAAAGTGTGAAGCACTTC
TGGTCCTAAGCATTTTGGATGAGGGATGTTCAGCCTGTAGTACCATCTACTAGATTGCTT
ACCTGAGAGCTGCTCCTCTTTCTCACACCCTGGTGTCCTTTGAGGTTCAGCTTCTTCCTG
CTGCTCTAATTCCAGCAGCTGTATCTCCCCAGCCCAGTCTCCTTCCGTGTTGTCCTTCCA
GCTGCAGTCTGAGGACCCCTCGCAGAGTCACACCGAAATGTCCCCGCCTGATGGCTCACC
CGTGAGGCAGATCGGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTATCTGG
GTCTCCCCTATGGGTGGCAGGTGCCCAAGACCTGACCATGAGGCTCTTCAGCTGCTTTCC
CAGGTGCATTAGCAGGCCTCTGGATTGGAAGCAGAGCAGCCAGAACTCAAACTGGCACTC
TGATGGGATATCAGCATTGCAAGTGGCAGCTTAACCTGCTGTACCGCAGTGCTGTCTCCC
TCTGCATGTTTTGACTCAAAAACCCTTGCATTTTAGCAAGTAGCATTGAAAATTTCTTTC
ATAACTGCTTTAATCTTGTTTGAACAAAATAGTGGTTGGGCTGATTATCAGTTGTTGAGA
CTATATGCACTAAAAGTATACTTTTCATAGGAAACATTTAAAAAGATAAACATACCTATT
TTCCTTAGGTATGTTTATTTAATTAGTAGTTTTGGTAGATATGAAGCTGAATGTTTTCTT
AAGTTCTCTCTTACTTGAACTTTTTGTTGATATGCTGATTTTGAACCATTTATCTTTGTC
TTTTGTTGCAGTGCCTGCCAATAATTTTGGATAATAAACTAAGTCACCCATTATTAGAAC
AGCTTTTGCCACCACTCAAATACTGTCTGCACGACAATTCAGAGAAAGTAAGAGTGGCTT
TTGTGGATATGCTTCTGAAAATCAAAGCTGTGAGGGCTGCTAAGGTAGGTAATGGAGGTT
ATTATATTTAATGTATGAAGTAGATACATCTGTTTTCATCAAACAGAAAGACAAAGAGTT
TTAATTCCAAGAGTATTGGTAATCACATTTTAAACAAATTGCTAACATATTTGACCAATT
GTATGATAAATTTTTGTTTTATGTTTTTCATTGAAGTTCTAGAAATACCAATGTATGTTT
TGCTTTTGAAAGACCTTAATGTAAATTTTTATATTTTTACCCAGTGTGACATGGTTTTTT
TTTGTTTTTTTAAAGATTGATTTATTTGAAAAACATAGAGTGGGAGGAAGAGACAGAGAG
AGAGAGAGCTGGTTTACTCTTCAAATGGCTGCAGTGGCTGGGGCTGCTGGGCCAGACTGA
AGCCAGGAGCTTGTTTTAAATGTCCCATGGGGGTGCTATCCTTCGCTGCTTTCCCAGGCA
CATTAGCAGGGAGCTGGATTGGAAATGGAGCGGCTGGGTCTCAAACTGTTGCCTATATTG
CGTGCTGGCATCACAGGTGGTAGCCTTACCCACCATGCCACAACACTGGCCCCAGTGTGA
TTTTTTTAGTTGAAATATTTGATGTAATTTTTAAAAAGATTTATTTATTTGAAAGTCAGA
GTTACACAGTCCACGCAAGTTTTAGAAACGAGCTGATATGTCATCAGTGTGGGATCAGCT
ACAGGCTTGTGTGTTCAGACAAGAAGTGATGCTGTGGGGCTGTTAAAGGTGTAGAGAGAA
ATTGCTGTGGGATGTACATGGAAATATTTCTTAAGATGCAGAAGTATAACAGTGAAGTGT
AGAAATGTTTTTAGTGTGCTACCAGCTATATAAAATGGGGAACTTACTTACTTATATATA
TATGTATTTGTTCAGATATGATTAAATAACACTGTAAGAGGAAAACAAGAAACTAGTGAT
CATTGCATCATGTGGGTTGGGTTGGATTTCCAAGGGCAGGGATAACAGGGAGACTTACCT
AATGTGATGTATATTGCTTTTTGCCTTTTGAAATTTTTTTTTAAGATTTATTTTATTTGA
AAGGCAGAGCTATGGAGGAGGGGGTGGGGGAGAGGTCTTCCATCTGCTGGTTCACTCCCA
AATGGCCACAATGGTTGGTCATTGGTTCTGAAAAGCTTTGTGTGGGCATACAAGCTAAGA
TTGGCCCAGATACGGAGAGCCAGGCCAATGAGAGCTGACTGCAGGCGCGTTGTCCACAAG
GAAGGAGCAGCCTGGGCAGTGTGACTAGACTGTCACACCCTAGTCATGCACACATTGTAG
TGGACATGCTGGCCAGGCTGAAGGTTTCCTGCCTGTAGAATATGTAGAATGAATGAGGGT
TACGGTTCTTTTTGTTGTCAGCCATAGTAGGTCTGGGCCAATATGCTGAGTTTAGTGGGC
CAAGCTATATCTCTCCTTCAATTTGTCTGTGTCAGTGTGTGCCTATGAACTTCTCAGATG
GGCTCTTTTATGATGTTGAAAGACAGCACTGTAGAGCATTTCTAAGCCATATATTCTTGT
GCTTAATCGTGCTAAGCCTCAGTTTCTTTATAAAGTAAGGACATCTATGTTTAGGATTGT
TGTGAAATCACAATAAATAGTGACAGAGGTACTTGTTCAATGCCTGGAGTTACTGGCAGT
ATTGGCACCTTAGGGCTGCTTGTGAGTTCAGAGTTAAAAATAACCTGTTAGGAATCATGC
ACGAGGCCAAGGGGTGTCTGTGTGTTAGGAGAGGCAGAAAGGGAACTGGTTGGGGAGAGG
AAAAAGATGTAAGGATGCTAAGATGGTTAGAAGGAGTCTTGGTGTGTATCTTGCTCTTAT
TTTTTTATTGGCACCTGGAAGGAACCAGATCTAACTCATGCGTAAGAGTCTCTGGAGCCA
TCATTTTCAAGCCTCTTTCAGTCATGTTTGGGGCATTGGTTGGCAGAACAGTCCCATCTG
CTAAAGCTGGAGGCTGTTGCTGCAGTCTCTTTCCTGTGCTACTTGGAGACTTATACAGCA
GCTACTCTCTCCTTACTAGGGCCGCGTCATCGTGGGATTGGGGTTAGTTACTGTCTTCAA
ACCCTTTAACTTTTTCCGAAATGCAAGAAGTGTCTTGTGGAAGCATCCCTGGAACACTGC
GCCCTCACCTTTACCTCCACTGTTCTTACAACAGGTGTAGACAGGGAAAGGGAGGGCAAC
CCAGGACATACAGACGCAGATGGAGCTTCTCTAGGTGTGGTTGTTTTGAGGGTTGGGATG
GCATCGGAATGTTTGACTGCTAATGAGAAGCATCGCACTGAATACAGCTGAAAGAGAAAG
TGCTCCTTAGCACAGGTCCTGAGAGTAGGCCAGGTCCAAGGCACTGCTTACATCTAGGTA
CTGGAGGACCTTGGAGGAGAGTGAGGCAGGGTTTGTCATTCTGCCTTTGGAATCTAGAGT
CTGTTATTCTGCTTTATTATACTGTTTCTTGTCTTGACCAGAATGTTGGTGTTTTCTGTA
GGCAACTTTGAGAGCTTTTGAGTGGAGAAACAATTTGTTAAGTTCTGATCTTGGCAGGCT
GTCGGTAGTGGCATGTGAGGTGGGGTGGCAGGAGGCAGAGACCTAGCTGTGAGGATCTGA
CCCCCCAGGCACCTGGTGCAGGAGAGGTGGGGACGGACAGGCAGCCCTGGGTGTTCAGGA
CTAATTCCCATACCTCTAAACAGGAGATGTGGTTTGTCCATGTCACAACTGTTAGCTACT
TATTTACTTTCACTTTAGCAGGTCAGCAGTTATGGTGTCTGGTAAGCATAAGTAGTATTT
GAGAATTGCTATATATGAATAATATTAAATAATTTTGACAAACCCTGTGGTTTTATACCT
GAGTACCTTACACATTGGTACTTTTTAAAATGTAACTTTGTTCTCATTTCTCTGCAGAAT
AATCACAGAATCTGGTATGTTATTAAAAATGATTCTTTTAAATATAAAAATTAGTTCCTT
TTGGGTTGTGTTCTGGACACCTTGCTAAAGCTGTCTTCAGGATTATAGGAACAGTTGATC
ATTTCCTTCTGCATGTGTGCTTTATATGCAGTTTTGGAAAATATGCCCCATGGAGCATAT
TTTGGTTCGTCTGGAAAATGATTCTCGACCTGTGTCTCGACGCCTGGTGAGCCTCATCTT
TAATTCTTTCCTGCCTGTGAACCAGCCAGAGGAGGTCTGGTGTGAGCGTTGTGTCACTCT
GATCCAGATGAATCATGCAGCTGCCAGAAGGTTCTACCAGTATGCACACGAGCACACCGC
CTGCACTAACATAGGTGTGGACCACTGCTGCTTCTCAGTTCTTACGTTGTTTCTCCCCTA
AGTGTAAGGCCGTTACACACAGTCAGTGTTTGTCAGTTTACTGGGCTTGGTGCTTTAACG
CATTTCTTAATGGTTTCTCCTAAAGTAATACTTTTAACTATTTGGGATTATAATTTTACT
ATTAGAAAAGTTGATTTTACCAAAGAAACGTGTAAATTAATTATTGATAATCTTAAACAC
TCTAGCAAAGCTGATCCATGTTATTCGCCATTGCTTAAATGCCTGCATCCAGAGGGCAAT
GAGAGAGTGTCAGGAGGATGACGAGGAGCGGGAGAAGGAGAACGAGAGCGTAAGTGGAAC
AGCACTGCACCCAGCCAGACATGAGCTGCCCGTAACTCCCTCCCCCACCCCAGACAGGCA
GAACCATTAACCTCATTATATCATTTCCATGGACTCTTAGGGTAAGAATATTTTGATCTT
ACATTTATCCCTTTAGTATTGATATTCAAATTATTTTGGAACATCATGTCAATTGTTCTT
GAAAGAATTGCTTTAGAGTTGGGATTGGATTTAATTTAGAAGAAAAATTCTTGTTAGTAA
CACCCTACCCCAGATTTTCTTTGCCTTGAGCTTCTTTGTATATTTCTACTTTACCTAGAT
ATGGTATAACTGGGTGGGTTCTGGACATTCCTGTAGTTTATAGTTAAGTGTGTGATGGTG
TCATTTAGAGCCACTGCCCAAGTTTCTACTAAAAACACCTTGAAGCTAAAGTTTTGGGAA
TGAGACGTTTTTAGAATTATCTTTTTATTTTTTATTATTTTTTTAAAGATTTATTTATTT
ATTTGAAAGTCAGAGTTACACAGAGGAGAGGCAGAGAGAGAGAGAGGGCGGTTAGGGGGG
GCTCTTCCACCTGATGGTTCACTCCCCAATTGGCCGCAATGGACGGAGCTGTGCTGATCT
GAAGCCAGGAGCCTCCTCCAGGTCTCCCACGCAGGTGCAGGGGCCCAAGGACTTGAGCCA
TCTTCCACTGCTTTTCCAGGTTATAGCAGAGAGCTGGGTCAGAAGTGGAGCAGCCGGGTC
TTGAACCGGCGCCCATATGGGATGCCAGTGCTTCAGGCCAGGGTGTTAACCTGCTGTGCC
ACAGCACTGACCCCTAGATTTATCTTTTTAAAAGTGTAATTTAGAGAAGGTACTCAGTAG
CAGCTATTTTTTCAGAATTCAAAGATTTTAGAGGTAGACTTGCAGACTGAGAGTGGTCTT
CCATCCGCTGGTTTACTCCCCAAAAGGCCGCAACAACTGGAGCTGAGCCAATCTGAAGCC
AGGAACCAGGAGCTTCTTCTGGGTCTCCCTGCGGGTGCAGGGGCCCAAGCACTTAGGCCA
TCTTCCGCTGTTTTCCCAGGCCATAGCAGAGAGCTGGATCAGTAGAGGAGCAGTTGGGAC
TAGAGGCGGTGCCCATATGGGATGCTGATGCTGCACATGGAGGCTTAGCCCACTATGCTA
TAGTGCTGCTCCCTCAAAGATTTTTAAGAACAAGGAAAAGCTTTCTTGGTAGAGTTCCTA
GTTTGAGAAAGGGTTCCATTCAGTGGGAAGACACCCAGCAAAATGCATCATCTTTTTTCT
TTAAGATTTAAGATTTATTTATTTATTTGAAAGGCACAGAGTTACAGAGAGGCAGAAGCA
GAGACAGAGAGAGATTTTCCATCTGCTGGTTCACTCCCCAAATGGCCACAGTAGCTGAGC
TGCGCCAATCTGAAGCCAGGATCTAGGAGCTTCTTCCAGGTCTCCCACATAAGTGCAGGG
GCCCAAGCACTTGGGCCATCTTCTACTGCTTTCCAGGCAATAGCAGAGAGCTGGATGGGA
AGTGGAGCAGCTGAGACTCAAACCAGTGCCCATATGGGATGCTGGCACTGTAGGTGGCAG
CTTTACCTGGCTACACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCATTGTGATTCTCTGGAAGAGTATTC
ATGGAAGTATGGAAAATAACAAAGAGGCCAAGGTTTATACTGTTAACAAGTTTGCCTCTG
TGCTTCCAGAGTATCTGAAAGTATTCAAGGTAAGTCTTGAACTGTACTCGGAAAGAATTA
AGTATTAGAATTGCATTTGTTTATGTTTTGTTTATTTAGAATTTAGTAAAAGTTACTTAC
GTGTTTGTCTGCTTTCTCTGTAAAACAAGAAGGTTCAACAGCAGTATAACTCGCAGTATA
ATTAGTCTTTCTCATCCTGCTTGAGGGTAGAAGCCACATGTCTGCTTCATGTCCTCGGTA
TGCTGAAAATGTCTGTGGTAGGCCCTTAACTTTCTTTTTTTAAGATTTTATTTATTTGAG
GGGTAAAGTTAAAGACAGTGAGAGACAGACAGAGAGAGAGATCTTCCATCCACTGGTTCG
CTCCTCAAATGGCTGCAACAGCCAGAGCTGGGCTGATCCAAAGCCAGGAGCTGGGAGCTT
CCTCCAGGTCTCCCATGTGGATGCAGGGCCCAAGTGGTTGGGCTGTCTTCTACTGCTTTG
CCAGGCCATAGCAGAGAGCTAGATCAGAAGAGGAGCAACTGGGACTCAAACTGGCACCCA
TATGGGATTCTGGCAACGCAGGTGGAGCATTAACCTACTGAGCCACAGCACCGGCCCCAG
GCCCTTAATTCTTCTGCTCTAGTAGTCTGTGATGCTGTTTTAGAACATAATCTGATTTGC
AGTTTTAGAGGATTTTATGAACATGAAGATGAGTAGCACCTGTTTTATGGCAGTTTTACT
TAGATATTGAAGGCACACAATAAGAAAATATGTTCTTGAAGTATTTGAGTTGTGTCTGTG
TTATTGGTGCGTACAGAACCGTGTGTGTGTGTGTGTGTGTGTTTAATGTGTATGTGTATG
TGTTTGAGAAAAAGCTCCCATCTGCTGGTTCACTCTCCAAATACTTACAGTGATGTGCCA
AACCTTGGAGCCAGAAACTCAGCCCATGTCTCTCATGTAGATGAGAGGAACCCAATCACT
TGAGCCACTACTTTTGCCTCCCAGGATCTGCATTAGCCCAGAGAGAAAGGGAGAGACAGA
AAGAAAGATCCTCCGTCTGCTGGTTCACTTCCCAGGTGAAGCCAGGAGCCAGGAGCTTCT
TCTGGGTCTCCCATATGGGTAACAGGAGCCCAAGCACTTGGGCCATCTTCTACTGCTTTC
CCAGGCCATAAGCAGAGAGTTGGATCAGAAGTGAAGTAGCCGGGACAGTAACTGCTGCCC
ATATGGGATGCTGGCCCCGCAGGTGGCATCCTCACCCTCCATACCACAATGCTGACCATA
GGAAAATTTTTTTCTTTAGGATCCACCAGCGAAGAATGTTTCTTATTGAATGTTCTTGGT
GGACTCTGCACCCCATTTACCGTATCATTATAATAATAATATAGCTACAATTTATTAAGT
AATGAATGCATGCTGCTGCACCAGGGTTTTGTATGTTTGGTTTATTCAGCTGTCCTAACA
GTCCCATGTCAGTTTCATAGAGGAGCAAACTATTAATTCAGCTCTTTTCCCTTGTGCTGT
ATCAGCTGATAGGGTTGTAGAGTCAGATCAGATTTAGATTTGGGCAGAAAGCTCCATAGA
CTGTACGTTTCCTGTTAAACTACACTGCCTTCCCAAAGATATTCTGACTCATTCATTTTT
TTCTGAAAAAAAAAAAATTTTTTTTTTTTTAAAGATCTGTTTAGTTATTTGAGAGTCAGA
GAGGGAGAGACAGAGAGAGAGAATCTTCCACTCCAGATGGCTGCAACATCTGGCTGAGCC
AGGCTAAGTCAGGAGCCAGGAGCTTCTTCCAGGTCTGAGTAGCAGAGGCCCAAGCACTTG
GGTCATCTTCCTCTGGTTTTCTCAAGCCATTAACAGGTAGCTGGAGCAGAAGAGGAGCAG
CCAAGACATGAACCAATGCCCATATGGGATACTGGTGTTGCAGGCCTTGGTTTTACCCAC
TGCAGCACAGCGTCACACCCCTCTGAATAATTTCTTTCTTAAGATTTGTTTATTTATTTG
AAAGAGTTACTCACTGAGAGGAGGAGAGGCAGAGAGAGAGAGATATTTTCCATCCTGTTT
CACTTCTGAACTGGCTGCAATGGTGGGAGCTGTATTGGTCCAAAGCCAGGAGCCAGGAGC
TTCTTCCGGGTCTCCCACATGGGTGCAGGGACCCAAGGGCTTGGGCCATCTTCTACTGCT
TTCCCAGGACATAGCAGAGAGCTGGATAGGAAGTGGAGCAGCCAGGTCTCGAACCGGCGC
CCATATGGGATGCTGGCACTGCAGGAGGCAGCTTTACCTGCTATGCCACAGTGCCGGCCC
CTACTGTAACTCTTACCGAGCAACTTTGAACATTGGTTATTAAGCATTTATGTGGAAAGA
CTTAGACAGTTTCTTAGTGTTTGAATATTCTGTTTGATTTTTTTCCTTTGTGTGCTTTCA
GGATGATCGCTGCAAGATCCCATTGTTCATGCTGATGTCGTTTCTGCCAGCATCTGCCGT
CCCTCCATTCAGGTATTTGCTGCTTTTCAGTACAACGGAAAGGCAGGAATCTTGACCATC
CTTGTACTCAGAGGATCCTTGCATTTAGCTTTTTTTTTTTTTTTTTTTTTTTTTTGATAG
GCAGAGTGGACAGTGAGAGAGACAGAGAGAAAGGTCTTCCTTTGCCGTTGGTTCACCCTC
CAATGGCCGCCGCGGCCGGCGCACCGCGCTGATCTGAAGCCAGGAGCCAGGTGCTTATCC
TGGTCTCCCATGGGGTGCAGGGCCCAAGCACTTGGGCCATCCTCCACTGCACTCCCTGGC
CACAGCAGAGAGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCCGGCGCCCCGACTGG
GACTAGAACCTGGTGTGCTGGCGCCCCAAGGCTGAGGATTAGCCTAGTGAGCCGCGGCGC
TGGCCTTGAGGGATTTTTTTTAAGATTTTTTTTTTTTTTTTGACAGGCAGAGTTAGACAG
TGAGAGAGAGAGAGAGAGAAAGGTCTTCCTTCTGTTGGTTCACCCCCCAAATGGCCGCTA
TGGCCAACGCCCTGCGCTGATCCAAAGCCAGGAGCCAGGTGCTTTCTCCCGGTCTCCCAT
GCGGGTGCAGGGCCCAAGCACTTGGGCCATCTTCTACTGCCTTCTCGGGCCACAGCAGAG
AACTGGCCTGGAAGAGGAGCAACCTGGACTAGAACCTGGTGCTCAAATGGGATGCTGGCA
CCACAGGTGGAGGATTAACCAAGTGAGCCATGGCGCTCGCTCTCATTTGGGAGGATTTTT
AACACCCTGGTGTGATGACACTGTAGGGCTTCTCGCTGCTGCTGCCCACATGTGGCTTTG
AGTACTTGCAGTGTGGCCATCTGGGTTGAGTTGTGCTGTGAATACAAAATACATGTGGAG
TTGAAGCCTTGCTGTGAAAAGAGGAATGTGAAGTGTTGGCTGCCTATCAAAAGTATATAC
TGGATAGATGAGATTAAAAGGTGTATTACATTTTCTTCACCTCTTTATTTTTACCTTTCT
GTATGTGGGTACTAGAAAAGTTAAAATTACCTATATTATTTCATTTGATGACTTGCATAG
TTTTTATTGTACAGTAAAGCTCAAGTGTGGTTATTTCATGAAATAAGCTATATTCAAATT
TATGGATAAAAAATGAATGTTTTGAGGAGAAACAAATATTGTTCCCTGAAATTAACAACT
CTTTCTCTAGACTCCACAGAGATGCCACAGAAACAAAAGGGAAAAGGGATAGTGTGGCTG
GTGTGGCCCTGACCATTAACACTTACCAAAGCCGCTGTCCCATTGAGTGTTTCAGGGTAG
GACTCGTCCCATGCAGTGATTGGGGAAACTATGTATTCCCCCTGCATTGGAGAGTGGTGA
AGTGTTGTTATTGTAGCAAGGGATTGTGCATCCTTAGTGTTTAGCTGCTTTTTCTTCACC
TCTTGGGGAAGTGGGACAGTTGTCGCCATGTTAATCTGATTTTACAAATTTGGTATTTTC
AGTTGTAGTGTGATTTCCACACTGAGAAGCCAGGAGGAGAGCAGTGTAGAGAAGAGCTAC
TACACCTTGTTGGACTGCCTCTGTTCCTGGGGACAGGTGGGACATATTCTAGAACTTCTT
GATGACTGGCTGCCAGGGGAGCAGCTGCAGACCAAGGTATATTTTCATTGGCTTTATTTA
AAATTTGATGAATATGCATAACTGTATATTAAAAATTATCTGCTTTTCTAGGAGCATGCT
TTAACAATCAGTTCGTGCTCTCTTTCAGAGTAATTCAGCATCTAAACGTAAAGTGCAAAT
CCAAGATGCATGCCCCGTGAAGCCTGAATTAGCGCTGCTGTACTTAGAGTATTTGCTGAC
CCATCCCAAGAACCGCGAGTGCTTGCTGTCTGCTCCCCAGAAGAAACTTAACCATCTTTT
AAAAGCACTTGAAGCCTCAAAAGTAATTTGATTCCTGGGTGATTCTTTATAATTGTTAAT
TTTTCTTTTTACAGTACTGTAAACTTTTTCAAACAGAAGAGGAATTGAGAGGGGTCTAGT
GCACCTTCCTCAGTTCGTAGACGAGACCCCTGGGTTGAGGTTGGGAGTAGAGTCTGTTTC
CTGGCCCTGGCCTTCACAAGAGCAGTGTTCAGAACTGTGTTTCTGCAAGTTTCTTAGAGT
GCCAGGAGCAGGTGCAGTTCTGTCTCTCAGAACACACCACCTGTGGGAAGCCGGTTCACA
CACAAGTTCTCTTCTGCTCTGCATCTGTCCATCAGTGTGAGATTCCTGGCTCCCTTCAGA
GTTCTTGCCAGTTGTTTTCTGGGAATCCTAGAGAGTACATGGATGTCCTGTCAGTGCTCT
GTGGAGTCCTTCCCATCCCTCTGGCCCTGGACATCTGCAGGAGCCAGCCTCTGAACAGCC
TCTTGTCACTGCTGCTGTTGACAGTGGCTCTGCATAGCTGGGGTGGGCAGGGACGTCCCG
AGGGCTGCAGGATGAGGTGGCCTGACGTTAGGGCGGAAGTGGACAGGGTGGTGTGGTGCT
TGAAGTCTCTGTGCGTCGTGGCTGTGGGAGACAGGAGGCCTGCTTGCCTGCTGTGCTTCT
CAAGCCCAGTCGGGGCTTCAGTTCAGGCTGAACTACCCGAGAGCTGGTGCCTTTCTGGCG
CACCTGCAGACAGGCATTTCCAGCTGGACTGAGGTGGTGGCCCTGCGGATTTGCACGTTA
CAGGCGGATCTGGAGGCGCTTCTGCAGTCACCTGGCGGGAAGCCTGGCGTGAACGAAGCC
ACTGCTCTGCGAGCCTTCAGTCTGCACTGCCGGCTGAGCATTCACCTTCAGCACAAGGTG
CGCTGCGTCCGGGGCCCTGTGCCGAGGGGAGATGAGGAGCGCGTCGCAGAGCTCCTTACT
GATCTGTCTTTTTGATGTTGGACAGTTCTGCTCAGAAGGGAAAGTTTACCTGTCCATTTT
GGAAGATACTGGATTTTGGTTAGAAAGCAAAGTTTTATCTTTGATTCAAGATCAAGAAGA
AGAGTACCTGAAGCTTCACAGAATTGTTTATCAGCAGATTATCCAGGTTAGAAATTTTAA
GAAAGAAGTCTGTCTTGTGTGTTTCAGATTGCTTTTCTGCTTTAACGTAGTGATTTTAAC
CATTAGTGTTGCTCTTTCTAATGATTAGAGTAGCAGTTAAGTATCACAAAGCAGAATCAT
GCAATTTTGATAGAATTTTACAAATTATATACGATAGGTATTCAGTTGTGTTTGTGGCAT
TACATAACATGTGTTTCTAGATTTCTTATGGCAACAAAAATGAAAGTATCTTTATGAACA
TCCTTTTATACACTTACGTAAACGTGTGCTTTGGAGATGGCTGACCAGAACATCATGGGA
GGTTTATCGGGCTGTACTTCTTCCCCTTTCCTCACGGCCTTTGGGAAATCCCACCTGTCT
CTTACAGACCTATCTGACTGTATGTAAAGATGTCGTCATGGTCGGCCTTGGGGACCTGAA
GTTTCAAATACAGCTTTTACAGCGGACTGTTGGCATCATGCAGACAGGTACAGCATACCT
CATCCATTAAAAGACTGGTTTAGAGCCACTGGTACTCAAAAATGGTCCTTCGTGCTCTGC
TCCCTCCTTTCGTAGATCAAGACTGTCACTTTTAAGTGATTTATATGTAATGCAAACTAG
CTTATACCCAGATAGGTATTTCTTGGCTGTCACAGCCAGGAAGTTGAAGTGGGTTCCTGG
CACTGGACACATCCAGAGCCTCTGATGTGCTGCTTCCCACGGTCTGCTTTGCCAATAGCT
TTCCCCGTGGGATGGAGCTGTTTCCTGGTATTTGTGTAGGAAACTTCATAGAAGAGCCCT
TGACTGCTGAGTGCTCCTGTACGTGGGTTGTGAGTTGGCATTTTCAGGAAAGAGTAACAT
AGGGCAACCTGCAGTAACGAATAACACTGCACTATGTTTGCTGCCTGCTGGGTACTAAAT
CTAATGTGTTTGGGGAGGGAGTGAGAGGGCAGCCACTGGGGCCATCTGGGTCCTAAAGGC
CAGGTTCTCACAGCACATGTCAGGAAGGGGTAGAAGGTACCCTGGCTTGTAAGCACTGAA
CTGCTTCTCCATGGCTTGCTGCTCTGGGCTGTTAGCGAGTGAGTTGCTTGTTCCTTTGCA
GATACTTGGGAACCTAGAATAGTAGCTTGCTGACAAGAGCCATAGAAGCCAGCATTTCCT
CAGTGGCAGGCTGACATCCCTCCCAATGACTGATGAGCTGATTTTCATCATAAGTAGACC
TGACAGTACTTGTGAATCCCGACATACCTTTAGTAATTTATTGTATTAACCAGTGTCCAT
CGTATATTTGCTTTGTAATGTACATACTGCTTGAACTTAATGGAGTAACTTTCATTTATG
TAACTTCATGGATTTTGTCAATAATTATAGATAATACTTTTTTAGGTTCTCCCCCATCCA
CACTCTGCCTTTAAGGAGGGAGATCCAACTCTCTTGTCCGGATCTTGTAGGGCTTCACAA
CCATTTAGCCTCTCCTGAGTTGTCCATGCTTTGTCTGTAAAGAGCTCGAGATTCCCGTAT
CATTTGTTCCACTGATGAGTAGTTTTGCAAAAGACTTACATGTGTGGAAGTTGCATTTCC
TTTTGCTTTCTTTTAAATAAAAGAGAATGGTTCCTTGAAAGCTTCTGTTATGATCTGAAA
GATTTTAGAGAGTTTTTATTGATCCTAGTAGAGCCATTGGCCTTTTGCTGGGTAGTCTAG
GATTTCTGGAGATTGGAAATGGAATATAATTTATTTTATTATAACAAATTTTAGTTTAAG
TGTGTAGTAGATTCTAAGAAAGCACCATGCAACATCATTCCTGCTGAGAAGGGTTTGCTG
CCTATAAACAGGGTGACACCCATGCATGGACACTTGAGAGTTGACTGGCATTCGGGCAGT
GTGGTTAGAATGGGATGAGAGTGCAAAAACAAGCCCACCCAGCTTACCAAGCTTACCAGC
TCTGTTTTTATACCTGCATTCACCAGTAAGATTGGTTAGACGCAAAAATGAAAATTCAAG
ATCTCAAGGATGGATATACAGAGTAAATGTTACCAAATTAATGTAATCAACTAAAGGAGA
TGATTTGAGGAGAAAGACAGTTAATAAGCTGCCACCAGATGTTAGGAATTTAGCAGCCAG
CCTGTGAGCTTCTCAGGTTGTAATCTGGAAGGTGTGAGGCCCGCCCTGCCGTGTTTCTCA
CTGCAGCTGGCTTTTGGTTTTGTGATACATGAGGAGTAATTCATGTTCTCTAGGTAAGGT
GTCCAAGGAGACGCACTGCTGGCTTGCTCTGTGTTTACATAGGCAGTGGATATAGTGTTT
AGTGTGGTGACTGAGTCATATTGTTAATGTTATTGAAGGTATTGGTTTTTACTTAAATGG
AACAAAAGTCTTATTTATCTTGATAAGAATTTAGGTTCATCTAATCAACCTTGTTAGTGC
TAAGTCACCATCGTAATATGTGTGTTAAGTGACTTTATGTGATTTTCCCCATTTTATTTC
TAGTGAAAGGATTTTTTTATGTTTCATTACTTCTTGACATCCTGAAAGAGATAACTGGGA
ATTCCTGTATTCAGAAGATGGATTCAGAGGAAGAAGTTACAACACTGTTTGACACAGTCC
AGAAAGTATTTCAGAAACTGTTGGAATGTATTGCGCGGAGCTTCAGGAAGCAGCCAGAGG
AAGGCCTGCGGGTACTCACGTCCTCCCTGGGTTCACTCAGTGGGCCGCAGGGCCCGGCCG
CATGGGGAAGGCAGCTGCAACCAGGCAGACTCACCCACCCTTGCTGTGCTGTTTGCACTG
GGTATAGGAAACCATTGCTAGACGGTAGCCTTCACAAGAGTTGCCACACTTCTTTACTGA
GAAAAATCGTCATCTCTGCTCACGGGGCTGGATAAGAGGCGCCAAAGGCCTTGGGTTCTT
GATTGTGCCTGTAAGTCTGGGAACAAGAGTTCAGGTCGACGAGCTGACTGGACACAAAGC
AGAGAACTGATTGCCAAAGCTGCTGTGTGCTCAATCGTTGTTAAATTCAAAAAATTTTAA
TTCTGGAATTAAACTTATTAAGTAACATTCATAGAATTTTCCAAAAAAATGTTATTTAAG
ATTTATTTATTTACTTTTCAACTTGTAAGTCAGAATTACAGAAAAAGGGAGAGGCAGAGA
GAGATCTTTCATCTTCTGGTTCACTCCCCAAATGGCCACAACAGGATAGGGATGGGCCAG
GCTGAAGCCAGGAGCTAGGAGCCAGGAGCTTCTTCCAGGTCTCCCATGTAGGTTTCAGGG
TCCCAAGCACTTGGGCCATCTTCAGCCGCTTTCCCAGGGACATCAGCAGGAAGCTGGAGT
GGAAGTGGAACAGCTGGGACTTGAACCATTGCCCATGTGGGATGCCAGCTTCCCACTTGG
CAGCTTAACCTACTGTGCTACAGCACCAGCTTCCAAAAATAATGTTTTTGAAGATGCTAA
TTTTAGTTGTTTGTAGAGCAGAGTACTTGTTCAGATTAAATACTGATTTCTACATCATGG
GTCACCTTTTCATCATGTTAACCTTCCCCAGATTGTGGGAATCTCAAACCTTAAAGATGG
GCTTTGGTTTCCCTTTGCTGGTGAAAAACTGTTGGGAAGTGAGATTAACCAGTACATATA
AAGACCAATATTCCAGATTTGCTTAACTCCTAGAAATAATGTAATGCCAATTTCTGAACA
AAATCATTGTTTCAGAGAGCTGTTATCTTTTATATCAACAAGCTATGGTTTTTATTTTTT
TAAGATTTATTTATTTGAAAGGGTAAATGACAGAGAGACAGAGAGAAAGAGATCTTCCAT
CCATTGGTTCACTTCCCAAATCGCTGTGACAGCCACGGCTGGGCCAGGCCAGAACCAGGA
GTCAGGACTCCATCCAGGTCTCCCATGTGAGTGGCAGGGATTCAGGTACTTGGGACATTT
TCTGCTGCCTTCCTGGGTGCATTAGAGGAAGCTGGATCGTAAGCAGAGCAGCCAGGACCT
GAACCAGCACTTGGATATGGGATGCCAGCATCGCAATCTGTGGCTTAACCTGCTCCGCCA
CATGCTGCCCCTTTTTAAAAATATGGTAAAAAATGGGAGGCTGTCTTGAAGAGTTTGATT
TTTATTCTGTCCTTACCTGATAGAGGTAATTGAAGGCAATTGGCCATATTTTTCCTAGCC
TATTTCAAACTATGAGATTAATTTGAAATGCTTCTGGTTTTTAAAAAATTGTTATATNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCAGGCTAT
AGCAGAGAACTGGAGTGGAAGACGAGCAGCTGGGACTAGAACTGGCACCCATTTGAGATG
CCCAGCACCTCATGTGGAGGATTAACCTTCGGCGCCATGGAGCTGGCCCCGTAAATCTGA
CTTTCAAGTAAATAAATAAATCTTTAAAAAAAAACAAAAAAACAAAAAAACGATAGTAAT
CTCCTAGGGGAGAACACTAGGAATACCCTTCTTAAAATATGTATATAATATAGTTTTTTA
AAAACATGATTTTTAGCGCCACTGTAAGCAAATGATGTGTTTTCTTGTAGCTCCTGTACT
CTGTTCAGACCCCTCTTCATGACTTCATAACCACCGTTCAGTCCTGGCACGCCGATACTC
CCGTTCACCGGGCCGTGCTCTCGACTCTGATTGCTGCGCCTGTGGTGGAGATAAGTCACC
AGCTCCGGAAGGTGAGGCGTGTGGATCCTGACACTGCTTTGTCTCTGAGCTCTGTAAGAC
TCTGTTTGCACCGGCAGCACATGCTTAATGTTCTTCAGAGATCTCAAGCTGAATTGTATG
TTTCCTAGCAGCTTTATCTTAGAGTCTAAAAGCTAAATGGTTAGACTTTTATTTTATTTT
CTGAAAATTTATTTATTTGAAAGGCAGAATTACTGAGCACTCCCTCAAATGGCTGCAACA
GCTGGGGCTGAGCCAGGCAGGAGCCAGGAGCCTGGCATTCTATCTAGGTTTCTCTCTAGG
GCGACGGAGCCCACGCTCTTGAGTCATCATGTGCTGCCTTCCCAGCACACTAGCAAGGAG
GTGGATCAGGAGTGGAACAGTTGGGGCTTGAACCAGCGCTCGTATAGGCTGTTGGGTTCA
CAGGTAGCACCTAACCCATTGTGCTACAACGCCAGCTCCAGTAATTCTAGAGTCTTATTA
CTGTTGTGAAAAATATACCACGGGTGATATGACTCAGCCTGACTCTTCCCTGCATTGGGA
ACGTAGCTCTTTGCTGTCTGTCAGAGATTTAAATGGCCTAATACATTTAAATCGTCTTCT
GTCCTGGGTACATGAAAGCAGTGGTGAGCAGAATGCAAGTCCACTCCTGGGCTGTATTTT
GAAGACTAGTTTATATATTTTTGTTTGCCTGCTGTATTACCACTGCCCCCTCAACTCCCA
TTTCTAAGCATAGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGGTGCAAAAAAGTTGAATTATACAAAT
AATTTCTGTCATAATAGTATTTTCCACAAACTTTAAAAATCCTCTCATACAAACATTATT
TTTATAACATAAAATCATGATTCATAAAAAGATATTAACTAAATTCTGGCCGGCGCCGTG
GCTCAATAGGCTAATCCTCCACCTTGCGGTGCCAGCACACCGGGTTCTAGTCCCGGTCGG
GGCTCTGGATTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTATGGCCAGGGA
GTGCAGTGGAGCATGGCCCAAGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAGGAAG
CACCTGGCTCCTGCCTTCGGATCAGCGCGGTGCACTGGCTGCAGCGTGCCCGCCACGGCG
GCCATTGGAGGGTGAACCAACGGCAAAAGGAAGACCTTTCTCTCTATCTCTCTCTCTCTC
TCTCTCTCCCTGTCCACTCTGCCTGTAAAAAAAAAAAAAAAAAAAAAGAAAAGATATTAA
CTAAATTCTAAAACATTAAATAGAATTTAAGACCCTCCTTAAAACTTGATGGGAGATCAT
TTTGGCTTTAGAGTATATATATAAAAGATAAAAACTGGGATGAATTTATTTCAGCAAACT
ATACAGCTGACAGTTATAATTAATGGCCTAGTAGCTATCCTGGTACACCAGTTGTTTTTT
TTTTAAAGATTTATTTATTTAATTTGAAAGAGTTACATAGAGAGAGAAAGAGAGGCAGAG
ACAGAGAGGGGTCTTTCCACTTGCTGGTCCACTCCCCCAATTTGACCGCAGTGGCTGGAG
CTGTGCCAATCTGAAGGCCAGGAGCTTCCTCCAGGTCTTCCCACATGGGTACAGGGACCC
AAGGACTTGGGCCATCTTCCACTGGCTTTCCCAGGTGCATGAGCAGAAAGCTGGTTTGAA
ATGGGAGCAGCCGGGACTTGAACCAATGCCTGCATGCCATGCTGGTGTTGCACATGACAG
CTTAAATCACCGCAACACAATGCTGGCCCCAAATGTCACCATTTCAATGACTATATGCAT
AAAAAGGATACCACTGGTATGTATTATGTACATCTGATATAGTCCACATATTGTAGAATT
GTGTATTTTATTCCTTTACAGGTTTAAATATATATATATATATACTCATACATTGAGCTG
CTTTCAAATGGAGTAACATACATCTTACAATTAAGAAGCACAGCTAGAACCATTCAAAAC
TTTTAAATCCTTACAGGTATTAATAAAAGAATGAGCAAAATAAAATTTAACAGGAGGGTT
GTGTAGAAAAAGAACCCACGCTAACTCACTGGCAAGACACCCTATGACGGAATAGCAGAG
CTTGAAACAATCCATTCAACCCATTGACTTTCTTCGTTTATAAACAAGGGAGCTTGGAGT
GATTATGCAAACTTGGCCAAGAGCTCTTTGACAATTACATTACATAAATTGTATTAACTG
AGCCCTAAAGTATTGCCCTCTTTTTTGTTTTAAACCCAGCTATCCAAAAATCATTTAACA
TTGCATGGGTGGAAGTGCAGACACAGATGAGCGAGGCACAAAGGAAGCACTTTAGGCTGG
CGCCTCGGGTCAATAGGCTAATCCTCCGCCTTGCGGCGTCGGCACACCGGGTTCTAGTCC
CGGTCAGGGCGCTGGATTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTGTGG
CCAGGGAGTGCAGTGGAGGATGGCCCAAGTCCTTGGGCCCTGCACCCCATGGGAGACCAG
GATAAGTTCCTGGCTCCTGTCTTTGGATCAGCGCAGTGCGCCGGCCACAGCGCGCCAGCC
GCGGTGGCCATTGGAGGGTGAACCAATGGCAAAAGGAAGACCTTTCTCCCTGTCTCTCTC
TCTCTCACTGTCCACTCTGCCTGTAAAAAAAAAAAAAAGAAAGAAAGGAAGCACTTTAGA
AAGAAGACTCATCGAGATAAGGGAATTATTCGGTGTGATCTGATTTCAGCCATTTGCCTA
AGTGATTCTCAAAACAAAGGGGCTGGTATTTTCTAAGAGCCTCTGTGCTGACTCATGCCG
TTATCAGATCTTCAGAATAAAGGGAAAGTGTGATGAGAATCTTAGAGCCTAATGCATTTA
TCCAGAGATCATCAGTGTGATCCTGTGTAGAACTCGACTTGACATTCACTGAAAACCCAG
GATTTAAGGCAGACCCTAAGATGACTTCCTAAAGAAATACAAATTTAAGGATAAGTACAG
TACACGTGCAGTCATATGCCATTTATACACCACTGACAGACAGGAGAATCACACACAAGG
TCTCCCAGGCACCTGACACTCGGCTTTCTTTCCTCACTCCCCCACCCTATTTATTTATTG
GGAATGATTTTTGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTGAGT
GAACCCCTTGGTTTGGCCTCTGGTGATAGTGTTCTTGCTTAGAGTCCGGGGTGGCGCAGG
GCATCACATGGCAAGAGAAAGGGAGTGTGTATCTATGTTCCTTTCCTTGCAGAGCTAACC
AGGATTCAATCTGCTCCAATCTAATTACTTCCCAGAGGCACCACTCTAAATGCCACAATT
CGATTTAGTTTCCATTGCCTTAGTGGCATTAACTAAGACTTTTGGGTTTAAACTGCTGAG
TAAGTTTGGGGGCCAGATCATATTCAGACCACAGTAAGCAAATTTTCTGTTGATTTGGCA
TATATTTCCTATTTTAAAAAACTTGAATTTATTTTGTTAATAATGGATGCTTTTGTGTTA
ATATTTAATTTAGCTACTATTTCTCTTAAACCTTAAACTTGGCTATTTTGAATTTCCTAA
CCAATTGAAATAGTATTGGAAAAATAATTTGTATGCTGTAGCCATGTGAAAAACATTGAC
ATCCCTACAGGGGCTACATTTGACTTTTTAATTGTTTAGTCAGAATTATTAATTTTGAAA
TAATTTTCAAAGTTAATATAGATAGAGAGCTGCTTCTGCAACAAGCTCTTTCCATAATTC
TGGTGCATATTTGAAGATTTGAGTTTCACTGATACCACGCACTTGAAACAGGAAGTGTTT
TTGAAGATTTTCAGATTTTGGAATATTTTCATAAATTGGCCAAGCATTTTTGGTTCAAAA
TCCAAAATGTTTCTAAATCTGGAGTTTTTTTCAGCTTCATGTCAATCACCAAAAATTCTG
AGTGCCTGGCACTTAATAAATATTAAATACTTATCATATTTAAACAGGTGGATAACTGAA
ATATGATTGTAGTTAGGGCGTGTGTGTGACTTAGAGGTTCAGATGACCCCGTCTCAAGCA
GACTACCTGGGTCCAGTGCCCGACTCTGGCTCCTGACTCCAGCTTCCCATTAATGCACAC
CCTGGGAGGCAGTGGTGATGGCGCAGGTCATTGAGTTCCTGCACTGAGGAGGCTCCAGCT
TACGGAAACTGTACCCATGTGGATAGCAGAGCACATTTGCTTTGTGCGGTAATGTGAAGA
TCTTTTCTCTGTTTTTATTGTAACCTTCCCAAAGGTAAACATAGAAGTTCAAAAGTGAAG
GAAGTTGCAGCCACTATTCACAGGAAGCTGAAGACATTCATGGAAATTACTTTGGAAGAA
GACAGCATTGAAAGGTAAGGTGCGAGATGTACTCTAGATGTGATTATCTGAAAACCGGGC
GTATTTAAGATTGCACTTTCATTTCTGCTGCTTAAAGCCAGGTAGTTCGGAAAAAAAAGA
TTGTCAAAATAGAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1078, 3493..3681, 3782..3896, 5350..5504, 9617..9751, 9852..9946, 10047..10116, 10761..10847, 15652..15747, 16806..16931, 18600..18779, 26411..26563, 29611..29833, 30065..30168, 32194..32251, 32253..32368, 34741..34811, 36302..36455, 36568..36741, 37503..37616, 37705..37845, 38227..38326, 40323..40510, 44270..44410, 45236..45339, 45440..45540, 64354..64451
1001..1078, 3493..3681, 3782..3896, 5350..5504, 9617..9751, 9852..9946, 10047..10116, 10761..10847, 15652..15747, 16806..16931, 18600..18779, 26411..26563, 29611..29833, 30065..30168, 32194..32251, 32253..32368, 34741..34811, 36302..36455, 36568..36741, 37503..37616, 37705..37845, 38227..38326, 40323..40510, 44270..44410, 45236..45339, 45440..45540, 64354..64451
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved