Oryctolagus_cuniculus Locus ATP5B
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus ATP5B
Oryctolagus_cuniculus
ATP5B
GeneScaffold_610
SNORD59, SNORD59
1845..1920, 2767..2842
6168
TTAACAGGAATGGTCTAAAAACAAAATTTACTTATTTGATTGGCAGAGTATGAAAGTGA
GACACAGACAGATCTTCCACCTGCTGGCTCACTCTCCAAATGGCCGAAAGATAGGGCTGG
GTTGGGGGTGGGAGCCAGGAGCCACAAACTGGTCCATCCGGGTCTCCTGGGTCTCCTACC
CGGGTGGCAGGGCCTCAAGTACTTTCCCAGGTGCAACACTAGAAGCTGGATGGGAAGCAG
TGTGTGTGACCGTACTGCTCTGGGATGCGGGGATTCTAAACTGCGGGCACAACGCCTACC
CCGGAAAGGAAACGTGATGGGGGACAAAAATGGGTAAAATTTTTTTAAACAGGAAAAACG
AAAGGCCCCGAATCTCCCTCTTTTTGTCTCCTCAATGTCTAGCATACATATGTTCAATGA
CTGGTTGCATTCGTTTCCTTTTCGTACAGATTTAAGCACTGATGATCCTTCCGGGTTTCT
GACCTGCTGAGCCGCCCGGGAGCTTCCAATCTCAGTACTGCGAAACAAAACCCGTGTTTT
TGACTCTAGAGAAAGCGCCTTATTTCGTCACCGTCACAGTGAGGACAGCTTCCCGACGAT
CCTAATTCCCTAACCCCCACCCTGTCACCTAGCTCAAGGTCTCGCTAAGGAGACAGCCCA
AGGACAGGCAAAGGCAGCCCACGTGCTTCCCAACAGGAACTCGGCCCCTTTCCTAAACGT
AGTTCCGCCCAGTACCCTCTCTGACTGACATTCCGGTGGCCCAATTAGGTTTCCAGGCTT
GGAAGGCGGCAGCTCCAATAAAAAAGGGAGTTTCAGATTAGCACCACAGTTGACCAATGA
TTGAGAAGATCAGAGCCTATTAACCTATAGGAGCACGGCTAAAAATGATAGGCAGAAGAG
TTAGCCAATGGACATACCTACAGCAGACTAGACTTCGCCCCAACTGCTGGATTGCCGGTG
GAGGGGCAGCTGCGGCACTCAGTCTCCACCCGGGCTCCGCCATGTTGAGTCTTGTAGGTC
GTGTGGCCTCGGCGTCGGCCTCCGGGGCCTTGCGGGGACTCACCCCTTCAGCGTCCTTAC
CCCAAGCTCAGCTCTTATTCCGGGCCGCCCCGGCAGCGGTCCAGCCTGGTGAGTGCTTTC
CTATAGATGAGTTCATTTCTGCCGCCCCAGTGACCTTGAGGCGCGGCGGATTGAAGTTCG
GGCCTAAAATCCGTGGTGCAAGAACGCCAGGGTGGTGTGCAGCCTTCTAATCGCAGAAGA
TCAAGAACGGTTCGCCCCTGCGAACCTTCTTCGACCTAGTTCTGTGTCATTTTGAAGAAA
GGGCTTTGTGTGACGGGAAGGTGTGGGCAGGTGCGTTGACCTTCCCCTGCAGCGGGGCTA
CCGAGCTCTTGCATAATTCGGTGCTGTGCGTGGAGGTGGGGAGATCGTGCAGGCGCTTTC
TCCGCGGCCCCTCGCTCTAGACACGCCTTCCGTACTAGCGGAAGGAGGCCCGGCCAGGAC
GGACGTTGCTTGTCCTTGTGGGTTAAATCGGAGCTTTCGAAGGCCTTTAACGTCCTGAAC
CCTTGCGATATGTTTCTGTCTGTTAGCTCGCGACTATGCCGCACAAACCTCGCCGGCGCC
GAAGGCAGGCCTTGCCACCGGGCGCATCGTGGCCGTCATTGGTGCCGTGGTGGACGTCCA
GTTTGATGAGGGCCTGCCACCTATCCTGAACGCCCTGGAAGTGCAAGGCAGGGAGACCCG
GTTGGTTTTGGAGGTGGCCCAGCATTTGGGTGAGTAGATTCTTTTTTTTTTTTAGTACCA
TAAGGACTTGATTTAACCAAAATAAATTAAAAAACCAACCTGTCTCCTTTCTATGATGAT
TTTATCAAAATGACTTTCGTTCTTCTGAGTCTGCTGAAGCCATGTTTCGATACTGAGAAG
GAGTCTTGGTTGAGGTCTTTCATGCCAGCTACACTTGATTAAAATGTTAGGAGCTCAGCT
TGTTCTTGTGTGTAACTGTGCAATGTCTTTTCCTGACAGGTGAGAGCACAGTACGAACCA
TTGCTATGGATGGCACAGAGGGCTTGGTTAGAGGCCAGAAAGTCCTGGATTCTGGTGCGC
CTATCAAAATTCCTGTTGGTCCTGAGACTTTGGGCAGAATCATGAATGTCATTGGAGAAC
CTATTGACGAGCGAGGTCCCATCAAAACCAAACAGTAAGACTCTCTTGCCGTAGCTTGCA
GTTTTCCATGTTAAAATGTCGCCATCCAGTAAAACAGACCATTCCTGTAGGGGATCCTTA
AAAGTGCTGCTATTTTCCATTACTGAAATCACACTGCGGTTTTCCTGAAGCAGTTAAGGG
TGCAGGGTGCAGAAGTTCTGATGGATAAAGATCTGCTGTTTAAGACACTAGATGATTATT
AAAAGGTCAGGTTTACGGCTTAGGTTGTGGAGTCTCCAACACGTGGAACTCTGTATTTCC
TGTTGGTATGCTAGTAAGGAAGTCTGCTTTATCGTAGAAAGTTGGGGTGGGCGCTGGTGA
CGGCTTTCACTAAGGTGAATGGACACTGGTCCTCCTCGCTCCTTCTCTGCAGATTTGCTG
CTATTCACGCAGAGGCTCCCGAGTTCATAGAGATGAGTGTGGAGCAGGAAATTCTGGTGA
CTGGCATCAAGGTTGTGGACCTGCTGGCTCCGTACGCCAAGGGTGGCAAGATCGGTATGT
TGGTGGGCAGGTGTTTTCCAAACCTAATATGGAAGGGGAAAAACAAAATAGGTACTGAGT
GCTCTCTCCTTCACTGATGAGTAGCTTCTGACTTTCGTTCTTCTGAGTTTGTCGAGTGAA
GCCAGATGCTGTTCCTGAGATGGAAAATGCAAAAGTTTATTTGAAGTTTGGTATAACCGG
ACAGAACTCTTAGATAATCCTTCTTTTCAACCTCTTGTAGGGCTCTTCGGTGGTGCTGGA
GTTGGCAAGACAGTACTGATCATGGAGTTGATCAACAACGTTGCCAAAGCCCATGGTGGT
TACTCTGTGTTTGCTGGTGTTGGTGAGAGAACCCGTGAGGGCAATGACTTATATCATGAA
ATGATTGAGTCTGGTGTTATCAACCTGAAGGATGCTACCTCCAAGGTGAGCATTGAGCTG
ACTGATGGCCTTGTCAGAAACTTGCCAGCTGAACCTAGGTTTTTAGTATCCTGGGCCTAC
AGAGGAAATTCCTGCCTTTTTTTTTTTTTTTTTTTAACACCCAGCTTCCTAAGACACTTA
GTCGTTTTCTCTTTGACATTAAATTGCATTTTTAGATTTTTTTTTTGTTGGTATACTCAT
AGTCCCATCATTTGGGAAGGTAAATTTTTTTTGGAGGGGGAGAGGTGAAGTTGGAGGTGG
ATCCTGTGCCTCAGATAACCCTATTTTGTACCTTACACTTAAACAGGTGTTTACTAATTT
CCTGCGTTGACCCCTTCTGGGAAGGAGGGTCTGTGCTACCTCTTATTTGGTGGTGTTGGG
CACGTGGCTTCCTCAGTCCTCTGCCAGGTTTTCTGATTATGTCTGATTACTGCAGGTAGC
GCTGGTGTACGGTCAGATGAATGAACCACCTGGTGCCCGTGCCCGGGTAGCTCTGACTGG
ACTGACTGTGGCCGAATACTTCCGAGACCAGGAAGGTCAAGATGTACTGCTGTTTATTGA
TAACATCTTCCGCTTCACCCAGGCTGGCTCAGAGGTAAGGGGAAGCCATGAAGCACATCG
TTCATGTGATGTTTCCGTTGTGCAATGAGGCTAACGGTGGAGGCATTGAACACCTCTTCT
TACTCTCCTTCAGGTGTCTGCCTTACTGGGCAGAATCCCTTCTGCTGTGGGCTATCAGCC
TACCCTGGCCACTGACATGGGTACCATGCAGGAACGCATCACCACCACCAAGAAGGGATC
CATCACTTCCGTACAGGTAAGGAAAATGAAATTGATGCATAAAGGCACTCAGAGTGGGCT
TTTAACTGGGGGGAGGGAAGCGGTTCAGGAGTTCCCTGGAGTAGTGTGTAATATACTCTG
TGTGCATGTTAACGTCCCTAAAAGATTAAGAAATAATGGTGTTAATATACTATAAACTAT
CTAAACATTATGTGGCCAGATTCTAAACTTTCGTGATTCGTTGAACTGTTGTAGTACAAG
GAGAATTTTGGCTATTTTTTAATTCAAAGTGAGTATCATTAAAGTTAAAATACAGAATGA
AGAACAATATAACACAATTCTTTCATCATGGCCTATAAGCTCAGCAGATACAGCGATTGT
AAGAAAGCCCCCTGTTCTTAGCATTCAAAAGTTTGCCTCAAAAAGAGTGAGGTGGTGATG
AGAGGTCAGAAAAGGGGGTGGCTTCGGTGCAGTGACTTTGGTTACTGCTGTTTATGGGTT
CTTGGCTCCCTGTAGGCTATCTACGTGCCTGCTGATGACTTGACCGACCCTGCCCCTGCC
ACTACCTTCGCCCACTTGGATGCCACCACTGTGCTGTCCCGTGCTATTGCTGAGCTGGGC
ATCTATCCAGCTGTGGATCCTTTAGACTCCACCTCTCGCATCATGGATCCCAATATCGTG
GGCAGTGAGCATTACGACGTTGCCCGTGGAGTGCAAAAGATCCTGCAGGTGAGTGTGTTG
CCGTGAGGGATCAGTGGCCATAAGATCCCTTAGGGTATTTGGGGAGTCTGTTAGGACTAC
ATCTGTCCTAGTAACTTGTGATAGACTTTGGAATTGGGAAAGTTGCGACGAGCATTGGAA
TTGTTAGTGCTAATGAAGATTTGGGTTTCCAGGTACTTAGGCTGAGCTTTGGAATTCACT
TTTTTTCCTAACAGCACCAGATTAGCAGTTGGGAGAACTAAACACGGAGGCCAAGGGCCC
TTGTGACCTGCGAGTGTGTAACTTCCCCTTTGTTTGCCTTTTCGATTTTTTGTCAGAATT
AAAGGAGTATGAATACTTAGACCTTGTTTTCATCCTGTTTTCTCACAGGACTACAAATCC
CTCCAGGACATCATTGCCATCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACT
GTGTCCCGTGCACGGAAAATACAGCGTTTCCTGTCCCAGCCATTCCAGGTTGCTGAGGTC
TTCACAGGTCATATGGGGAAGCTGGTCCCCTTGAAGGAGACCATTAAAGGATTCCAGCAG
ATTCTGGCAGGTGAGCTTTTTGACTAGTACAAACCGAACATAAAATGATAGGAAAACTAA
AATCTTTTAAGTTACTGTTCCTATTCCAATAGCCATCAATGTGTGATGTGTTCACCTTTC
TTTTAATTACAAAAATAAGCTATTTCTCATAAATTTTGTTTGGAAATACTCTACACTGAC
TTGAGAGTCTGAATGCCTCTCCGAGTCGCTGGCTCCCTTTCGTGCAAATCCAGCACTTGC
TGTGTTCAGTGCAAGCTCCCCTCTGCTGTGAGGGGCGCAGCCTCTTCAGGAAGGCCTCAT
CCTGCTTAATTAACTGCTGGGATGCAGGCAGGAGAATCTGAACTCAGGGTGCTGTAATCC
ACCCTGCATCATGTTTTCTTGTCCATTTGAGGGTGAGAGAAGTTTGAAAATACAGGTTTC
TTAGATTATATGAATGCATCACATTCCGACCCATGCTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCCCGTGCTGTCCCTCTCCTTCCCTCTCCAAAACGTTTCAGTTTTCT
GTGTAGCCCATGTAGAGCCTTGGTGGAAAACATTATGTTCTGTTTGAAGAATATTTAAGG
TTTGCAATAAAATGTAACCCCTCAGAATCTGTCTGATTTTATTGGTTCTACCAACACTTA
TTTATTTATTTGTAAGAAGAAGAGGCAGAGAGTGAGGTCTTCCATCTACTGGTTCATTCC
CCAGTTGGCTGCAATGGCTGGAGCTGCACCAATCTGAAGCCAGGAGCCAGGAACTTTTGG
GTCTCCCACATGGGTGCAGGAGCCCAAGGACTTGAGCCATCTTCCACTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1127, 1586..1768, 2019..2193, 2572..2693, 2920..3104, 3535..3693, 3793..3915, 4395..4607, 4968..5168
1001..1127, 1586..1768, 2019..2193, 2572..2693, 2920..3104, 3535..3693, 3793..3915, 4395..4607, 4968..5168
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved