Oryctolagus_cuniculus Locus ENSOCUG00000004902
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ENSOCUG00000004902
Oryctolagus_cuniculus
ENSOCUG00000004902
GeneScaffold_6610
SNORA65
2462..2588
4191
CGGCTTCCTCACCTGCGGAGCGTGAGCGATAATGTCACCGACACCGGCTTCCCAGTGAG
TTCACACACCTGAGGCCCCCACACGGCCGCTACCTGCACACAGCGAAAGCTCCACGGCCA
CAAAGCGCCGCCCGTCCCGCACACACGGAGCCAGGGCCGAGGGCTAGGGGAGCAGACGCG
GCTGGGGAAGCGGCGGAGGCCAGAGGTCTCCGCCCACAGGGGTGCGGGCTGCCAGCCGCA
GGGGTGGCCCGCCCAGGCCCTCCGGTCAAACCCACCAGTCTGCCGGGACCGGGCAGGGTC
TGCCGCAGCCTGCCCACCCCGCTCCCCATCTCCTCCCAGCTCAGCCCCGACGCCGCTCCC
TCATCTGCTGGCGTCCAGCCCGGGGGCGAGGGCCACACCCATCCTCCCCTCGGCTGCGGT
CACCGGGCCGGGTGGGTGGACAGGCGGGTCACCCCCGGGCTTAGCAGTGGCTGCGGCTCC
TCCGGGGCAGGAGCTGGGACCGAAACCCAAAAGCTCCAAAAGTCCTGCAGAGCAGGAGTG
ACAAGTCCGGGACGCCGGGCTCGCACGAGCAAGAGTTGCACCTGGCTTAGGTCTGCTGAG
CGGACCCACACACCACGAAGGGGTTAGGAGGAGTCCCGGGTCCCGGGACGGGGGCGCGGA
CCGCCCAGGGGAGGGGCAGGTCTCTGGATTTCGGTGACAGGGACCCCGGGGTGACCCTCA
CGATACGAGGCACAGCAAACAGCGAGGCCCGGGATCTCGGGAGCAGCCTGTCGTCTCTGA
CTCCCCTCTGGCAAACTGCCCCGAACCCCGCTTCCGAATCCTTTACCCCGGCTCACCGCG
ATGCCCCCGGCTCTCCAGCAGTCAGCCGCAGGAGCCTGCCCACAAGAAACATGGCGGCAA
GGGCGTCGCCAGGCGGAGCCAGGATTTTTTAGGCGGAGCCAGGAGCTCTCGCGAGAGCCG
CATTTTCCTGCTTATATCCGGTGCGGTCGGCGGGACTTCCGGCCTTTCGGTATTCGGCTC
GGAGGAGGCCAAGGTGCAACTCTCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAG
GCGCCTCCACCATGCCACCCAAGTTCGATCCCAACGAGATCAAAGTCGGTGCGTGCTCTC
GCTGCGAGCGGGGCTGCGGGGTGCAGGCTGCCCGCGCCCCGCCGCGCTCCTTTCCCGTGC
GCGAAGCTGCGCGTCCCGGGCCTCGGCTTTCCCACGTGTAGATGGGGAGGGAGGAGCGGA
CGACCCTGGCGGCTTTGCAGCCCGCACGCCTTAGGGTAAGGCTTGTCTTCGGGGGTCTCT
GCGCCCCTCGTGTGGGTTCCGGGCGGCCTCCGGGCGCCCGAGCGAGCGAGGAGCGTGTGT
CCGGCCTTGATCCCCGGGAGCTCCTGGTGCTGTGTCGGGAAGAGGCGACGGCCGGGTGGG
CAGCCCGGAGAGACGCGGCCCCTCCGCTGAGACCCCGGCTTTCCTCCCCTCCCCCCAGTA
TACCTGCGGTGCACCGGCGGCGAGGTCGGCGCCACGTCTGCCCTGGCCCCCAAGATCGGC
CCCCTGGGCCTGGTGAGTACTTGGTGCGCGGCCGGAGCCGAGCGGCGGACCCGCAGTGGG
CAGCGCGTGGCGGGCTCGCGGGGGCCGTGGCCGGCTCCACTCTGTACCGCGTTCATGCCG
TGGGGCACCCGAGCGTCGCTCCTGCCACTAGGGGCCATCTTGCCGTGGCCAGCTGGGGCC
CAGCCTCCGCAAACGGGTTCGGGCTGCGCGCGTGCCGCCTCGGTGCAGGGGCCCTTCGAG
GCGTGGCCGCACCGGAGCCTGGTGCTACCTGGGGTATGGGGCGCAGGTGCAGCTGCCCTG
GCGCTGGCGGAGGGAGGTGGCGGTACTGCGCAGGTTTGGGGGCTGCGGCCCAGCTCGGGC
ACAGGCTGATAACCCGCCCGTATCTCTACAGTCTCCCAAAAAGGTTGGCGATGACATTGC
CAAGGCCACCGGCGACTGGAAGGGGCTGCGGATCACAGTGAAACTGACCATCCAGAACCG
GCAGGCCCAGGTATTTCCGGCTGTGTTGCCGGCCCCCAGGCTGGGCTGGGCATGCTCTGG
GAGCCCACGTGGGTGGCCGCGTAGCCACGCTCACCGGCGTGGGGTCCAGTGGGGTCGGGC
TCTTTCACACAAGACTCTGTCCTGCAGATCGAGGTGGTGCCTTCGGCCTCGGCCCTCATC
ATCAAAGCCCTCAAGGAACCGCCCCGGGACCGGAAGAAGCAGAAGAACAGTGAGTGCCTT
GTGTAGGGGTCTGTGACCAGCGGCGGCTCTGGGTGTCCCCTGTGTGACAGTGTGGGAGGT
GACGGGTTAGCTAGTGTGGGGCAGGTCCTGCTTCCCGTGCGTGCGGGGGGTGGAGGGTGA
GTCCTGGACGCCTAACTGGCCCCAGCCCGGCTTCCGGCGGAGGCTCGGTTGTGTCCCAGC
CACCCGCCACTGCGCCTGCCCATGCTGCTGGCTGGCGCAATCCAGTGGTGAGCTGAGAGG
AAGCCCCGGCTTAGGAAACAGGGTTGTCCTCCACGTGGATGACTCTGTGCCGAAAGCACG
GGAACAGCCTGCCACGGCTGGCGGGGCCTCGTGAGGCTTCACAGGCGGCCGCCTCTGACC
GAGCTTCCCCTGGTCCTTCCTGCAGTCAAACACAGCGGCAACATCACCTTCGACGAGATT
GTCAACATTGCCCGGCAGATGCGCCACCGGTCCCTAGCCAGAGAACTCTCCGGTAAGCGC
AGGGCGTGGAGCCGGCTCCCGGGTCCGCCCCGGGGTGATCCAGGACTTGGGGCGTGTTCT
GCAGAAACGCGTGGTGCTGAGTGGGGTATTTAACCTGGGCGCAGGGGGAGTGTGGAGACC
TTGTGTAAGGCCTTTGTAACCAGGTGGGATTCCAGACTCCAAGGGGAGTGGGGAGTCCTG
AGAGAGGACCAAGCCTTCCCTGAAGCCACTGCTCTCTCAGGGACCATTAAGGAGATCCTG
GGGACCGCCCAGTCTGTGGGCTGCAACGTGGACGGCCGCCACCCTCACGACATCATCGAC
GACATCAACAGTGGTGCCGTGGAGTGCCCGGCTGTAAGTGCCTGCGGGTGACACGGGGTG
GGGGGATGGCCAGTGGTCACTCCGTGTAAAAGTGGGGTGGGGTACAGCTGATGTATTGCC
AGGCTGGAGTGGCCGGTGGTCACTGAGACCCGCTTTCTTCTTCACAGAGCTAAGAAGCAG
AGAGGAAACTTGGAATAAAGGATCATCTGACAAGGGGCTTTCTGCTGTGGCGTCTTCTTG
GGGGAACTGGCTCCCTTACTGGGCGGGAGCGGGCCAAGTGCAGAACCTAATTAGCAACTC
CTGTGGGTAGCAGGACAGCTCATGCCCTCAAAGAAAGCCTTGACTCAGTGTGGATGTCTC
CACCCACCTCCGATTGATGGGTGGCTGGGGCCCAGGACCCACCACTGCTGTGCAGCCAAG
CTTCAGAGCCGTGCCTAGCCGACTTCTGCTGCCTGCCCCAGCTCTGCTTTTCCCGCACTG
TGTGAAAGGGGCTCCTGGTCCTAAGTGGGACTGGAGACGATTTCCCCTAAGAATTTGTTC
CCCACGCTGATCCCTAATCTGCTCCTGTCAGTCTGAAGTTACCCCTGGATGGAGGTACTG
AGCTCCAGCAGCAGGTGGAGGTGCGGCAATGTGGAAGGCACATGGTTGAGGGCCCAGCTG
GCTTAGAGTAGGCCAGCGATGGGGGCTGTGGTCCAGGCCTGGCTGCCCAGGAGCCAGGAA
GGAGAACACACATCTGTAGGGGCTCAGGCAGGCTGAGGCTGTGCAGTTGGGTGCCAGGAT
GGGTGGCACGGTGGGGGAGGGGGGCATGGAACCTGAAAGGGGATGAAGGCTTGTGTTAGA
AGAGGGAGAAACAGGTTGGAGACTGGTGTGGTTGAAGCACACACAATGCCTGGCCTAGGC
CTTCACATTGGTTAGGTCACTGCCACAGAGGTCTGTGTAAATCTGAGAATCCAGACTGGC
TTGGACGCTGCTAAGACCCCTGCTCTCTGGCTCTTACTGAGGGGTGTGCCCACAGTGTGG
CGCAGCAGGTAAAGCTGCCACCAGCATCACACAGGCACTGGCCGTGTCCTGGCTGCTCCA
GTTCCAATCCAGCTCTCCTGCTAATGCACCTGGGAAAGCAGTGCAAGGTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1498..1571, 1951..2049, 2187..2268, 2665..2751, 2980..3101, 3103..3147, 3149..3171, 3173..3191
1001..1127, 1498..1571, 1951..2049, 2187..2268, 2665..2751, 2980..3101, 3103..3147, 3149..3171, 3173..3191
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved