Oryctolagus_cuniculus Locus DKC1
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus DKC1
Oryctolagus_cuniculus
DKC1
GeneScaffold_2644
SNORA36
5924..6053
11247
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAAAATTTAAAAGTCTACAAGTGGCTCGCACGGTACTCTTATTGGCCCAGCGTCGCT
TTAGCTAGTTGTGAGTTGCAAACATCAAAAAGCTTCCAACCTCTCGGTGCCTTAATATCT
GGACCGACACCAACTTGAAAGTGAAGCCATGGGAAAGCAATGAGTTAACAATTCCAGAGC
GCTCAGCGGAGGATCCAGCTGCCAATACCTGAGTTAAACCGCGAGGTTGAGCAGCGACTG
CCTGGGCCACGCCCACAGGTCCCAACTGGTGGGGCGCACTGCGCTCGCGCTTCCGACTCC
AGCCGCCGAGGGGGTGTGGAAGGCCCGAGGCGCATGCGCACTGCAGCGATAGCGGTTGCC
AAGCCAACCAATGAGATTGCCAGGACGGCCCGCGCAAGCCTCGGGACCCGCCCTCTCGGA
CTGACTCCACCCTTTCTCGCCCCGCGGCACGGCGGTGTACGCACGGAGCGGTGCGCTGGT
GGGCGGGTCCTAGCGGCACGGCCTGACGGGACCTGGGTGGTGGGTGTCTGCGGTTGTTCC
TTGGCGGCTGCCTTAGTAGTACGCACGCGGTGTAAGGCAACATGGCGGACGCGGAAGGTA
AGGGGTTGCGCGACCGAGCCATGCGATTATAGGCCAGGTCTAGCCCCAAAGTCTCCAGGG
AGTCGGGGTGGAGAGATGGCATCTGGGCCCGCGCTCACGGCCGGTTCCCGCTTACCGGTC
GGCAGCTGGGACTTGAGCCGGTGGTGTCATTCGGTCTGGCTCCGCGGGCGAGTGCACGAG
ATCGAGAGGCCCTCACGGTTACTTGGCTTTGCCGGGCCTGGGCCTCTAGCCAACGATCGC
CAAGCCACCGGGGGCCTGGGTCGCTGTTACAAATGATGGCGGGAGACCTGGCAGGCCGTC
TTGGTAGTACCTGTGTCGCCATCAGCCCATACACCGCCGCCGGTAGTACCTCACGACAAG
GGGAGCGAGAGCGGTCGCTTGGAAGAGGCACGGGAACTCCAGGGCAGGGGTTGCTCTGAC
CTGGGAGAAAGCCCTAGCTAGAGGCCACAAGGCCGCGTGGGCAGTCGGGTGGTCGCCTTG
AAACTTTGCGACCCAGGAATGAACGCTTCTGTAGGCTGTTTAAGCCCTGCCACAGCCACG
TGGTTAGCCTGTAGCATTAGGGAAGTCGACAGCTGCAACCCATGTGTTTGCCTTTGCACT
TTTTTTCTCCAATAATTCTACGCCTAAAATTGATTTTCTACCTGCCTTGATTTTGCTCCT
TAAACTTTATTTTATGTAGTTTTGAGAAAAATTCTCCAATCTCATTTTTGGTTTTTTAGT
AGTTATTTTGTCAAAGAAGCATAAGAAGAAAAAAGACCGGAAGTCGTTGCCAGCAGATGA
TATAGCTGTGAGTAGAGATGTATTTTACTTTGGTTTGAATGAAAAGAAAGGTTACTTAAA
TAATAAATTGAAGAAAACAGTTTTTAAAGGTTTGCAGGGAATGGACTGTGGTTGAGTGGT
CATTGTGTGCACTCAACAAAGTGCCAAAATGGCACAACTGCAGACACTTGGGTCCTGTCC
AGCATAGATTACTAAATGGTTTCAGCCAAATCAGCTGTTCTAGGTGAATTTCTCTTTTTT
ATCCCACCCACAGGCCCACCATTCCTCTTTTTCTTTAAATATTTGAACTCACGGAGTGGC
ATTTCACCCCTTCTAAGCTACTTGGTTTCTTCTCTTTGTTTCCATTGGAAGTTTCAGTAC
ACAGGCATGGAATGCTTTGTTTCTGTTTAAGTAACATGCACTCAATGTTAGTAATAGATT
TGTTGAAAATCAGCTGACCAATCTAATAGGTTGTGTTTCTGAACTGTTGAAGGAAATACA
ACATGCTGAAGAATTTCTTATCAAACCTGAATCCAAAGTGGCTCAGTTGGACACTTCTCA
GTGGCCCTTGTTGCTAAAGGTATGTGCATCAGGTGAATGCCTGGCTTTCACATTATTTCT
AAGTATTAAACAGTTTATTAAGAATGCTTCCTGCTAGCATCCTTTACTTCAGGGAATGCC
AGATGATTAAAGCAGTGTTCCTCAAAGTATCTCAAATGAAGGATGAGGTTATTGACTTTT
CCCATTGTGCTGCACGCTAGTAGAATATAATTTCAGATATGTCATGGCAATTTTAAATTG
CTATCAAAGTTTGTAAACAATTAGTTTTTAGTTTCTGCACTTGTAAGACAAATCTGTCTA
ATTGTGGGCTACACGTGGACTAGGACTGTTGTAGTGCTCAAGAGCGTGGTCCTTGAAGCT
GCATCAATTTAAGCCAAACTGTATGTGACTTTGGACCACTCATGTAACTTTTCCTTTTTA
TTTTGTATTTATTTTTGAGTGAAAGAGAGAGAATATGAATCAGCCCTCCCCAAATGCCTT
CAATAGCTTGGGCTGGGCCAAGCCAGTGCCAGGAGCCAGGAGTACAGTCTGGGTCTTTCC
CAAGAGTCTGCAGGGACCTGAGTATTTGAGCCATCATCTTGCCTTCCCAGAGTGGGCATT
AGCAGGAAGCTGGCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTGGTTAAGATGCCGCTTGGGACACTTGAATCTCATATCAAA
AGTGCCTGATTTTGAGACCAGGCTCCACTTCTGATTCCAGCTTCCTGGTAATCTGCAGCC
TTGGAGGCAGCTCAAACAGTGAATCCCTGCCAACCATGTAGGAGACCCAGATCTAGTCTC
AGCTCCTGGCTTCAGTCTGGCCCAGCCTGGCTATTGTGAGATTTGGAGAGTGAACCAGCA
GATATAAATAAGATCTCTTTCTGTTTGTCCTTCTGTCTTCCTCGCTCTTTATAAAAGTAC
ATTTAAAATTTTTTCAAGAAAGTCTTGGCTATAATTTGAGCTTTTGAATAGGGTAGTTGA
GTAATGAGTTGAATTGCAGTGTTTTTAGGCTTTTAGGCTAGGGTAAAAAGTTAGACATCC
CTCAATCCTGTAGTTTTCATAAAGCTTTGTATGTGGGATGGTAAAGAATGATATTTGCTT
GTATGCTTTAATATACTTGGGTGTCTGCTTAGCCAAATATTTCTGTCATTTAGCCAGCAT
ATGCTTTTCTATTGTAGACCCTAGGGATCTGCTACTAAACAGGGTAGCCAAGCTCCTTGC
TCTCATGAAACTTAAAATCCAGGGGTGGAAGATAGGTAAAAGAGGGTTTGTTTTTTATGA
AACTAAACTGGTGATGAAAGTTGGGCTTGATCATCATTTTGGCTACTTTTGTCCCTCAGA
AAATCAAAACTGTTGCATGTTTTATTCATAATCTTGCAGTGAAGCCAGTCTTCTTCATAG
AGAATAATGAGTTCAACTTACCAATATTCTAGTTAGTGTGATTCTTACTAATTTGGGTGG
TGTATAAGGAGCAGAACAGTTTCACAGCAGATACTGGAAATACAGTAGCAAAAATGCAAA
TTCAGGAATGTGAAATGTTAGCATATCATGGTTGATGATGGTGCTGGCTGTTACATGTGT
AAATGGTTTATCATTAACACTATTTTGTATTGTATTGCTGCTTTCTAGAATTTTGACAAA
CTAAATGTCAGGACAACACATTATACACCTCTTCCTTGTGGCTCAAATCCTCTGAAGAGG
GAGATTGGGGACTATATTAGGTAAGTGTGTTGGGAGCAAGCACTGTTGATAGAAACCTAC
AGTGGCTTTGTCTTGAATGTATAACCTGTTCGCGTGGTGAATTTTTTTAACTCTTCAGGT
TTGTTGTTTTATTGCAGCATGAGAGCAAATGGTACATTAATTTTCTGTCCATTCTAGGAC
AGGTTTCATTAATCTTGACAAGCCCTCCAACCCCTCTTCCCATGAGGTGGTAGCCTGGAT
CCGACGAATCCTTCGGGTGGAGAAGACAGGACATAGCGGTACTCTGGATCCCAAGGTGAC
TGGCTGTTTAATCGTGTGCATAGAACGAGCCACTCGCTTGGTGAAATCACAGCAGAGTGC
AGGTATGTGCAAGACAGAAGGCAGGTTTACCTCCACATTTTGCCTCTTGGAAATTTTCTT
CATTAAGGGGAAAAAACCTACCCTGAAGCATGGATATGCTTTTTGTTTCTGTGTACCTTC
TGTCCTCTGCCAGATCTTGGTGGGTCTACATTTGGAGTTCATAGAGGCATGTGTTGATAA
ATTCCGTTCATGCCGCTGAGGCAGAATTCTTTCCGAGTCCAACTCTTGTCTTGTTCCAGG
TTCCTTTCACGTTATGTTTCTGTGAAATCTGCACCAAGACACTGAATAATGTTGAGCTCC
CAATGTCGTCGTTCCATTCCTTTCCTTTCTTTTCAAAATGTCTGCTTTTCCTGCTGTGCA
AGATGGCAGCTATGGAGCATATAACAAATACAGAAAACTGAGTGGCCACACCTGACTACT
CTTTTGTCATTTTTCAGGCAAAGAGTATGTGGGAATTGTTCGGCTGCACAATGCTATTGA
AGGGGGTACCCAGCTTTCTAGGGTAAGTCTCTCACTTTAGGGAAGGGAAGTTGGGTCTCA
GCCCTTGAAGCCTTTGGAAACAGCCACCTTTTGTGGCTGACCATGCTCCTGCCCTTTTCA
ATGGGCTACCCCATCCAGCCACATCCCTTCTGAGGAGCTGCTTCCCATCAGCCCTGAGCC
GTCCCAGGGGTTGAAGAACGAAGCAGAAATGGAAAGAAATGGCTTTTTAGTTATTATTTG
AAGAAAACCTTTTATGTTTTGTATCCTTAAGCTCCCCAAATATGCCCTCTCATCTTATTT
AAGAGGCCATGTAGGGAGAGTGCTTGTTTCTATTTGTGCTTATTCTCAGGCCCTAGAAAC
TCTGACGGGTGCCCTCTTCCAGCGACCCCCACTTATTGCTGCAGTGAAGAGGCAGCTCCG
AGTGAGGACCATCTATGAGAGCAAAATGATCGAATATGATCCGGAAAGAAGATTAGGTGG
GTTGTTGGGTCTTTGAGGAACTGAGTTATCACAGGCCGCATTGGGTAGGAACTCATTCTG
GAAGGTTCTACGGTAATCTTTGAAAATACTATGTGGTGAGGTCATATCATCTCTAGGCTT
GATGACTTAGAAGCAGACTAACTCTGGAAAATACTCTGTATTGTGTTTATGTCTTAGGCA
TATTTTGGGTGAGTTGCGAGGCTGGCACCTACATTCGGACACTGTGTGTGCACCTTGGTT
TGTTATTGGGAGTTGGCGGTCAGATGCAAGAACTTCGAAGAGTTCGTTCTGGAGTCATGA
GTGAAAAGGTGTGTCTTCATGGAGCTAGAAGATTTAGAGCTGGTTCTGGGTATCTTGCAG
CCCCTGGTGGAACTCTGCCTACTTCACACCCTGGGAAAGGCCACTTCCAAAGTGTTGAGT
TCAGTTCAGGGCATCTTCCCTGTTCTGTTAATTAAACTTTGGTACACTAAAAGGGGTTTG
GAGATAGAACTGGATAGAAAGTATCACTATTCGTTTATCTCCCAGCCTACAGCAGTGCTT
TCATAAAGTGAATCTATAAACAGTTACAGGTGTCCAGAAGGGAGGTGAGTATGAAGACGC
TCAGGGTTCTTCATGAGCTTGCACTAGTGGAAGAGATGCATGGTATATGAGTGTCACAAG
TGGTATCTTAATTATGTGGCCAAATGCCCACTGCTGTTTGTGGACCTGTGAACTGTTGGA
GATCTGAAGACACTGAGTTTTTTCCTATGTACCTGCTTTTCAGGACCACATGGTGACAAT
GCACGATGTGCTTGATGCTCAGTGGCTGTATGACAACCATAAGGACGAAAGCTACCTGCG
CCGAGTTGTTTACCCTTTGGAAAAGCTGCTGACATCTCATAAACGGCTGGTTATGAAAGA
CAGTGCAGTAAGTTCTGCGATGGGAATGCGCATTTGAACAGAAACTGACTCCAAAGATAG
GATATGGTCTTTTTTTCTTGGAAACTCTATGTGCCTAAGAAACCTTGACTGACTTAAATT
GTTCTAAGACAAAGTTAGTTTAATGGGGAAAAGTTGAGATTAGAGAGATTCAGAGCTGTA
ACAAAGTTATTTATCCTGTAGAAGTTTGAATAAAATATTTTGTTAGTGTAAATAAAACAT
AGTTTGAGGCTGTGAAAGCGAAACTTCACTGAGGTTATCAACCTCTTTTTTTTTTTTTTT
TTAAAGATTATTTTCACTCAGGTGGCTGTAATAGCCAGAGCTGAGGCAGATTAAGGCCAG
CAGCCAGGACCTTCCTGCAAGTCTCCCATGAGTGCAGGGCCCCAAGCACTGAGGCCATCC
TTCACTGCTTTGCCAGGTGCATTAGCAGGGATCTAAATGGGAAGTGGAGCAGCTGGGACT
TGAAGCAGCGCCCATAAGAGATGTAGATGTTGTAGGCAGTGACTTTACCCACTATACTAC
AGTGCCAGCCCTACAAGTCCTTTTCTTAACATATTCACTAACTTGCCTTTTACTTGAGAG
TATTCCTATTAGCAATGCAAGTAAATATTTTTCAGTTGGGGTTTCTTTTGTAGTGGTCAT
TTTAAGAATAAGTTTCTTACTTTCCAAGTAGTCCAGAATTTGTTAAGTATGATCAAAGAA
TGTAGTTTATAAATTTTGTTAAAGACTAGGCAGGCATGAAAATTCTCTAAGGAGAGAGTA
GAATATGGGTAGCAAGAGATCTAGATGAGTGAAGATGGTATAGCATAAGGCAGATAGATT
CCAAAGTGCTGTTGAACTGAAGAGGTGGGCTTCTACCCATTGGCCTATAAGTTTCATGTC
TAAACCTTTGTGTGATAGAGAGGAGCAATTAAGGAAAGCTAAGACTGATGTGTGTGTGTG
TGTGTGTTTATAAAAAAAAATAAACTTGTATGTCCCAATTGCATAATTAATTGGAGATCA
GTGAGGAAGTAGTTACTCTTTCACAGCTAAAGGATCAGGGAAATGGGAGAAGTAGCTGTT
AAATCTGTCTAATATTTTTGAGTCATGCATGAAAAGTGCTGAATTCTTCTGTGCCCTGTG
GATGCGGTGTGGGATCAGGCTGCAAGGCAGCGGTGGAGTCCTCACATGCGACACCGTCTC
TGCAGGTGAATGCCATCTGCTATGGGGCCAAGATCATGCTTCCAGGTGTTCTCCGATATG
AGGATGGCATTGAAGTCAATCAGGAGATTGTGGTCATCACCACCAAAGGGGAAGCCATCT
GCATGGGTAAGAAGGGATATACTGCCTTCATCAGTTCTGGTACCATTGCTGCTAGACTCA
CTGAGAATAGGTCCCCACATCCTGGTTCCTTAAAGTTGTTCTAATCATGGTGTTTTGGGG
GTGAGGGGAGGGATTGGTCAGCCAGGTACTTGACTCTAGTGAGAATACAGAGAATCATTT
GTGACAAGTGAGAAAAGATTGTTTATGGTAAGGCAAAAAGCCTTTTAGTCTACTGCTTGT
CTGCTTCCCAGTAAGCTTGTGGTTTGTATCAATGTTTACCTTGTGAAAGTTTAGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATCTTC
CACTGCTTTTCCAGGCATGTTGCAGGGAGCTGGATTGGAAGTGGAGCAGTCAGCACTCGA
ACTGGTGCCCATATAGGATGCTGGCATCTCAAGCAGTTGCTTAACCTGCTGTGCTGCAAT
GCTGGTCCCTTAAATGGGGTTTAAAGTGGTATAAAATAGTAGGATTGGAGCTCATCCATT
CTTTTCACTTCAAATCATTCTTTTCTCTCTCTCCAATTCATGTAGCTATTGCACTAATGA
CCACCGCAGTGATCTCTACATGTGACCATGGTATAGTAGCAAAGATCAAGAGAGTGATCA
TGGAGAGAGACACTTACCCTCGGAAGTGGGGTTTAGGCCCAAAGGTAAGGGGGACTGGGT
GAAGTGCCCTGTTAGCTGGTTTTGCCTTGGGATTTGCATTGTTGATGAGCATAAATAGGC
CCTGTATCAGACCTTAGGGAATGGTGCATTTTAGCCATGCTAGCAGCTGTTGAGTACAGA
GGTGCCTGGTACCTCGAAACGCCACAATGACCCTGGTGTTGACCCTGGTGTGGAGGTCTG
GGCAAGTCCTGTGTTTGTTCCTGTTGGAGGGAGTAGCTGAGTTGCAAATGCTCTGCAGAA
CAGCGTGAGGTTTTGCTGAGGACACACAAGGGAGGAACCAGGTGCTGTTCTGTCCAAAGT
GTGTTTAAGCCACCTGTGTGCAGTCACACTGCCTTCATAGATGCCATTCTAATGTTGAAA
CCCTGACATCCCACCAGGCAAGTCAGAAGAGGCTGATGATCAAGCAAGGCCTTCTGGACA
AGCATGGCAAACCCACAGATAGCACCCCTCCCTCCTGGAAGCAGGAGTATGTCGACTACA
GGTGAGGACAGGATGTTTCAGAGGCAAGGATGGGCGGGGACAGCACATCCCTGACCACAG
GTAAGGGTGGAAGGTTTCAGAGCCTGTGGCAGGAGTTGTGTGTAGGAACCAGTGTCGCAG
CTACATTTTCCTTACTGGGCTCCATGAGGCTTGGCTGCCGTGGCTCATGGAACTGAAGAG
GGAGCCAGTCTGCAATAGTAAGTGGTGAAGTTTCTTTTCTCTCCAGCCTTGGTATTCTGA
TGGTGGCTTTAGGCTTGCAGCTTATCACTGAGGGTAACAGGATACAGTATCCCTGCTGTG
AAAACCTAATGTGACTTGCTGCTACCTCTCCTTGCAGCGATTCTGGCAAGAAAGAGGTGG
TTGCTGAAGCAGTGCAGGCCCCACAAATAGTTGCCGAAGCAGTGCAAGTCCCCAAGGTGA
GTGACATGTCCTTGGAGACTTGATCTAAGAAGTGCAGTTTGCCTTATCTTGGTGACTGTC
TGCCCTCCTGGCACACCATGGGGCACATGTAGGGTAGGCTGGCATTAGAGCACAGAAGAG
AAACCTTGTAATCAGAAAGCATCTATTTAGGGCTAATGGGCATCTCCTATCTCTGACTTA
CGGAACCTTGCCTTTATACTATTGTTTTCATCTCAGCGGAAGCGCGAGAGTGAGAGTGAA
AGTGATGAAACCCCACCAGCAGCTCCACAGTTGGTCAAGAAGGAAAAGAAGAAGAAGAAG
AAGTCCAAAGCTGCTGCAGAGAGTGGGGCAGAGCCTGCAGATGGGGTATGCTAGGGTCTG
GGCTGGCTGGGTACCCGGGTGGTGCTGGGCTGCATGATGGTGGGTACTGCCCTATGTTCC
TGGATGTCACAACTGCTTATGATTCCAATTCTACCGACGGTGGGTGGGGAGCTTTGCTAA
TCTGGATGTAATGACTCACTTTGTGTTTCTCTCCAGGACAGTGACACCACCAAGAAGATG
AAGAAGAAGAAGAAGAAAGCTAAAGTCGTAGAGGTGGTGTCTGAGTAGCAAAGACCACTT
TGAGTATTGACTTCAGCTGGGAAGGAGAAAGGAAGTAAAGCCTTACTGCGGAAGTAATTG
TTCCTCTTGATGAGGCAGTGGAACAAAGGGCACATTGTAGCTGCTACTTGAGACCCTGGG
TGATGTTACCTGGTGTGGGCTTTCCATCTTGTCCTGTTTTTAAGGATGTGGGTGACAAAA
GAGGCAGATTTTATGCCACCAACTGCTCTGTTTTGGAGTGGGAAGCCTCACTCACCTTTA
GACCCACTACTGCCCAGTGACTGTCTGCAGCTGTTTCTAAAAACATCCTAGTCCTCTCCT
CATGGGCTGTCTTTTTTTTTTTTTTACCACCTCCATTTAAAAGTGTATATAACAAGTCTG
CCCAGTGAAATGGTATTGAACCCCCAGTAAGTGCACCATATTCCTGGGGGAGTCGGGCCC
CCATGTCCTGGGAGGAGACTGTTCTGTTTTGGTGTCGGGTTGAGGCTTCCATCTTGTGTG
CTTCTCCAAAGCTTGAGTGTACAGCTGTGTTCACCTAAAGCCATCTGGTCGTTTGTGTCT
TTGACAGAAGCTGAACCGTTCCTGTACCCTCTTGTTTTAACCTTCATTCACTTTTAAAGA
ATGGAATCACTCATTGCTGGAAGCCGAGTGTTGTAATTTGTACTTATTAAAGTTGACTTA
CTAAGTTTTTTAAGTATTCCTGTTGGGTTTTCTAATTGTTGGAGATTTCAGACTAGCGTT
GTCAATGATTTTCCTTTATGTTTAGCTAGCTTCGCATTCTAATTCCGTATCTTAAAACAT
TCACTACCCTGAGAATGGGGTGGGGCAGGTGCTTACCACCAATGAAGAACAGACAGGATC
ATGAAGCTGTCAGTTCATTGCTGGCCACAGGGTGGTCAGGGAGGAGTCTGAAGGCCTTGC
TGCCTCACATTGTTAGCAGGAAGAAGGTCTAGGCTCACTAACAATGTGGTACCAAAAAGC
CCAGAAAGAATACAAAACACAGCTTAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1016, 1739..1806, 2272..2358, 4128..4219, 4377..4561, 4997..5061, 5389..5515, 5697..5827, 6283..6426, 7625..7745, 8625..8743, 9137..9240, 9577..9655, 9876..10004, 10176..10247
1001..1016, 1739..1806, 2272..2358, 4128..4219, 4377..4561, 4997..5061, 5389..5515, 5697..5827, 6283..6426, 7625..7745, 8625..8743, 9137..9240, 9577..9655, 9876..10004, 10176..10244
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved