Oryctolagus_cuniculus Locus KIAA1731
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus KIAA1731
Oryctolagus_cuniculus
KIAA1731
GeneScaffold_4988
SNORA5, snoU2_19, snoU2-30
12464..12594, 36321..36401, 36599..36668
36795
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGGAGGTATGAGAAAT
AATGGGCCTCTACGTAGGGCGGCGTACGTGCTGGTGCGCATGCGCGGGCAGCCGGGCTCA
AGCGCCGCTCGGCCTTCCCGGCGGCCTCCGGGGGAGGCGGGGCCAGGCAGCTTCCCGCGG
TTTAGTCCCGCCATTGGCGGGCGGTTTGAATGACGGAAGTGACGAGAGCTCTGCGATGGC
TTCCCCGCAGGCGCACAAACGGCTGGTGGGAAGCTGATCCGTGGGGGCCGCTGGGGCCGG
CTTGGCTGCTAGAGCTCCGGACTCTGCGCTGCGTGCCGTCAGGTGAGTGACGGGTGCACG
GTCTTCCTGGCCACCCTGGGCGTGCACAACCCCCTGAGGCGGAGTTGCTGGGCTGGTGGT
CCTGAGGCATTGCGTCTCCCGGGGCGCCGCGTCGCGAACGCTGATCGGCCCGCGGTTCTC
AGGGCCCCGCAGGCCGCGGGGCGCTGGCGGCTGTTAGGGGCTCCCGGCAGCAGTGTCTGG
CCCACCCCCTCCATCTCCATGCGAGAGCCTGAGGCTGCCCCGGGACATCTTGCGCGCCCT
GCCGCCCTCGGGTCGAGGGGGCTTCCCCTGCAGCCTTCTCGGTCCCTGAGCTTCCAAGCT
GGGGACGGTCGGGAAGGGCCTCCGGTGCTATTGCTGCGGCAGCTGCAGGTGTTTCCCCCG
GGCACCCGCGGCCGTGGCCTGCAACCTGGTAGCCATTTAAGAGCATTGGCTGGCATCTTT
TCATGCAAAGAGCGCCCTCTATTTTGGTGTCTGTCACTTTTAATGCCTCAGGTATTGAAT
TCTGTCACAAACTCGGATTTAAAACGTTTGAAGTCTGTAATACTTACAGAATAGGTGGCA
GTGTCACTTTTCAGTTGCATGATCATCAGGACAGGTGCTGGGGTCAATGTTATTCCGTCA
TTTACACAGTGTAAGAGAAACTGAGTGACTTGACTGGTGTCTTCCTGCTAATAAATGACA
TTGTCGGATTTTGAACCCCAAACTTGTGAGTTTAGTATTAGTTTTGTGATCGTCACCATT
TAATCGGCAGGACCAATACTGTCTTACAAGGTAAGTACTATCGTCCCTATTTTGGATAGT
AAAAATGTACAATTTAGGAATCTGTACTAGTAGGAATAAATAAATAGGGCAGGAGGGAGG
ATTTCCTTAGGTAGGATTGCAGTTGTTAAGTGTAGAAGGAATAATGGAAGTAGAAAATGA
TACATGATAAACACCACTGTAATTGGTTGACAGCCATCAAAGGATATTGCACTTGGTAGG
CAAAATATGAGAAACCTAATGTTTATGTAGTCTCTACTGTCTCTCTGTCAGAAATGTATA
GCTTATAAGAGACAATAGTAACTACAGTGGAGAAACCTGGTTAGACACCATCTTGACCAG
GTGGTCCCAAGCTCCATCCCATCGTCACTGAGAAGCGTATGTCATCGCTTCTGTTGTGTG
CTTGCTCTCAATGTGAACCCCAAGTCTAATCACAAGAAAACAATTTAGACAAATCCAAAC
TGAGGGATGTGGAACAAAACCAGCGGCCTTTTCAGAAATGTCAGGGTCTTGAAAAGAAAG
ACAAACCGAGGAACCCGCCTGGATTAGAAGAGACACCACAAGTGTGGCAGCCAGCAGAGT
GTAATTCACAGATCTTCTCTTGGAGGCTGTGACTGAGTGGTGGGAATACAAGGTGGGCCT
GTGCTGGAGAAACCCACTGAAGGACTTGCTGAACCTTTCTTAGATTTTGTGCCTTAAGAG
GCATCCGCCCACTCTTCCCTCCCAGCGTCAAGTTTGCACTGAAACCTGAACCTCCACCTT
TTACCAACTGCCTTCCCATCTCCCCTCGCAGGCCTTTTCCTTAATAAACTGTGGGTTTAA
CTCCACCTTGGCATCTACTTCTTGGAGAGCCAAGTTTCAGTGTATTGTCCTTGGATGGGG
ACCGGGGCCACATAATAGACATTAGTGGCCCAACTGATGTGAAATTTGAATAAGGTCTGT
AGATTTAGTTGAATTTTGTGCCAATGTTCATTTCCTGGTTTGATCCCTGTACTGTGGTTA
CATAAGATGTTTACATTTGGAGAAGCCGGGGAAAGCTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCTTCATGGAAGGAGTGAGGCTTCAGCTAGCTTCAGAAAGATGTAAGTATCCAGTAACA
CAGTTTACCTGGTCATTGTGAGGTGGCTGAGAAATGTTGACTTGTCCCTGATAAAATTAC
GCTTGTATGTATATGTACGTATGTTAAGTGCATAAATTTTGGAAGTGGCAGTAATGAGGA
AAAACTGACAGTGGAATTACTTGGATGGTTTTCAAGTTGTAGAAACTGTAGAGTCTTACA
TTTTTTTCCATTTCTGCTCACCCCTTCACCCTCCCACCCCCAAAAGGGGGGCATGTCATA
ATTGAGGGAGGAGAGTGAGAAGAACTGAGTGTAAATAGTAGCAGTAGAATAGATCTGGGA
CTTTAAACCCTTGGTACCTTCAAGCAGTTATTTGAAAGGAATGTTCAAGATGGTCATTTG
TTTAAAAATCATGCCATCATAATTACTAAAGGACCATCTACTGTAGAGTGTAGCACACGG
GATTGATTTAGCGATTCCATGAGATACCAGTGATACTTGATCAAGTTAGATAAAGCACAC
TGGGAGTAGAACTAGGGACTGGGAGCCCCTGACTGTATAGCATACTTGCTGGTTATGAAC
AAGTTATTGAACTCTAAAGTGTTAAACGGTTGTTGTGAAAGCATTTATGCTATGCTAACA
CACTTTTTTGAAACCATGTGTTTTTGTTTGTATGTGGGTTTTTTTGTTGTTGTTGTTTTT
AATATGTGCTAGGTAAACTCTGGAAATGCTATCAGGAATAAGTCAGGTCTGAGATACTGT
AGGAAAACAGTAACCTGCTATAGATAGGGAAGAACTTTTCCAAATAATTCTGATCTATTT
TGTATTTCCTTTTTCCCACCCATCTGAAAAGTACTATTCTAAGTACTGGATTTATAGATA
ATTTTGCTTTTTTTTAAATTCAGATTATTTATATTTAAAATACACAGAAATGAAAAGAAA
GGTAGCAAATGCTGCCAAGCTGAGATTGAGTCCTAATGAGGAAGCCCTCATCTTGAAGGA
AGATTATGAAAGACGACGAAAACTAAGATTGCTACAGGTATGGTTTATTTTGGATTAACA
TTTAAAATTTTTTGCCTCCCCCAAATTATTATTTTTTACATTAAAATATTCTAAAATGTT
GCATTTAAAAGCCTTTTCTGAATGTACAAGAGCCCTGCCTCTTTTGTATTGATTACTTTT
GGAATATTTAATAAGTGGGCTGAGGTAGTAAGTAGATTAGAGAAGAGTTGGAGAATTAGT
ATTTGACTCAAATATTGGAAAATAGTTATTTAAATATTCATTTTTAAATGATCTATAATT
GATGAGTATTAGAACAGGCATCTAGGCCAGCGCTGCGGCTCCCTTGGCTAATCCTCCATC
TGTGGCACCGGCACCCCGGGTTCTAGTCCTGGTCGGGGCGCCGGATTCTGTCCTGGTGGC
TCCTCTTCCAGTCCAGCTCTCTGCTGTGGCCCGGGAAGGCAGTGGAGGATGGCCCAAGTG
CTTGGGCCCTGTACCTGCATGGGAGACCAGGAAGAAACACCTGGCTTCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTGAAGTAAAAG
CATATTCTTGCTATCAAGGAGCTTTGCAAATAAGTGACTCACTTTTTATGTAGTTTTATC
AATTCTGTCATGCTTATTGTTCGGTTGGTGTTAATTCTTCAAACATAACATAAAAAGGAT
TTTTCTCATTAAAAGTCTGTTTTTTTCTGAATTTGACTACTGCATTTGGATATTTTAAAC
ATCCACCTTAGGAACAAATCTTTAAGTATTTCTCTGGGAATTAAATCCTTGTCTTAAGAA
AGCTTGAAGTTTGAACTAAATTATACCTTCTCCCTTCAGTTTTTGGCTTTTGAAAACTGG
GAGTAAATTATAATTAAAATAACAGTATCAGAATTATTATTAGTAATTCTCCTCATCTAA
AGCTTATACCTGCAAAATGGAAAAAAAAAAAAAAAAAAAAAAAACATGAAAAGCAGTTGA
ACACATTATTCCGCAAGTGAGAGTGTTTAGAAAGTAGGCTCCACAGTCAGTGTGCTTGAA
CTTTCCTCACTTCTTCACTGCTTAGTTGTTTGATCTCAGCACATTAACCTCTCCAAACTG
TTTCATCATCTGTTTCATGAGGATTAAATGAGTGTATTAAAGCCCTTAGGAATATGCCCT
CAGGGCTGGCCTTGTTGCATAACAAGTTAAGCCTCCGTTTGTGACCTTGGCATCCCATTG
TTGGATTAGTGCTAATTCTTTAAACATTATATTCTCTGTACGAATGATCATCAAAAACCA
TGCTGTCTTATTGTAATAGAGTTTCATATTCCGTCTCTGAACCCTTTGGCTGCACATCCT
ATTGGGGCGTTGAACCTAACGTCATGCTGAGGAATATACTACCTAGTGTTGGCGCTACGT
GCCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TGCGTACTTCATGAATAGTGATAAGTAGCACAAGCTTCAGTGTCATAAACTTTGTTATTT
CCAACACTTTGAACTTTTTCTCTTGGCTTTTGCACACGCACTTAAAACTCAGTGTCTGCT
AATAGATTCATCATCGTCTCTTGCTTATGGAAGTCTTTATTCTTGTCTTCTGTATCTTAG
TGAATTGTACTATCATCAGGGGTTCCCCAAGCCAGATACTTCTCTTTTACATCTCCTTGA
AGACCAAGTCTTGATAATTGAATTCACCTCTTTTCCTACCATATTTCCTAAGGTATTGCC
TTAGTTAAAAACCATGTAGGGAGGCCAGCGCTGTGGTGTAGTGGGTAAAGCTGCTGCCTG
CAGTGCTGGCATCCCATATGAGCACCAGTTCGAGACCTGGCTGCTTCACTTCCCATCCAG
CTCTCTGCTATGGCCTGAGAAACCAGTAGAAGATGGCCCAAGTCCTTGGGCCCCTGCACC
CGTGTGGGAGAACTCAAGGAAGCTCTTGGCTCCTGGCTTCAGATCGGCACAGCTCGGGCC
GTTGTAGCCAACTGGGGAGTGAACAAGCGGATTGAAGATTTCTCTCTCTCTCTGCCTCTC
CTCTCTCTGTCTAACTCTGACTTTCAAATAAATAAATACATCTTTAAAAAAAAAAAAAAA
ACCTTATAAGCTGAGGCCCGGCACTGTGGTATAGCTGGTAAAGCCACCACCTGCAGAGCA
GCGTCCCATGTGGGCACCAGTTCATGTTCTGGCTGCTCCACTTCCAGTCCAGCGCCCTGC
TAATGGTGTAGGAAATCAGTGGGAGATGACTCAAGGGCTTGAGCCCCTGCACCCATGTGG
GAGACCTGGAAGAAGCTCCTGGCTCCTGACTTAGGATCAGCCCAGCTCCAGTCATTATGG
CCATTTGGGGAGTGAACCAGCAGATGGAAGACTTTGCTATCTTTCTCTCTGTTTGTAACT
GCCTTTCAAATAAATAATCTTTAAAGAAAAAAAGTGTGTAGGCTTTCTTATCATCTTGCC
TTGGATGTAGCCCTTTACCATTGCAACTTTGTGTTGGGTCTCCCCTTAGACTCCTCAGGT
GTGCAGTCTGACCTTTATCCTTTTCACCTATGCCCTGATTGTTATCCAAACTGAAGTAAA
GGTTACTGTATTTTAGCTGTGGTGTAAACTTGAAGGAATATGGTTTCAAGGTTCACTTGC
CTTCCTTCCAGGTCCCACTTAAACTTCAGATCTGATTTCTGCAGAATCTTGTTTTCTTGC
TAGATCAGTGGTGTCCTTAAAATCCAGCCTTTTTATTTACTTTCATTTGGAATATCTTTC
TGATCTCTAGTTTGTTGGATTGAAAGTCGCTCGGTCCGAAGCACCTAACTTTTTAGTTCT
TGATGATCCCATTTAGCATTGCTGGCATGGTGTTTCCAGGTCTTTGAGTTGTTCAAAAAT
AGCTAGATATCCTATTATTTATTAAATCATCATTTTTAAATATTTATAATTAATTAATTT
ATTAAAATGACTGGGACTCACAATGATTGAAAAAAGCTCTCAGATGCAGCCGTGTCAAAT
TCGGCACCTGCCTGCCCATGGCAGGGGCTGGCCCAGAAGGCTGCCACAGAAACATTGTGA
CTCATGGGCCCTGCCCCGCACTCGGGCTCAGGGATAAATTTGGTCACAGACACAGAGAAA
AAAAAAAAAAAAGAAGAAGCAGCTGGCAGAAAAGAATACCTAACTGTGATTCCATGTTTA
CATGAAATTAAACAAAAATGAAAAAATGAGCAAAAATCTGTGGTCCTGACTTTAGCATTA
ATTATTATCTTTAGGAGTATGTTGACAAGAAAGAGGCGTGAAGGAGCTTTCTAGATGCTG
TCAATGTTCCATATACTGATTTGGATGTTGTTACATATACATCTGTGAAATTATTGGGTC
TGTTAGAATGTGGCTCGGACAGAACTACAGTCTGCCAATTTTTTGTTTAAAATTTATTTA
CGTATTTGGAAGGCAGAGTTAGAGGGCGAAACAGAGAAAGAAATCTTCCATCTGCTGGTT
TATTTCCCAAGTGGCCTCAGCAGCCAGGGCTGGGCCATGCTAAAACCAGAACTGGAATTC
CATCTAGGTCTTCCATGTGGGTGCAGGGCACGANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTATAAAAATTTTTGCTGATCAAAATACATAATGTTA
GATCTTTAAATTGTACAGTGTGAATATGGAGGAAAATGCCTTTGTTTTTACTTAGTGGTT
ATAACAATACTGGGGAATAAAGATAAAAACAAACTTACCTAGTTTAGAAAGAGTGCTGAA
ATGAGATTTTTTCCTCTTTATTTTCTTTTAGTTCCCTGGACAAATGGAAGACCAAACAGG
GTCTCATCAAAAAATTCTTTTTAAAAAAATTAATAAATAAGATCCCGACGCCAAAAATCT
CTCTGGACAATTAAGTCCTTGTCTGAGGATGAAAAGTGAAATGATCACAAACTGTCAATG
AAATGAAGAGTAAAAGCGTCGACTTCTGAATCAGGAACTGGGCAGGAACAAGGTAGCTGT
CCCCAGTCATCTTGGATTGTAGCACCTAAACTCACTGTAAATTATTCAGAAACGTACCCA
TACCTGAAAAATCAAAGAGTGGAGGTCAAAAGGAAGAAAACATCATCTTGCTACTGAAAG
GCAACAAACAAATTATAAAAACCTCAGTGAATTTTCTTCTGGACTGCTTTCACTGTAGAA
TTATTGCCATATATAAAAATTCCAGTATAACTGGTGAACCAGAATTAAGCAGTTCTCTAT
TGCTAAGTATATTTCCAGAAGTTACAAAGATCATAGCGCTTGCATCTCCTTGATTTATAC
ACAAATGAGAATTGTGAAGATTTAACTCCTTCTTGGTGTGTTTTGATATTTTTTTCTTAG
AATTTTATCTTTGGAATTCTCTTGAAAATGTGGTCGGATTTGTATGGAAATATTTTGATA
GAAGTAATTATTGTCTGTGTTTGGATTCTAGATGTTATCCTAAGTATGACAAGAAGCTTT
CTTGAAGTATTTCCTTCACATGGCCTCTTGACCTCTTGACAGCACCTTCTCAAATTTGTT
TTCCTACCTTATCTGTTCCTCTTCATGATTTCCTTTGCTGTTTATCAGCGTTTGCACAAC
CACTAACCATTGCCCTCAGAACTCATTCCGTAGAGCTTTGTATCAGAATTCTGCCCCTAG
TTCATCTAATGCCATAATTTTACATTATTGAGCATTTACTGATGTCTCCCAAGGAGGTCT
TTCTAGGCTTGGTCTTGGAACTCCATTCATATATTCAGCTATCTATTTCACTTCTTGTGT
ATTTAGTAACATATTGTCCAAAACTGAACTTTGATCTCTTCTCCCACCCAACACCTGCTT
TTCTTAACAGCTTCTCCAGGTTTTCATAACTGGCAGTATTCTAATTCCCTTGTGCCAGCC
AGAAAGTTTATGATCATTCTGGATTATTCCATCAAAACTAGCAGCAAATCTAGTTGGTCC
TACACTCAGAATTATCCAAGGCCTAGCCATTTTTCACCACCTACCCTCTTAATTTAAGTT
GCATTTGTTTTCTAGTTGAGTCTCATGGTGGTCTGCTATCTTCAGCTATTGTACTCTTAA
AGTGTATCCACAGAGGGGTCCTATTTAAAACATATGTCAGCTCATTCATTCCTCTGGGTG
GAGCCCTCCTATAACTACCTGTTTATCAATAAAAAAGTGTTCACAGTGTTACCTGACTTT
GTATGATCTGAGCACACGTATTCACCTGTCTCTAATTTCCTCTTCTACCACATTTCCCTC
ACTAACCACTGACCCGTGGATAATCAGCTTTATTGCTCTTCATTCAGAGCAAACATATGA
CTCCTGTGCTCTTTGTAATTGCTCATCTTTTTGCTTAGAATTTTCTTTTCTTGGATATTT
CAAGTATCTTTCTTAGGCCTTTTCTGACTACTCTGAAATGACAATCAGCGCCCCTGTCTG
CAGCCTCACTGCTACCCCCTTTATTCTCTTTTCTACACTGTTTTTCATCCATAGCTCTTA
TCAGCATGTGATGGGCAGTATATTTACTTTCTTACTGTCTTAACACCTATACTTCCCCAT
CCCCTTCCGTGACCTAGGAGTGTCTTGTTCATTGTTCTTTCCCCAGAGCCTAGTACTTTG
TATATAAAAGATGCTTAGTATTTACTGAATTAGTTAATTGTGTAGCTGATCAAGAAAGGT
AAATTGGGAAGTCAGACTATGTAATGCTTGAAGCTGTAGCCATGAAAAATTTTTTATGGG
ACATGCTTCAGTGAGAAGACAGTTTATGAAACGATCTGAAGGATTCTAGCTCTTAGAAGA
CAGCTAGAGAAGGGCAAACAGCAAAGGCATAAGAAAAAAATGGCCAGAGAAGTAGGAAAG
AATATGGTATTGGAATCTAAAAGTGGAGGACTCTTTCTTAGTAAATCCATAATGAAGTTC
TTTTGAAAACAGCCATCCTTGCCTGCTTCAATCTTCCCCTTGTCTGACTACATGCACGGG
ATGTGTGTCGATCTTTCAGTTCCTTGAATGAGCCAGATTTTATTTTTTACTCATTCATTT
TTTCTGGTCCTCAGAGAGCCTTTCATACCTGCTGATCTATTTGGAAAGATCTCTTGTACA
CTCCCCACATTCTTTCTAGGAAAGACTCTGGCCGAGTCTTACCTGTCAGGTATGTGCTTA
AATGTCATTTCTTAAGAAATCTCATCTGACCTGCTAGTCTCATACCATCTTTATTGTATG
ATTTGTATATAGCCCTTAATTTTTCTTATATAGAACTTAACACAGTTTATCTTTTTTTTT
AACTGGGGTAATTATATGATTTTTCTGTCATTCATACCTGCCCTGTAAAACCTCCCTGAG
GCCTTTTCTCATTCCACACAATATCCCTAACATCTAGCTCGTCAGTAGGTGCCAAATCAG
TAAGTTAATGAATGCAGAATTAAATCTTGGTTTTGAAATATATACAGAGATACATTGATT
TTTCTTTAAATTCTCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
GTTTGAACACTGGCAGCATATCTTATATCAATTCTTCACTTTTTCCTTTTTCATGGTTTT
AGTCTTCCATCTATTTTGTTCTGTCAGGCTTGGTTTTGATGGATAATATATTTGATCAAG
AAGGTGAATGGAACGTAAGAAAGATGTGACATTCAGGGGGACCAAGATTAAATTGTTAGT
CTGAATGTAGATTTTTGTTATTTTGCTCAATTTAAGCTTGACATTGATAATATGCTCATA
TTAACAATGGTGTCTATTACAGATGCTGAAGGTGACAGACTAACAATTGAGTCTGGGCCA
CTTACTAGTGAAGACACACTACCCTCAGGCCAGATAGACTCCAGAAAGGAACAAGGTATT
TTTCATCACCTACTAAAATTAAACTTACTTGATGCTTTACGTATTTTTCCTTATAATATT
ATTTGTACAAGTGAATGCAATAGCAATATAATGCTGTCAAAATTCTAAATAAGATTGATT
TTTGTTTTTGGAAATTCTTTTAGAAATAAATGAGACTCTGCCTGTCACAACTGTAGCTCA
GAGTGCAGTTCTCCTCCATCCTCAAGAGGAAGCAGCCAGAGTTAGAATATCTGCAAGGCA
GAAGCAGGTAATCAGATATTTAGTTTTTTGTTACCAGTGAAATTTGTCATACTGTCTGAT
TACTTTCAACATTATGTTTTCTCCTGTGTTATGCAAAGTTTCAGCTTATAAAATGCATTT
TTGTCTTTGTAAACTACTCATTTGATCTTTATTGAATCTGCTTTGTGTATTTTAATACTT
CTTTTAAAAATTTGATTTATCCTGGCCGGCGCCGCGGCTCACTAGGCTAATCCTCTGCCC
TGCGGTGCTGGCACACCGGGTTCTAGTCCCAATCGGGGCGCCGGATTCTGTCCCGGTTGC
CCCTCTTCCAGGCCAGCTCTCTGCTGTGGCCAGGGAGTGCCGTGGAGGATGGCCCAAGTC
CTTGGGCCCTGCACCCCATGGGAGACCTGGAGAAGTACCTGGCTCCCAGCTTCAGATCAG
CGCGGTGCGCCTTCCGCAGCGGCCATTGGAGGGTGAACCAACGGCAAAGGAAGACCTTTC
TCTCTGTCTCTCTCTCTCACTGTCCACCCTGCCTGTCAAAGAAAAAAAAATTTTTTTGAT
TTATCCTACATAGTTACAGGGCTTTGCATACTATTAAGTGCTCAATAAATATTTGTTGAA
TTAACAAGTCCTCATCATAATGTTAGACGCCAATGAATATGAAGGGTCTTCAAAATGTTC
ATGGAAATGCTTATGAAAAAGCTATATATCAAGAAGGATATATATATATAAACATTTTTT
TAATTTCTGTTTTCCCGTGAACTTTTTGCAGTCCTCTCACATTGATAGTGCAATTCTGGA
GGTGCTACAGAATTATAAACCATCTAAATTCAGTGAAACCTGTGAGTGAAGGAAAGAAAG
GAAGATGACAGGAACTCAGTGGTATTTTCCATTTTGAAAACAAGGCTGCTCTTTATGAAA
CTTCACATGCATTCCTTTTTCTACTTAGTAAATATTTATCTGTGTATGTGACTGTACCAG
CTGCTGGCTTTGGCATGCAGCTGGACATAGTCCTTGTCTTCATGAAGCTCAGATATGCGT
TCATGTTATATAGAATGTGCATTTGTATAATATAGAGTGTATTTGTCATTCCTCTGACAT
TTGACAGGAAAGGTACAACATGTTCATTGTATTATGCAGCTTCTAGATCTCTGCACTTTG
TAAGGAGTATGTTGCTTTGGGAGGCTTGGCACTTGATACTTTTTTCTTTCATATTCATAC
TGGGAACATTGTGTAAGTAAAGGTGGGAACATAGAACTTAGCATCATTTGCTGCTGCTTG
ATGAGGATTCCCTGTGCTTCCAGAAAACAGAAACAGTGCTTATATTTTCTTTTCCTCCTG
CCTCTTTGCACCTTTTGTCCTTTTTTCCTTTTCCTGTCTCACTCCTGTCCTATCTTTGGC
AGTAACATAGATAAAATGTCACCACCACTTCTGGGATCATTGGTACTCTAGAGATAAGAC
CTATTTGTTTTTAAAAGTATGATACATGTCAGTTTTCTTTTGTGTAAGTTTGTTAATAGA
TTGATAATATGTTTTGTTACCTAGATAATGGAAATAGAAGAGCAGAAGCAAAAGCAGCTG
GAATTACTTGAACAAATTGAACAACAGAAGTTAAGATTAGAAATTGACTGCTTCAGGGCT
CAGCTGGAAGAAGAAAAAGGAAAGAAAACACAACAGACTGAGGTAGGATGCAGAGGCTCT
CTTCCTTCCACAAGTTATTGGGACATAAGAAAAATGAGCAGTAATGGAATTCAGAAAGGT
AAAATGCCTTTCCAGTTGTTACTTGGCCATTTTTTTCTTTATTGTTATGTATATTTATAA
ACTAGTTTATATATATATGTATATGTAACATATATATATAAGGTAATGACTTTCATCTTT
CATGTTTTTTGTTTTTATTTATTTGAAAGAGTTACAGAGAGAGAGGTAGAGACAGAGAGG
TCTTCTGTCTGCTGGTTCACTCCCCAGATGGCACAACGGCCGGAGCTGCACTGATCCGAA
GCCAAGAGCCAGGAGCTTCTTCTGGGTCTCCCACGTGGGTGCAGAGGCCCAAGGACTTGG
GCCATCCTCCACTGCTTTCCCAGGCCATAGCAGAGAGCTGGATCAGAAGAGGAGCAGCTG
GGACTTGAACCAGCGCCCATATGGGATGCCGGTGCTCCAGGCCAGGGTTTTAACCTGCTG
TGCCACAGCGCTGGCCCCATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGATGGAAGATCTCTGTCCTTGTCTGTCTCTGTCTCTTCAATCACTGA
ATACCTTTCAAATAAATAAAAAGAAATAAAACTACATGAGGGGCCAGCCCTGTGGCATAG
CGGGTAAAGCTGCTGCCTATGGTGCTGGCATCTCATATGGGCACGGGTTCGAGTCCCAGC
TGCTCCACTTCTGATCCAGCTCCCTGCTAATGTACCTGGGAAAGCAGTGGAAGATGGCCC
AAGTCCTTGGGCCCCTTCACTCACCTGTGAGACCCGGAAGAAGCTCTAGGCTCCTGACTT
TGGATCAACCCAGCTCCAGCTATTGCAGCCATTTGGGGAGTGAACCAGTGGATGAAAGAC
TTCTCTCATTCTCTGAACTCTATCTTTCAAATACATAATAAATAAATCTTTTAAAAAAAA
CTACATGAAAGTTTACAGTTAAACAACTTTAGTTTATATAAATACTTTAATAATTGTTTC
TAAATTTGCCTTTTAATTACTTTGTCTTTTTTTAGGTTGGCGCTGCTACGGTATCGTGCA
CTGTACTTCCTGATGAAGACAGCCACAGGCAGATGATTCGCAATTATCAACATCAGCTTT
TACAACAAAATAGGTATTAGCTAGAGTGTAATTTATTTGTGACACTATGTGGCTACAGTT
TCAGAATTTATTGGAATTCTGCATAAAACTATGCCATATAGACTTCTCCAAAGACTGTCT
TGCTCCTTTTCCTTCATGATTATGACTAACTGCAGACTGCTGTTTGTTCAATTTAATGCA
TAGACACTTGAGAATGTGGAGCAAGTGTAAAAACAATACTTATTTATTTTTGTGTTTGTT
TGCTTTTGATAGGTTACACAAGCAGTCTATTGAAACAGCCCGGAAACGGTTACTCGAATA
TCAATCTATGTTAAAAAGAAGGTACCCATCCATGTCAGCTACATCATTAGTATCAGATTC
TGTTGTTTTGGTACCACCACAGAAACCCGAAAGACTCACTGCTGTATCAGAACATAGGGA
TCAAAGTCAGAGACCTAAGTTGAGTCCTAATAAATATCAACCCACACAACCCATACAGAT
CTCCAGATTAGAACATGATCCTTTTCAGGTACAAAAACAAAGTCACTTTCCACAAAAACA
AGCAGAAAGAACAGAAACATTAAGCACTCCAGATGTTTTAGCCAGGCAATATTTAGAATC
ACAGGAACATCTAAGGCAATTCACACAGACTGAAACACAACAAAAAAACTATAAATCTTC
TAAGCCAGATGAACCTTCTTTATTTCTGCCACTGCTTCCTCAGCGTTCTTTTACTTCTCT
GCCTATTAAAGTTGAATCTGGAAAAACCCACAAACCCTTTTCAACCATGAGCAAAAGTGC
AGTTGCAGAAAGCCATTCTGTAATCAGCCAGATGCATTATGGGCCTCTGCCATTCTCAGA
GAATATCACAGCACAGCAAAATCATTTGAAGGTTCTCCAAGAACAGCTAGACCTACATAA
GGAAGCTCTTCAGGCAAGACAGGAAGCTCAGGAACAACTGCTTTTGTGCAAACAGAAACA
ATTGGAAGAGCAAATTGGTTTCTCTCTATATCTTCCATTGCATTCGTCTGCTCACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNATTCACTGCATGGTGCCAAACCTGAATCAGGGAAAATTCAGGAATCTTC
TCCAATCAAGGTGGATACTGCACTTTCCTCAGGTGATTCTGTGGTCCCACAACTTCAGGA
TAGGCATTTGAGTTTTTCACAGCCTGTTTGTTTACCACAGCAAACTAATTTTAAATTTCT
GCAAGAAAAGTTGAATATTCAAAAGGATAGCCTTCAGGCTAGGCGAGAAGCTCAAGAAGT
ACTATATATTCATAAACAGAGTCAATTGGATGGAAGAGTAGATTCTGAACAGGCTGAGCC
CTCCCATCTCCCATTTCAGGTAGGTCAGCATGCATTTACCTCACCACCTTCTACTGATAC
AAAATCTAGAAAAATCCAGGAGCAATGTTTACCTACGAGCGAGAAAGGTTTTCTCTCAAG
CCAGTATGAAATCACAAAATCTGAAGAGGAGTCCTCAGGTTTCCTACAACAGTTCCTTCC
TCTCCATGATAGTTTGAAGTTGCTCAAAGAACAGCTGACTGCACAAAGGGATGCTCTTCA
GGCTAGGCATGAAGCTCAAATGGAATTACTTTTACATAGACAAAGGGATTTGAGGGACAG
TAAGTCTGGGCACATTTCTTCATTCTCACCAATGATTGTTGGACATTCTTTTCCTTCACA
AGATTCTGATGCTGAGTCTAGGAGAATTGAAAAACCTTATTTATCTGAGAAGGAGCATGT
AAGTCCTTCTAGTCATTTGCTAGTCCCAACATTCCAGGATAAATCTCTTAGTTTGCCACA
GCATAGCCTGCCACAGCAAGATTTGACAGCACTGCACGAACAGTCACACATACAGAGGGT
AATACTTGGTGCTGGACAGGAAACTCAACATAAACAAAGTGCACTGGAGAATATCCAAGG
AAATACATTTGAAGAAACTGGCTTGTCTTCCTTCATACCCCAGTTAGCACAAGCTTCATC
TCCCTTACTGCCTTCTGAGTCTGGTGCAACCCAGGTATTTCTTTCAACAGAAAGTGATAA
TAAAATTCCATCAAGCCAGTTTCAGATCCCAGAACTGCAGGATAGGCTTTTGAGAATATC
ACAACTTATCCAGCCCCAGAAAGATAATTTGAATGCACTTCAAGAACAGTTAGCTACTCA
GAGGGAAGCCATCTTTCAGCTCAGACAGGAAGCTCAGGAAGAACAACTTTTACATCGAGA
GAGTGAGTGGAAGGGAAGACTATCTCCTGAGCAAGTTGCCACCTCTTCCTTACCCCAAGT
AGCACAGCTTCCATTTACTTCATTACCTCTTACTGTATCTGAAAGAACCCAAGAATCTTG
TTCAACTAACAGTGATTATACAATCTCTTCAAGCCGTTCTGAAATGCCAAGATTGCCTGA
TAGGCTGTTGGGTTTATCACATAGTGTTTTACCTCAGCAAGATAATTTGATTTCACTTCA
GGAACATTTGCATGCACAGGCGAATTCCCTTCCTTCTATTGAAAAAACCTCAAAAGAATT
TATTTTACCTAGACAAGGTAAATATGAGGAAAAAGTATCTAATGAGCATTTTATCCAAAC
TCACCATGATGATTTGAAGGCACTTCAACAGCAGTTAGATATCCAGAGGAAAGCCATTCG
GTCTAGGCAGGAAGTCCAAGAAGAAGTACTTTTTAAAAGATTAAGTAAATTGGAGAAAAG
GGTATCATCTGAACAGATTAGTTCCTCTTCCTTCTTACCCCTTGATGCACTGCCTTTTGC
CAGCTCTGATAGAACCCAGAAATCTTTACCAACTGAAAGTAATGGTACTCTTCCCTCAAG
TCATCCTGAAATCACAAGATCACAGGATAGGCTTTTGAGTTTTTCACAGCCTATTCATCA
ACAAGGTAATGTGACAGCACAAATGGACTTACCTGGAGAAGTGTGTTCTAGTAAGAGACC
TCAAGAAGAACTACTTTTAAACAAAGTAAATCAGCTAAACAAAAGTGAATCTACTGAGCA
TGCTATCCCTACGTTTTTCAAGGAAACAGAGCATTCATTTATTCCACTACCTTTTGCTGA
AGCTAAATCTAAAAGTATATGTGAATTGCATTCATCTAAAAACGAACATGCAGCTCTGCC
AAGTGATTCTGTATTTCCAAGGTTTGAAGATAGGCTTTTGAGTTTTTCACAGCCTGTCTT
AGCTCAACAAGATAACTTGGGTCTTCAGAAGCAGTTGGGTTTCGAAAGAGAAGTTCTGCA
TTGTAGCCAGCAAGCCCAAGAAGAATTGCAGGTACAGAGACAAACAGCATTGCAGCAGCA
GATCCAGAAACATCAAGAGACTTTGAAGGATTTCTTTAAAGACAATCAGGTATGTTGTAA
GGTATATCTAAGAAGTAATGGAAGTTCGGAAACAACTCAGTTTTAACCCTAGGCCTATGA
GCTTTTAGTTAATGAGAGTAAGTGGTTTGATTTTAAATATGTTTTAATTTTTAAGCAGTG
TAGAAATTAAATTGATAGACCTCACATGAAGTTTATGAGCTTAATGGTTATTTGAAACCA
ATTAATTTTTTAAGAGGTTTATATTTTTATTTGAAAGGCAGAGTTAACACAGAGAAAGAG
AGTGACATCTTCGATTCACTGGTTCACTCCCCAAGTGTCAGCAGTGGCCAGAGCTAGGAG
CCAGGAGCTTTTGCCTGGTCTCCCACATGGATTCAGGGGTCCAAGCACTTGGGCCATCTT
CCGCTCCTTTCCCAGGTGTATTAGGGAGCAGGATTGGAAGTGGAGCAGCCAGGACTTCAA
CCAGTGCACATATGGATGCTGCACAGCACTGCAAACCATTGTACCAGGGCTGTCCCCAGA
AACCAATGACTTTCTAGTGGAAACTTTGTAAAACAATGTAGCCTTTTATTTGGACATTTG
GTATGAGATTTAAACATACCGTAAAATTAAAATTGTAAAAGTAATTGGTTAGCAGAATGT
ATGTAGTAGATCTTGTGCTTTTTATCTATAACATTCTGTTGACATTTATGTGTGAATATG
AATCAAGTCCCATTTTTTTCCTCAGGTAACACTATTATTGCCTGTTGTGAAACAGCCATT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAGAGATTTACTTATTTGTTTGAGAGGCAGAGTTCCAGAC
AGAGAGGTCTTCCATCCACTGGTTCACTCCCCAAATGGACGCAACAGCTGAGCTATTCAG
AAGCCAGGAGCTTCTTCCTGGTCTCTCACGTGGGTGCAGGGGCCCAAGCACTAGGGCCAT
CTTCCGCTGCTTTCCCAGGCCGTTAGCAGGAAATGGAGCAGCCAAGACTTGAACCAGCAC
CCATATGGGATGCCAGTACTGCAGGTTGAGGCTTAACCTACTATTCCACAGTGCCAACCC
CTACTTTTTTTTATTGAAAACAATATTCTATGAATCCTTTGATGTTCAAGAAAAGTTGAG
TTTTTGAGATTGATCATTTGAAGGAAAAGCAATGGCAAATGAAAATGGGGGATCCTTGAG
TATGATTGTTTGTTGAAAGAAAGATACAGGAGAGGCAAGATTTTAGGTTTAGCGTTATGA
ATTATTGCATTTTTTGATGGGAATATAACTTTTTCAGTATCTTATTTTTTCTTTTAGCTG
TGGGTAGCATGGTAATAGTGCAGTTGGTAGAACTATTTGGTTGAGGTTCTAAATTAAGAA
GGAAGATATTAAAAAAAGGGAGATATAAACCTAATGAATTCTTCACATGATCCCTCAATT
TGTCCTTATCTGTCCACTTTTTCAGACAAGTAATTCCACAGTTGAAAATGACTTAAAAAT
GCAGAAGTTGGGGCACTTCGGAGAGTGGCTTCCTCGTATCCAAGACCTTGCAAGCAATGA
TCAGGAAAATAGTCGTATAGATAGGAGCAACTCTGATTATAATCAGCTGCTTTCAGAACA
TACTAGTGCCAAGCAAAGTGGTAAGATATTGCAATTTTATTTTATTTTTTGACTGGCAGA
GTGGACAGTGAGAGAGAGAGAGAGAAAGGTCTTCCTTTACCGTTGGTTCACCCTCCAATG
GCCACCGTGCGGCACGCTGTGGCCGGCGCACCGCGCTGATCTGAAGCTGGGAGCCGGGTA
CTTCTCCTGGTCTCCCATGGGGTGCAGGGCCTAAGCACTTGGGCCATCCTCCACTGCACT
CCCGGGCCACAGCAGAGAGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCTGGCGCCC
CGACCGGGACTAGAACCCGATGTGCCGGCGCCGCAGGCGGAGGATTAGCCTATTGAGCCG
CAGTGCCAGCCTGATATTGCAATTTATTATAATTATTCTGATTATTATTTGCTCTCATCC
TCTGCAGTTTTTTTGTTTGCTTGTTTGTGGTGTGTTTGTTTTGTTTTGTTTTGTTTGCCT
AACTTTGTCATTGACTTGATAGGTGAGCATTTGGACAAAGAGTTGGGTAGAAGATCCTCA
AAGCCACCTGTAGCAAAAGTTAGATGTGGATTGGAGGTAAACCAACATGAACTTAGTGCT
ATACAAGAAGTAGAATCACCAGCAAGTGTTAGAACTTCTATACCAGGTAAACAGAGGGCT
TGATAAAATATTTTAATAGTCTGCTAGTCTTCTAGATTTTTTTTGGCTGGGTTTATTTTA
TTTTATTTTATTTTTGTTAATGAAACATAGGCTTTGAATACTTATAATAGGAAAATATTG
GTTTTACATATACAGTATTTAAAACTTGAGCATAAGAAAATGTGGCTTTAAGTAACTAGT
CTTTATTTCGTGTATGAATGACACCAATGTACTATATGCAGCAGTTCTTCCATGTAGCAT
ATTCTGACACACTTGTTCCCTATTATTTTTGATGTTTACTTCTAAACTTGCTATTTTAGG
ATGTAACCCAGTTTGTTTTTGTTTTCTTTTTTTCTCTTAATGACTTTTTGCTTTAATACC
TTCAGTGCTGTTTTCCTGTATTTTTTATTTAAAAATTTCTAAAAATACTGGCTTTAAGTA
CAATTAAAATAGGTATATTTTTTCACTATTATTTCTACATCTGAGAACCTAGAAAAATTC
TTCCCTATAAACTTTGTTAAGTGGTCCTGTTAGAATTTCTTAGTTATTTTTAGATTTCAA
AGTTACCAAATAAATTTCCTGATCAAAATTTAACAAAACAAATCCTTTTGTAAAGGGAAA
CATAAGCTTTTTGTATAGAGAAGTGTAATGAAAACATTGTCTATTTTGGTCTTGAGTCAT
ATGGTACTGTACTTTTGTTTCTGACTGAAAGAATAAGAAAGGTAGAGATTCACAGTGACG
CCTAAGAATGAATTCCTTTGTGGCCAGTATCAGCGCATGTCAGGTTAAGCCGCTGCCACT
GATGCTGATATCTTACGTTGGAGCACTAGTTGGGGTCCTGGGTGCTCTGCTTCCCATCCA
GCTCCCTGCTAATGGCCCTGGGAAAGCAGCACAGTGATCTTGGTGATCAAATGCTTGAAC
CATTGCCACTCACATACAAGACTCAGATGAGTTCCTGGCTCCTAGCTCCTGGCTTCAGTT
TGGTCCAACCCCAGTCTGTGGCTAGTTAGGGAGTGAACCAGTAAATGGAACATCTCTTTG
TCTCCCTTTTTTTCTGTCATTCTGCCTTTCAGATAAATAAAAGAAAAAGAAACAGTCCCT
TTCTTGCTTCCTCATGATGTCAGTGGAGCATGTGAAGATTTTATTTTACTAGGCTTTGGG
AGCTTTTCTGTTTTGCAGTGTTTGACAAACCACAACTGTTTGGGAATTGATCATCAGAGA
TTTAGTAAATCATGATCATGTCTGAGATTGCAAAAATGTCATTTTGTCTAAAAGAGAAAT
AACTTTTTCCCTTTCCTCTACTTTTCTCTTTCAACTGTCTTTTTTAAGTGAATGTTATCC
AGATGTCAAGCCTTGACCTTCCCTTGTCCATACTTAACCAAACCCAATGAGCCACCAGAT
CTGATCTCTACTTTGTGAACTCTGCTATCTGTCCCTTCTTTCCATTGCTCTATCACTCCA
TTATTCTGACTCTCATTTTTTTCCTGGATGGCTGCTACAGCTTGCAGTGTTTGCTGTTTC
CAGTCCTGCTTGACTCTAGTCCATTTTCCCATGATATATTCAGCTAATCTCCCTCTCCTT
TCTCCTGTTTAGAACTCTAAGGCAGTTTATTTTGTTGTTTGTTTTTTATTTGTTTGAAAG
AAAGAAGTAAACAGAGACAAAGAGATTTCATTCCCCAAATGTCCACAGTGATTGGTTTGA
GGGTCGGGAGTGGGGAAGCAAAACTGGTAGCCAGGATCTCAACCATGTCTCTCACATAGG
AGACATCAGGCACTCCTGATGTGGGATTTGAGCATCCTAATCAGCATCTTAAATACTGGG
CTAAATGCCCACCCCAGTGATTCTGATGATAGAGGGACTAACTCTAAGTCAAGGTCCCTA
CTTCACCTATCAAACCTGTAGGATCTTTTTTTTTTTTTCTTTTTTAAACCTCAGTGGTTT
CTCCACAAACTATTTTTTTTAAAGATTTATTTAGTTTTATGAAAGGCAGAGTTACAGAGA
GGCAGAGAGGGAGGGATGGGGGGAGAGAGAGACTGTCTTCCATTCTCTGGTTCACTCCTC
AAATGATTGCAACAGCGAGATCTGGGCCAATCCAAAGGTAGGAGCAGAAACCAGGAGCTT
CTTCACGTGGGTACAGGGACCCAAAGAGTTGGGCCATCCTCCAGTCCTTTCCCAGGCCAT
AGCAGAGAGCTGGATTGGAAGTAGAGAAGCCGAGATTTGAACCGGTGCCCATATGGGGTG
CTGGCACTGTAGGCGGTTGCTTTACCAGCTACACCACAGTGCTGGCCCCCCTTTAGGATC
TTATTCCTTCCTTCATGACCTGGCTTTGGTCTAGTAAACTCCTGAACTACCAAGTGTCCT
TCTCATGTGCTCTTGGGAGCTCTCAAAAAGATAAATAATGCTAAAAGTTATAACATGAAT
AGCAGTTCTTCCTGTCCCTGCTCACCCTTTGATCTCATTCTACAGAGGCCATCATTTTTC
AATTTATATAAGTGTGTCTTGTATTTATGTTCATAAATACAGTGAATTAAAGCAGAAATT
AAGCTAAATTATCATCATGGTGTTGTATAAACATTTTTCATGGCTATGACAATTAGTATA
TTGTGATTATATTTCCATTTTTTAGGAGTTACTTTCCTGTAGTGTCTCAAATTTTTTCAT
TGCTTAAAGTTTCTATAGAATGCCTGTTTTCCTAATACTTTTATTAAATACCTCTCAATA
TAATTTTCCATGGAGTTCACAGTAATTTCTCTGTGGAATAGTTTTTATTTGGAAGTTGGA
TGACCTTAACAAAGGTCATTTTTAACAAAGGTCTTACTTCTCTCAAGAGGTTAGGTTAAA
AAAATTTTTTATGTACAAACATATACAGTATATCTATAGTAATTAAAATATCACAAGGGT
AGAGGCAATGGGGGAGGAATCTAAAAAGGCCCCAAGGGGGTGATGATAAAAATGAAGTTG
AGAAATATTCATCTCTTTTTTTTTTTTTTTTTTTTTTTTTTGACAGGCAGAGTGGATAGT
GAGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTTGCCGTTGGTTCACCCTCCAATGGC
CACCCCAGCTGGCGCATTGCGGCCATCGCACCGCGCTGATCCGATGGCAGGAGCCAGGTG
CTTCTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGTACTTGGGCCATCCTCCACTGCACT
CCTGGGCCACAGCAGAGAGCTGGCCTGGAGGAGGGGCAACTGGGAAAGAATCCGGTACCC
CGACCGGGCTAGAACCCGGTATGCCGGTGCCGCTAGGTGGAGGATTAGCCTAGTGAGCCG
CGGCGCCGGCCTCTGCAACCATTTTCCAAATAAACACTGAGCTTCCACTTAAGATGATGA
ATGAGAAGTAGGAATTTGCCATTTTTTCTCTCCTGTAAATCTTTGTGAAATAATTTTTAA
AAGCCAGAAAATACAACAAGTTTGGAAACAAGAATGAAGTGACATGGTAATTACATAAAA
GCTCGTCCTATGAACCACACTTACTGGGATTTATGCCTGCGTGTAATCCCTGCTCATCCT
GAAGCTGAAGTTCAAACAGCAGAATGCAGTGAGTGAGAGAGATCCTGAGCCTTTTTAGAT
CAAAGCTTTTCAAAAACCAATTTTGTACTCCTGAAAGCAGGTCACTGTATATGAAGCCAA
ACCATCATGCAGTAGAGAGAAGCCAGGTTTCGGACCCTGTGGGATGAGATACCCCAGAGG
CTGGAGAGCTAAGCCTCATGAAGAGGCCATATATGTATGTGAGAGAAGTCAACTTAGAAG
TGTCCATCTGCAGGGCCTGGCATTGTGGCGTAGTAAGTTAAGCCACCACCTGCATCCCAT
ACATTTGCCAGTTCAAATTCCAGCTACTCCACATCTGATCCAGCTCTCTGCTAATACACC
TGAGAAAAGCAGTAGAGGATGGCCATGTACTTGGGCCCCTGCACCGAGTAGAGGACCCAG
AGGAACCTCCTGTCTCCTGGTTTCAGATTGGCCCTCCTGTCTCCTGGTTTCAGATTGGCC
CAGCTCTGGCCATTTGGGGAGTGAACCAATAGATGGAAGATTCTCTCTCTCTTTCCCTCT
CTCTCTCTCTCTCTTTAATTCTGCCTTTCAAATAGATAAGTAAACCTTAAAAAAAAAAAA
AAAGAAGTGTCCATCTGCAAGCCTCCAGGGACCAACAGTCCTAGTTGGCATCTGACTATA
ACTGCAGGAAAGATCTAAAGTGAGACCAGAAGAATTGCTCTGCCCAACTCAGCCAACGCA
TGAGAACATAAGTTAATAAGAAATTGCTGCATGCAACTGTTAAATATTTGGTGTGTAGTT
GGCTCAGCTGTGGTTCTGGATGCTCTAAGGCATCTGAAAATGAACTTACAGAAAAAAAGA
AAACCATACCCACACACCCACATAAGTAGATTTCCTTAAATGAGTTGAAGGAAGGAAGTT
CCAAGAACAGAGGTGAGGCAAAAGCCATCTGTCAAGAGCTAAGCACCAGTTTGTGGAGGC
GAGGAGCAGACTGAACAATGTTAGGAAGTGCTAGCCTTCATTTGCCACAGCTGGTTCCTA
AATTGGGGGGTAAGGAGTTTGGCAGTAACCGTGCCTCTCCAGGTTGCCCTGATAAATTGA
GCATGCCACCTCCCCCAGAAACTTGCTTCAGCATCCCTGGCATTCCAAGGACAGAGACTG
GAATGTCTGACAATGTTGGGGGGTGGGACAGAGACACATCAAAGCAAGCAATTTGAAAAA
TTCCGTTTATCTGACTTGAGGAAGTTTCTCAACTGCCTCTAGGGAGGTGAAGAACAGGGT
TGAACCTTACTGAGTTTCTTGTTCTCACCACATAAAGCACAAAATGGAAACAAATAAAAC
TACATCAGGAGAGATCTTTTGGCAGGTGCAATAATAATAGCTATCACTTATATGCCATTT
ACCATGTGCTAAAGGCCGCTGTTCCAATTCACTTGCAACCTTATGGAAAACTGCAGCAAA
AAGGTTTAGTGGCATATGAAGACACAAGTCTGATCCCAGAGTTTTCACTGTTAACCACTA
GACCTTATAAACAGAGTGTGATAGCAGTGACATTTCAAATCAGTGAGGAAAGACTAGATG
CTTCAATAATGGCAAGCTTCCAATGCCAAAATAAGGCCACTTTTAGAAGGGGCCAATACT
CCAGCTTACTCCATTCCTGGAAAAGACAAAGAATGAAAACAAAGGCAAGAATAAACCACA
GGTTATATTTGTATCTTTAATTAATAGAGTGTGCATAAAAATAATGGAATATATTACAAA
GTAAGACTTAACCTCAAAATCTATAATGCATTTTTTTAATCATAAAAGGGGTGGTGTTGT
GGTACAACAGGTTAACTCACCATTTGTGATACCTGCAACTCATATTCAAGTGCCTGGGCA
AGTCCCACCTCTATCTCTGCCTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGGGGCACCGGATTCTGTTCCCGGTTGCTCCTCTTCTAGTCCA
GCTCTCTGCTGTGACCCGGGAAGGCAGTGGAGGATGGCCCAAATGCTTGGGCCCTGCATG
TGCATGGGAGACCGGGAGGGGGCACCTGGCTTCTGGCTTTGGATCGGCCGTAGCATGCTG
GCTGTAGGGGCCATTTAGGGGGTAAGCCAACAAAAGGGAAGACTTTTTTCTCTGACTCTG
TCTCTCTCTCACTGTCTAATTTTTTCCTGTCCAAAAAAAAAAAAAAAAAAAAAAAGCTAT
ATTCAGGGGCTGGCACTGTGGCGCAGGGGGTTAACGCCCTGGCCTGAAGTGCTGGCATCC
CATAAGGACACCGGTTTGAGTCTCAGTTGCTCCTCTTCGGATCCAGCTCTCTGCTATGGC
CTGGGAAGGCAGTGTAAGATGGCCCAAGTGCGTGGGCCCTTGCACCTGCATGGGAGACCC
AGAAGAAGTTCCTAGCTCCTGGCTTTGGATCAGCTTAGCTCCAGCCATTGCTGCCATTTG
GGGAGTGAACCAGCAGATGGAAGACCTTTCTGTCTGTCTCTCGCTCTTTCTCTTACTGTC
TGTAACTCTACCTCTCAAGTAAATAAACAAAATCTTTTTAAAAATAATTAAATAAATACT
TTAGGAAGTATATGAAGGTATGAGTTTTATGTTAATTGGCAGCGCAACAGATTTTGTGTT
GAAGTCTATTTGTAACAATCCACATTTTTTTTTTTTTCTTAAAGATTGATTAATTTATTT
GGAAAGCAGAGTGACAGAAGAGGGAGAGATAGAAATAACTTCCATCCTCTGGTTCACTCC
CGAAATGGTTGCAACAAACAAGGCTGGTCCAGGCCAAAGCCAGGAGCCAGGAACTCCATC
TCGGTCCTCCACGTGGGTGGCAGGGTCCCATGTACTTGAACCATCTTTTCCTGCTCTTCC
AGTTGTATTAGCAAAGAGTTAGATTGGAAGCAGAGCAGCTGAGACTTGAACTGGCATTCT
GATATGGGATGCCAGAATCACAGGCAGGAGCTTAACATGCTGTGCCACAATGCAAGCCTG
AATGATTCACATTTCCATTGAAATATAGTACCATTAAATATTGTATTAGGCCAGTGCCAC
AGCTCAATAGGCTAATCCTCCGCCTTGCAGCGCTGGCACACTAGGTTCTAGTCTCAGTCA
GTGCGCTCGGATTCTGGTCCTGGTTGCTCCTCTTCCTGTCCAGCTCTCTGCTGTGGCCTG
GGAGTGCAGTGGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCTGCTATTGGCACTCCGCCAGGTATTCAACGGAAATA
CCAAGGCCTTGCTGATAGTGCCAGGTTAGTCCCTGACCCTCAGAGCCTGGTTTCTATTAT
AGAAAGGTCTTGTTTTCTGAATACTTCTCCATCCCCTTCCTCCACATTATGCTGGTTCTC
AGCACCTCACACTTTGAGTTTTAACTCCATAATCTTTTTTAGTTCAGGTCAAGGAGTCCG
AGGTAGAGAATCATGCAGTATTGAGTTTTGCTGTGGAAGAAGAGTATCCCCGTTTGGGTC
TAATCGTAAAGCCAGATGATAAGGTTAGTAATGTCTTGTTGTATGCTAAGTTTTCAGAGC
TGTTTGGTTTCATATTTTCTTTTGCTTGGCTTGCTGAAATTTTAAAGTCTGTGTTCTCTG
AGATCTGCTCATACCAAGGTGGATCAATGATGAAAATAGCCAAATCTGAGCATCAGAAGA
CCTTCTAGTCTTACCTGATGCATGATCTCCATTGTTCTGAGAAGCAAAACTATCATTATT
TAAAACAATATGAGCGTTACAACTGGGGTTTGTGTGTGTGTATGTGTGTGAGTGTATGTA
TGTATGCATGTGTCTATAAAGATGGCAGTGGATAACTGAGGACTAGATGGATGAAATGTG
TGTGTGTGTGTGTGTGTGTGTGAGTGTGAAAGAGATGGACAGAGAGGCTAATCTTTTCTG
AGCAATGATGAAAAGGTTTTACAACTGACCTTTATAACTATGAGGTTTTCTACACTTGAC
CTGAGCTCAGAATTGATAACTGCTGAGATTGGTAATTTGAAATTTCTATAGACATTAGTT
GCTACATTGTAGTCTAACAACACCTTAATTTTTTAGGCTGAAACACAAGCGATTTCTCCT
GAGCCAATATCCTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1061, 5543..5676, 6268..6468, 6569..6693, 6794..6887, 6988..7083, 7184..7324, 9379..9562, 9663..9827, 13831..13842, 13845..13863, 13866..13887, 13889..13904, 13906..13953, 13955..13969, 13971..13993, 13995..14031, 16882..16974, 17123..17226, 18744..18881, 20315..20412, 20652..21411, 21613..23928, 25465..25639, 26122..26265, 31805..31957, 36102..36202, 36756..36791
1001..1061, 5543..5676, 6268..6468, 6569..6693, 6794..6887, 6988..7083, 7184..7324, 9379..9562, 9663..9827, 13831..13842, 13845..13863, 13866..13887, 13889..13904, 13906..13953, 13955..13969, 13971..13993, 13995..14031, 16882..16974, 17123..17226, 18744..18881, 20315..20412, 20652..21411, 21613..23928, 25465..25639, 26122..26265, 31805..31957, 36102..36202, 36756..36791
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved