Oryctolagus_cuniculus Locus GTF2A1
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus GTF2A1
Oryctolagus_cuniculus
GTF2A1
GeneScaffold_1894
SNORA79
2760..2903
30927
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTTTCTGAA
CTCTGTGCTATATAATAGCTGATGATTACAATAGATGCTATGAAAAGATGGTTGAAGATA
AAAACAAAAATTTCTTTAGGTTGCTAAAGTGGCAAAGAGGAAGTTTGATACTTTAAAAAA
TTGTTTTCATTATCCTTTGCACTTAGATGAGATTTGAGGTTATATTTTTGTGCTATGTAA
GTTTTTAAATGGAAGAATTCCATAAATAGCTAGTAAAAATATGTTTGACCATGTATTGAG
TTATTTTTTCATTTTTAAACTTTTAATGTTGTTTGCATTAGTTGTGGGAGAATAAACTAA
TGCAGTCTAGAGCAGTAGATGGATTTCATTCAGAAGAGCAACAACTTTTATTGCAAGTTC
AACAGCAACATCAACCCCAGCAGCAACAGCATCACCACCACCACCACCATCAGCAAGCTC
AGCCTCAGCAGACAGTACCTCAGCAAGCCCAGACCCAGCAGGTCCTTATTCCTGCATCAC
AGCAAGGTGAGACTAGATCTGTTTTCCTAACTACTTGGAAATTAAGTTGGTCATTTTAAA
AGACTAGAAATACTCTAGGTCACTTGGATCTTGTTTTTAAAAGGTATTTCATAAACCTAA
AAAAAAAAGTACTGATTTTGTTTTTCCCTTTTCTATGTATGTTTTTATGTATATAAATTT
GTATAAAAATGTGAGTCCTATTTGTAGAATAGTGATAGACAAATAATTACCTGATTGAAA
CCCTAAAATAGTATTCAGATACTTGTACTAATGTTTTTTAGGAAGTACATATAGTGGTGG
CTTTCCTAAAATTTAAGTCAGATTTATAATTTTTTTTAACTAAGATTTCATTGTTTTATA
TAGTAAAGTAGTTATTTCTTCATGAAACATTTTCCTTCAAAGGGATATTGGTGTTGTTTT
TATGTCTTAAATCCTGAGTTTTGAACCATATGTTGGCATTCTGAAAATTCAGTACCATGG
TAATTTCTGTGTCTAAATTAACAATTAAATTTCTTTTATGTGAATAGTTGATCTATATAT
CTTGATGTATATTATTACTCTGTTTAAAGGTATGAACAATGCACAATGCAAAACTATTTG
TTTTTCATTTATTTTTAACTGAAAGGCTGAGAGAGAGAAAGGGAGAGAGAGATCCTTCTA
TCTACTGGTTTATTGTCCAAATGCCTGCAACAGTGTGGGCTGGGACAGCCTGAAACCAGG
AGCTTGGAACTCAATCCAGTTCTCTCTTATGGGTGGCGGGTGCCTAAGTACTTGAGTCAT
CACCTGCTATCTCCTAAGAAAGATGAGGCTTCATTTTGACTCCTTTTAGGAACTCTATGA
AATAGTTCTTAGCTCCATTGCTTCGTAGCTGAGGCAAATCTGGGCCTTAAAAAGGCTGAG
AAGCATGATCCATTATATGTAGCAAATATTTTCTGTCATAACAACTATGTTCAATTAAAA
ACTTACTAAGTATTCTAATTCAGTGAATCTTGATTGTTATTGGAGAAGAAGGTAAATGAA
AAGCTTGTTTTAAGGTAACCATTTAGTTAACCTACATATATATGTGTATGACTTGAAATT
GATAGTGAAGGGCAAGCATTGTGGAGCAGCCAGGTTAAACTGCTGCTTTTAATGCCTGCA
TACCACATCAGAGTACTGGTTGAAGTTCTGACTGACTGCTCTGCTTCTGATCCAGCTTCC
AGCTAATGCACCTGAAAAGGCAGGAGATAATGGCCCAAGTACTTAAGTCCCCGCCACCCA
CTTGAGAAATCTGGATGGAGTTTTAGGTTCATGATTTCAGTCTTGTTCAACCCTGGCTAT
TGTAGGCATTTGAGGAGTGAACAGTGAATTCACAGTCTCTCTCTGTTTTTTTTTCTCTCT
CTCTCTTTCAAATATATACATATATACATACATAATTCTTTTAAAAAAAGTGAAAAAAAT
GATAGTGATACACAGTGGAAAGGTCTTTTTGGGTTGTTTTGCTGTTTATATAAAGTAAGA
TTTAATATCTGCTTTAAATCTATCCTTTGTTATCAAATATTTTTAACTCTTAATCTTTTC
TGATGACTGTTCCTCCTAATGCTTTCAAGCCTGGCATTAGGATTTTAGGTCATCATAAAT
TAAAATTTGATTTTCTTCACTCAGAGATTATGTGGATAATGGGATTGTCTGTCTGTTCTC
TGAAATTTGCGGAATCAAACATTTAATGCCTTTTACACTTAAGTAACATCACCATTATTT
TCAATTTCTACTTTTCGAACAATTAGTAACATCCTAGCAACTGTCAAATTGGGAGAAAAG
GATTGTAGATTAAAAAAAGTAGTTATAACTGAATTTTGTTCCTAATGAATTAGTAGCTGT
TGTGATAAGTATTTCATTTCCTCATCTTACTGAATTCCTTTGCAACCTTCAAATTTATCA
CTTAAATACTTAAATATTGATGTTTTCTGTTATGATACAGTTATACTAGAGCTTTAAATG
CTGTAAAATGTATAACATTTTGAAGTATCAAGGGGTTGAGGGCATTTAAATGCAGAAAAA
GTTTTCAGCATTAAATAACATACTTGTGATTATGAAATAGCCTTAGGGTTCCTTGTTTCC
ATGTGTGTTTATTTGATTTAATTATTTTGTAGCCACGGCACCTCAAGTTATTGTTCCTGA
TTCTAAGCTGATACAGCACATGAATGCATCAAACATGGTAAGACTCATAGTGTAGCACTT
TGATTGGCTTTGCGTCTTCTAACTCAGATAGGGATCTTGCCTGGGTATGTTGTATATTAA
CAACTTGAAGTTTATTGAAGACTTGAACAAGACAGATATTTTATTTAGTTTCTTATATAT
TGTATTTAGCAGCAGATCTAAAGTTTAACTTGGTATTTCAGCATTAAGCTTCATAAAATT
ACGTAATTTTCTGTTTAAAAAGTACCAAAAGGTGTTTTATGGGAGCTCTTTTATCCCTGT
TTGTTTAAAACTGGGTAATTCCCAATTCGAAGATACTCAGTAAAAATAGTTTTGATTTTT
CTAATGGTGCTGTGTGCTATAGAAATCAACATTTTGAAAAAATATGTGATTTCATGAAAA
TGTGGTATGGTAATATAATTAATCAGAAAGATATTTCAAGGAATTTATATCATCAAACTA
ATTTTCCTGGTTCTTTTTTTGAAATGATGTAGTGTATTCATATTTGGGCTGTTTAATGAA
ATAGAAGAAAAAATTTTTAGTAGTCATTAAGTGAAAGATGGTTTCCTTATGGTATATCAT
TTCACAAATATTTATTCAGCTATTTGAGTATGTAGAAAGTGTGCAGCTGGTTACTGTGTC
ATGTTTATGCTAGTAGAAACTACTATGTCAGTTTGCCAGTAGAGGGAGAACTATTATCTT
GCAAAACGTGAACGATAGGCCTTTTATGTTTGTAAATAATACTTGTCAACGATAAGTGCT
AATACGTTCATTAAATTTGGATTACCTTTTTGTTTTGCTATATATACAAAATTTATTTTA
TATTGAATAGTTGGGTATGTAGCTTAAAGATGAATGAATCTAGTAGACTGTAACAGGGAA
TTTCAGGCTCAAGATGTAGCAGCTACTTAGGACGTCAGGTGGCAACAGTAAGCATATTTT
ATTGGAAAGCTGTACTTAGAGCCTTAGATGGTAGTTAACCCAGTTTAGTATGATTTTCCA
AGTTTGATTGAATTTTCTGGCCATTAACACTTCCAGAACACAGTTTTATTTGTTCCTCTA
AGCTTATCCAAATTAGGAGTATTTGTAAAAATATATAAGCAGGCTGGCGCCGCGGTTCAC
TAGGCTAATCCTCCGCCTGCGGCGCTGGCACCCCGGGTTCTAGTCCCGGTCGGGGCACCG
GATTCTGTCCTGGTTGCCCCTCTTCCAGGCTAGCTCTCTGCTGTGGCCAGGGAGTGCAGT
GGAGGATGGCCCAAGTACTTGGACCCTGCACCCCATGGGAGACCAGGAGAAGTACCTGGC
TCCTGCCATCGGATCAGCGCGGTGCGCCGGCCGCGGCGGCCATTGGAGGGTGAACCAACG
GCAAAGGGAGACCTTTCTCTCTGTCTCTCTCTCTCTCACTGTCCACTCTGCCTGTCAAAA
AAAAAAAGTTTTAAAATCTTAAAATTTAGGAATTATAGATGAAGATACTAGGTGCTTTTG
CCACAAGTATATTCATTGAAAGCAAGGAATTGGGAATAAGGAAACAAAGGATGAGAAAGG
AAGCAATGTGGAATGGTTTTCCTATATCATACAGCATTGTTTTTAATCTGGGTGTTTCTA
AACGTGTATAGGTTAGATTGAGTATATGAAGGCTTAAAGAAAGTTGACAAGATAAAATAC
TTGAGGTGTCCTGGAAGCTATTCTCTATGGGGTGAAAAAAAGCAGTGTTGTTGTATATAA
TTTTTGAGCTAATTAAGTATGTCACTTAGACTTGATTGTCTCATCATTTTATAAAATGAA
ATTTTGTGTTAGAACTTTTCATTTTAATATATACTTAAATAATTTCATATACTATTAAAA
TATGCTAAGAGCTAAGCTGAGATACTTTTTTATACATATATGGTTTCATTGTTTTTCTTT
GTTTTTTTTTTTTTTTTTTTCAGAGTGCTGCTGCTACAGCTGCAACTTTGGCACTCCCTG
CAGGTGTGACTCCTGTTCAACAGATATTAACAAATTCAGGTAGTAAGGAATAGTGAAACA
ATTTTTTAAAAATTTATTTATTTATTTTGAAAGTTGCAGTTAGAGATCTTTAATCTGCTG
GCTCACTCTCAAATGGCCACAGTGGCCCAACACTGGACCAGGCTGAAACCAGGAGTTTCT
TCACAGTTTCCCACGTGGGCCATCTTCCACAGCTTTTCCCAGACCACCAGGAGGGAGCTG
GATCAGAAGTGGAGCAGCCAGGACATGAACTAGTGCCCATATGGATGTCCGTGTTGCAGC
TTAGAAAATTTTATATCAAACTCTTGTTTTGTCTTCCTTGATTGAAAGACAGAAAATACT
GCTATTTCTTTTACCTTTTTGTTTGGGTTATTAGAATAACTTGGAGGGTTTTGGAACATG
CAATTATAATTATTGTTGAAGACACAGTAAAGATGAAATTTCCCCTTGAATTTTTGATGT
GCAATTAAGAACCCTATTATTGAATGAAGTATGATTATATAGAAATGCTTGTTTAGTTTT
TCACTAAACACATTTAGCCTTCTGAGTGAGTTAAACTGGACTCATTTGAACTTAATTTGT
GATATCAAATTAAGTCCTGTATTACCTTAAGAGCAAATTTATTGCATGTTATTACATATA
ACATCTCCGCATTAGTAAAATTCCAGTATCTAGTTCATTATTTTTGGCATACTAGTTGAA
ACATTTATTTACTTGAATATTAATTCTTCTGTCTATAATGCTGATTATACAATTTTTTGT
TATTTTAGTTATTTGTGAAGAACAAATTAGGGGCTTGTCTTATTTTAAATAAGATAAATT
GTTTACTTTTAATTCAAGATTCTGGGTCATCTAAAGTAACAATAGGAGTGAGAGTGTCTA
AGTAATCATGCAGTTAGTGTTATGTGGTGTTGGTAATTGACTCATCAAACTTTTATTGCT
TTTAAGCAGTTTTGAAGTACTCCAGACACCAAATGAACTACTACACTTTTTTTTTTTTTG
AAAGATTTATTTGTTTATTTGAAAGGCAGAGTTAAAAAGAGAGAGATATCTTTCATCACT
AGTTCACTCCCCCAGTGGCCAATTGGCTGGGACGGGGCCAGGCCAATCAGGAGCCTGGAA
CTCTAACTGGGTCCCCTCCCACATGTGTGGCAGGGGCTCGAGCACTTGGACCCTCTTTCA
CTGTTTTCCCAAGTGCATTAGCAGGGAGCTGGATTGGAAGCAGAACAGCTGAGACTGGAG
CACTATTATAGGATGCTAGTGTCGCAGGTGGCAGCTTAACTGTTGTGTCAGATGCCAGCC
CTGCTTTCCTTTTTTCTAAAGCTTTAAAAACAAATAGTCTCTGAAATATCTGATCTTACC
TCTCTTCCCAGACTTTTAAAATCTTAGCAAATATAGGGGGCTGGCGCCGTGGCTCACTTG
GTTAATCCTCCACCTGTAGCGCCAGCATCCCATATGGGCGCCAGGTTCTAGTCCTGGTTG
CTCCTTTTCCAGTACAGCTCTCTGCTGTAGCCTGGGAAGGCACTGGAGGATGGCCCAAGT
GCTTGGGCCCCGGCACCCGCATGGGAGACCAGGAAGAAGCTCCTGGCTCCTGGCTTCAGA
TTGGCGCAGTGCCAGCCGTGGCGGCCATTTGGGGGGTGAACCAGTGGAAGGAAGACCTTT
CTCTCTGTTTCCCTCTCTCACTGTCTATAACTCTACCTGTCAAATAAAAAATTTTTTTTA
AAAATCTTAGCAAATATAATTAAAGCTTTAAATCAAGTCTTGAAATCTATTGATAAAATC
TTAATTAAGGACAGCTGTGAATGAGGATGATCTATTTGAAAAATGAAGCATTTTAACTAA
TGTGTTTGAACTTGGAGGAATTCTGGGGTAAGAAGTATACTTAATGTACATGAATGATAT
TCCCTTTAATAAAACTATCAGACTTCCTACTTGTTAATTTCTAAGACCTTGAGGAGTTTG
ACATGCAGTGCAAATTCGCTCACTTTGAGATGGTCACTGCTAAAGTGGCAACTTGAATAT
ATGTTTTTTGCTTTAGGCCAGCTTCTTCAGGTGGTCAGAGCAGCCAATGGTGCCCAATAC
ATCTTTCAGCCTCAGCAGTCAGTGGTTCTACANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
TTAAAGCCATCAAGGTGGTTCTTATATCCAGTGTCAAGAATCATGAACTAGTCCGACAGT
GAAGTGACAAAAAGCCAGGAGTGGTTAAATGACTTGCCTTTGCTATAGCTATATCTGAAG
CTGCTCTTAGACAAAAGTAGATTGAGTCTCCAGATTCTCAGTCCTCTGTTCTTCGTGCGG
AGCTGGTATAGTATAATAGTGCAGACATGGGCTTTGAGCCAGAAAGTTCAGGTTCAGGTT
TTGCCTTGTAGTGATGGCAAGGTTTGTAAGTTACTACCTCTCTATTCGTCTCAAACAAAT
AAACTAATAACTGTATAAGTCTTGGCCTAGTAAGTACTCAGTAACCAAACAGTTTTGCTT
TGGAAAATCTTTTTCTTGCAGCAGTTTGAATGATAAAATAAAAATTTAGTGAATCTATAC
TAGTTTACCATTGCTTTTGTACTTCATCAGCTTTAACTAAATATGAGATATGGCTGTTTC
TGGTGATTCTTCAACATGTGAGCCTATTTCTTTGTATGGTACTTGATCCTGTAAGTAGTT
CCTAACATGTGGTTTTCTTTTGCCACAGGTATTGGCCCCTCTTCCTGGAGGGATTTCACC
ACAGACAGGTGTCATCATCCAGCCTCAGCAAATCTTATTTACAGGAAATAAGACTCAAGT
TATACCTACAACAGTGGCAGCACCTACACCAGCACAAGCACAGATAACTGCCACTGGCCA
GCAGCAGCCGCAGGCCCAGCCTGCTCAACAGCAAGCTCCATTGGTGTTACAAGTTGATGG
AACTGGGGATACGTCATCTGAAGAAGATGAAGATGAAGAAGAAGATTATGATGACGATGA
AGAGGAAGACAAAGAGAAAGATGGAGCTGAGGATGGACAGGTGGAAGAAGTAAGTTTCTA
GTAAAAATCTTGGAATGAGAATCTGCATGATGATTTCTTATTTTCCTTGTGCCAAACTAA
TGAATTGTATCTTAATTTTTTCAGAGGCTCTTAGGGACTGTGCAACATAAAATTTTAAGA
AAAATAAGATTGTGTGGGTTGTATTCATAAGATACAATTATTTAATGTACTTAGTAATAA
AACATAAAAATATACCACATTAAATCCTAGTAATAAAATAATTTAGTTCGTGAAATTAAA
TCTAAGCATTTGGGTTATTATTAATGTGGCTTAAACGTATGACATTGGTAGAATATGTAA
TTAATCTTTTGCTTCAGTAATTAAAAAGTTATGGCAACATTTGGAGAGAGGAAACTCAAG
AAAAACTAAATATGACAAAATCATTTAAAATTTTCCTTATGGCCCATATTCCATTCCAGT
TTCTTCTGAAAACTTACACATAACCATGTAGTTAAAAAATAAATCCTGTTAGGCCGGCGC
CGCGGCTCACTAGGCTAATCCTCCACCTAGCGGCGCCGGCACACCGGGTTCTAGTCCCGG
TTGGGGCGCCGGATTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTGTGGCCA
GGGAGTGCAGTGGAGGATGGCCCAGGTGCTTGGGCCCTGCACCCCATGGGAGACCAGGAA
AAGCACCTGGCTCCTGGCTCCTGCCATCGGATCAGCGCGGTGTGCCGGCCATTGGAGGGT
GAACCAACGGCAAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTCACTGTCCACTCTGCC
TGTCAAAAAATAAAAAAAAATTAAAAAATCCTGTTACTTAAAGTCTTTGTGCCTCTCCCA
TTGCTCTCATCTTTATTCTGCCATCAGATTATTCGTTCATGCTCATGCATTTTATGTTTA
TCACAATCTTGCCTTTCTATTTTACCAGGGACTTAAATCCCTGAACAGCATTTTGTCTAG
TTTTGGCTTTCCATTTGTAACAAATGGAATAATTTTTTATGTGTTCTACAAATTGTTTTT
AAATTTATGTTCTTAAGGTTCATACAAGATGTTTTATATATATATATATTTATAATTAAT
TTAACTGTTAACTACATTTATTCACCCATTTTTCTGATCTAGTTAGCAATGGAGTCATTT
CTGTTTGTTCCCTGTTGAAGAAGTTACAAAATACACTAATATGTATACTCTGAGGATACA
TAAATAGTGGTGTCTGTAAGTGTGATACCTTAAGCATTGAATTGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCC
AGAATCATTTGTAATTTATTCTTTGATCTCGCTTCTAGTATTGTGGGTGCCTTCTTTTTC
TTCTTTTTTTAATAATTTTTTTCAGGATGAAACTTGATTTTATTTATTTATTTTAAGATT
TATTTACTTATTTGAAAGGCAGAGAGAGAGGGAGAGATCTTCCCATCTGCTGGTTCACTA
CCCAGATGGCCACAACAGCCGGAGCTGTGCCAATCCAAAGCCAGGAGCCAGTAACTTCTT
CTGGGTCTGCCACATGGATGCAGGGGCCCAAGCACTTGGGCCATCTTCCACTGCTTTCCC
AGGCCATGGCAGAGAGCTGGGTTGGAAGTGGAGCATCCAGGACTGGAACCGGCACCCATA
TGGGATGCTGGCATTGCAGGTGGTGGCTCTACCTGCTGTGGCACGGCACCAGCCCTGTTG
TGCCTTTTTACTCTTTTTTTTTTTTTTTTCAGTCTTTCCAGGGATGTTGATTTCATTAGA
ATTCATTTCAGAGAATGAACGTTTAGCTTTGTTTATTCTTTCCACTGTGTTTCCCTGTTG
ATTTTCATTCTGTTATTTTGTAGACCTGTTTTTTTTATTGGACCTATGATGTGTGAATCC
TTTGGAATTGATTGAGTTTTGCTTGATATTTTGTATATGTTCTGTGCATATTTGAAACCT
AAAAATGGGTGCATATAGGCTTAAAATTGTTTTTTTCTCAGTTAACTGAATCACTTATGA
TAATAGTGTCTCACTGTATCTAGTAATGTGTTTATGTGTGTGTGCGTATATATAAAAAAT
ATATACATATATTTATTTAACTATGAGGTCAGTTTTCATGATACTAGTAGAGCAGTACTG
GTATTACTTATCATTGCACCAGCAAACAGTGTTTAATAGGGCAAGAATTGACTTTCTACC
AAAGGGTGCTTAACTGATTATCCATATGAAAAATTGTGAAGTAAGACCCCCTAATTCACC
TCATATGCAAAGATTAAGTCAAAACAAATCAGAGACCCAAATCTGTGAGCTAAAATTTTG
AAACTCTCAGATGAAAACATAGAAGTAAATCTTCAAACCCTTGTATTTGACAATAGTTCC
TTAAGTATGATGCCAAAAGTACAAGCAACCAATGAAAAAAGTAGACATTATAGATTTAAA
ACGTGTGCGTGAAAGGACAGTATCAAGAAGGTAAAAAGATGGCCTACAGAATCACAGATC
ATTTATCTGTTAAGGATCCAGTATCCAGAATGTGTAAAGAACTCTTACAGTTCAAAAAAC
AAAAATCTAATGAAAAGGTGACCATAGGACTTTAATAGACATTTCCCCAAATGACACAAA
TAGCCAACAAGCACATGAAAAAATGCTCAGCAGCATTAGAAAAATGCAAACCAGAACCAC
AGTGAGATACTTCATACACGCTAGATGGGTTTAATCAAAAAAGTAATGCAGTAATTGGAA
CACTGTGCATTGATGATGAGAATGTCAAATCTTGTAGTTTTTGTGGTGGTTCCTGAAAAA
GTTAAGCATAGAATTAGCCATATGACTGAACAGTGTGCAAGATAATGAAAATTGGGTATC
CACACACAAAAAAACTAGTAAATGAATGTTCATAGCGCACTATTCATGATAATCTAAAAA
ATATAACCCAAATGTTCATCAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTCACTTTGTCATAATCTTTATGAAAATAATTCTCCGCGCGTTAGTTTTTAAGATA
CCCAGAAGAAAATATACATAAAGATTTAGATGCATTTGCTATTTGGTTTTCAGAAAATAT
CAAGGTGACTATATTACTTTCATTGACTATTTAAGGGCTTTTTTGTAATACATTGGATAT
AAACATGCAGACTTTCTTTTATTTGTAGGAACCACTCAATAGTGAAGATGATGTGAGTGA
TGAGGAAGGACAGGAACTCTTTGACACAGAAAATGTTGTTGTATGCCAATATGATAAGGT
AAGGATTTTATTATCAGATGACTGATGTTATTTCTGTTGTAGTTTTTTCCCTAAACCAAC
CTTTTTGCCTTATTGAAACATCAAGGTAAGTGATTAATACCTGTTATATTCATTATAAAA
AATGTAAGAACATTGTTATAGGGGGCCAGTGCTGTGGCATAGTAGGCTAAACCTCTGCTC
GCAGTGTTGGCATTGCGTATGGCTACAACTTCATGTCCTGGCTGCTCCTGTGCAATCCAG
CTCTCTGCTGTAGGCTGGGAAAGCAGTAGAAGATGGCCCAAGTGCTTGGACCCTGCACCC
GTGTGGGAGACCAGGAAGAAGCTCCTGGTTCCTAGCTCCATTTGACCCAGCTCTGGCCAT
TGCAGCCGTTTGGGGAATAAACCTGTGGATGGAAGACCTTTCTCTATGTCTCTCCCTCTT
TCTATCTGAATTCTACCTCTCAAATAAGTAAATGAAATTAAAAAAAAAAAAAAAAAAGCA
TTGTTATAGTTTCTTACATTGTTTCACTAGAACGAGATTAATTTTGTATGTTTAAGTTTT
TTTATTTATACTTTTTTATTAAAAAAGATCTATTTATTTGAAAGAATTTGATAGAAAAAT
AGAAGGATCTTCTGTCCCTTGGTTCACTTACCAAATAGCTACAAAAGCTGTGGTTGGGCC
AGGCGGGAGCCAAGAGCCTGGAACTATCCAGATCTCCCATGTGGGTGGCAGGGACCCAAT
CACTTGGGCCATCTTCAGCTGCTTTTCCAGGCACATTAGCAGGGAATTGGATTAGAAGTG
GAGCAGCCAGGATCAAACCAGCACCTATATAGGATGCTAGCACTGAACACTATGAATTAA
CCCACTGTATCAGAATGCTGGCCCCTATTTAGACTCTCGATCTGTAAGTGAAATAAACAA
AACCACTTTGGGGGCATCATCCTTTTTTTGTTAATTCGTTGTTAAAGATTTATTTATTTA
TTTGATAGATGGTTACAGAGAGAGCAGGAGATACTCCATCTGCTAATTCACTCCTCAAAT
GACCATACCATCCAGGGCTGGGCCAGGCAAAAGCTAGAAGCCTGGAACTCCATCCTGTTC
TCCCATATGAGTGGCAGGGGCCCAAGCATTTGAACATTTTCCACTACTTTCCCAAGTGCA
TTAGAAGGGAGCAGAATCAGAAATGGAGCAGCCAGAACTTANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACGGCAAAAGGAAGACCTTTC
TCTCTGTCTCTCTCTCTTACTATCCACTCTGCCTGTCAAAAAAAAAAAAAAAAAAAAAAA
AAAAACCACTTTATTGTCAAGAAATCTCAAGGGAATCATTTTCGACCAAATTACCCTGAA
CACAATTTGATTATAATAAGATGTCAGATTTATCAGTCAAGATAGGACCTCTACCTAGCC
TGACTGAAGAATATGCCTTCTTCTTCTAAGAGAATGATTAATTTCTCCTTTGGCACAAAC
TGTACATATTTTTTAAATGTTAAAATTGTTTAAATGTTAAAATTGGTTTATTTACTACCA
GAGACATTAAAGTTTTAACCAATACACTAAAAATAGCTTTAAATGGCATGTTGAATGATG
AATAGTTTTAAAGTTTGCGGAGTTGTCTTTTTTAAGAATCAAATGACTGGGGCCAGTGTT
GTAACGTCGTGGGTAAAGCTACCACATGTAACATCATCATCTCATACGGGCACTGGTTTG
AGTTCCGGCTGCTCCCCTGCTAATCTGGTTCCCCACTAACTGTGGCCATTTGGGGAGTGA
TCCAGTAGATGGAAGATTCTCTCTGTCTATGTGTATGTGTTTATGTTTGTCTCTTCCTGT
CTCTTTCTGTAACTCTGCCTTTCAAATAAATCTTAAGGAATGAAATGACTGTGTTCAAAG
GTTTTAAGGATTGGAGGGCTTGGGAGCTTGCTGTTTTAGCCAACAGTAAAGAATGGTAGT
GCTCTGGAGTTGGATATAGCTTGAACCAACTTGAATTTTAAGAGTTTAGTTTTGAAACCT
AAACTTTAGAGTTTCAATAATGAGTCAATTTTAGAAGAAATAAAGTTTGTATTGCCAGTC
AAATCAGAATCTTAGTTAAATGCTAATATAGTAGCAAAATTCTCACATTACTTAGTGTAG
ATAAGGAGATACAGAGATCTTTCAACTGCTGGTTGACTCCCCAAATATCTGCCATGGCCA
GAGCTGGGCCAGTCTGAAGCCAGTAACCAAGAGCTTCTTCCAGGTCTTCCACACGGATGC
AAGGCCTCAAGCACTTGGTCCATCTTCTGCTGCTTTCACAGGCCATAATAGAGACCTGGA
GTGGAAGAGAGGAGCAGCTGGGACATAAACCAACATCCATATGGGATGCTGGCTCCACAG
GTGGATGCCAAGCCCACTATGCCACAGCACTGGCCCTCTATTTCACTATAACACATTTTG
ATTGAGAAGTTTAAGAGGCCTTTCTCCTGGCATATATAGGACATTACTTCATGAAGTAAA
TGCATTGCTTTTCAAGTTGTATTTTCTACATTTCTTCAAATTAAAATATTTATCATCTAC
TACTCAGTGAGATTTCAGGGCTGAGTATTTGGACTATTATTTAGCCCATGGAACTTTTCT
ACATTTTTTTTGCTGGTTGCCCTGCAGTAATCAATTTCTTGTCTGTGGAATTTCTGTTCC
TTGGCTACTCATCACTTGTTATTTTTGTCTATATAATTTCAGTATCTTTCAGGTTGCAGT
CATTAATTTCAGGCTGGAAATGAATTTGCATGCATAGGTTTGGGATATTTCTATATAGGG
AATCAAAGAAAAGGAGAGACAGAGGTCTTTTTCATTCAACAAGAACTCAGGAGTGTCTAA
GGTGTCCCAGGACATTATTCTATGAGCCTGAAATACACTAGTGAACAAAGCGAAACAACA
TAATCCCTGTGATTGAGAAGTTTACTCTCATAAAGTGAGACATGCTGGGGCCAGTGCTGT
GGCGCAGCAGGTTAATGCCCTGGCCTAAAGCATCAGCATCCCATATGGGCGCTGGTTCTA
GTCCCGGCTGCTCTACTTCCAGTCCAGCTCTCTGCTATGGCCTGGGATAGCAGTGGAGGA
TGGCCCAGGTCCTCGAGCTCCTGCACCCCTGTGGGAGACCCGGGAGAAGCTCCTGGCTCT
TGGCTTTGCATTGACACAGCTCCGGCTGTTGCGGCCATCTGGGGAGTGAACCAGCTGATG
GAAGACCTCTTTCTCTGTCTCTACCTCTCTCTCTTTCAAATAAATAGAAATAAATCTTAA
AAAAAAAAAAAAAGAAAGAAATGAGACAGATGCTAAAATATAATTGATTAATTCATTAGT
ATGGTACATTAGAAACTGGTAGTTTGAAAAATACTACATAGGGAAGGGGTGGGGACAGGT
TTCAGTTTTAAACAGAATAATCATAGTAGTTCTTTCAAGAAGGTGGTATTTGAGCAAAAA
GCTAAAGACAGTTAGCTCCTCTTGTTATCTGTTGGTATAGGCTGCCAGCTGTGTGTGAGA
AACTGCAAGGACAAAACTTGGCTGGACTGGAGTAGGAAGTTAGTACGGTAGTTAAGTCAG
GTGGTGTGAGTCTTTGTGAGGACATGGACTCTTAACCCACTTGAATCAGAAGTCTGTTAA
AAGGTTCAAAAAACAAGAGGTATCATCCAATTTAAATTTTAAAAAGATTACTTTGCCTTC
TTTGTTGAGAATAGTTGTAGGGAGGAAGCAAGGGTTAAAACAAGGAGTCTATTTAGACCA
GGATGTTGTAATAATCCAGGTAAGTGATACTGTGACTCATACTATGGTGATAGTATTCAA
ATTGGTGAGAAGTGTTTGGATCTTGGACTTACATTGAAGGAGGAGTCAGTAAATTTTCCT
GACTTCTTGGATGTATGATAGGAAAGAAAAAGAGAGGGTAGATATTTGGTACAGCAGTTA
AAACACCTACATCCCATATTTCAGGGTTTGTGTTCCATTTCTGGTTCCACTTCTAATTCT
AGCTTCCTGCTAATGCCCACCCTTAGTGCCAGCAGGTAATGTCTCAGGTACCTAGATCCT
AGCCACACATGGGAGACTGGATTGAGTTTCAGGCTCCTGGCTTTGGCCTGGTCCATCTCT
TATTGTCAGCATTGGAGAAGTGAACCAGTATATGGAAGCGACCCTCCCTCTCCCACACGC
GCCTTTCAAATAAAATGAAAGCAAGTGTAATGATAAATATGTGACATTTAATATTTTTTA
AAGATTTATTTATTTGAAAGTGTTACACAGAGGAGGAGAGACAGAGAGAGAGAGAGGTCT
TTTGTCCTCTGGTTCACTCCCCAATTGGCCGCAACGGCCTGAGCTGTGCCAGTCCAAAGC
CAGGAGCTAGGAGCTTCCTTTGGGTCTCCCACTCTGGTGCAAGGGCCCAGGGACTTGGGC
CATCTTCTACTGCTTTCCCAGGCCATAGCAGAGAGCTGGATAGGAAGTGGAGCAGCTGAG
TCTCGAACTGGTGCCCATACGGGATGCTGATACTGCAGGTGGCGGCTTATATCGCATTAC
GCCACAGCACTGGCCCCGATATTTAATATTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTGGATAGAAGATCTCTCT
TCTGTCTCCTCCTCTCTCTGAACATGAGAGTGATTTTTAAATACATGAAGTGTTGTTTTA
AAATCTCAAAAGGCAGAACTAGTATCAGTTAATGGAAGTTGGAAGAAATATTTCATTGAG
TAGTAAAATATGAAAGACTGAAAAAAAAAAGAGCATTCCCAGAATGGAGCAGCTTAATTT
GGAATTTCTTTGCTTCCCCCTTCCCTCTTCTCTAATTATATCCAAGCCAGCAATAAATAG
CCATTTGCCAAGAATATGCCATAGTGACCGTTTGGATTGTACTGCAAGGGTAGACTGTGG
AATTTTAAGAACTGGATCGCAGAAAATACCTGTAGGTGGTGAGCATTTCTGCATTATCAT
ATGAAACAGACTGATATAGTAGGAAGAGTATTAGACCAGAACTTGAAGATCATCTTTGTC
ACCTGATAGCAATATACCCTCGGTCAAGTCACTGAACCATTCTAAGCTATAATTTCTTTC
CTTTTGGAAAGTGAATGCCTGAACTAGTAGATTTTGAAAGGTACCTTAATATCATAGAAT
AGGGAGAACTGTGGGGCCTTGATTGCAGAAGATGTGCAATTTGAACTAAGTGATTTCAGT
ATTTTGGCTTAACTGTGGATATAGTTTATTGAAATAGGCTGTAAATCACTGGATGATTAG
TATTCCTTCAGGTGTATTTAAGTACTACAGTGCATAAAGTTGTATGTTAGATTTTGAGAA
TACTGGAAAGAGTTTTATTTTGATAGAAGGAATCCGGTCACAAATTTGTTGTTGTTGTTG
TTTCTACTTTTTAAATTGTGTAGTAGTAGAAATTCTGTATGTAGCATTACTTACAGTTAA
TTCTAGAAGTTGCCTTTGTGATTTTATTAGTTAGAAAAAGTTTCAGCTGCTGAGATTAGG
GAAAGCTTTTGTGGAAGACACTGTCACTGTATTTTTGAGGTTGACCCTGGAAGTGTATAT
GCAGGGCCCGCTCTGTGGCTTAGCAAGTAAAGCCACCGCCTGAAGTGCCGGCATCCCATA
TGGGCGCTGGTTTGAGTCCCAGCTGCTCCGCTTCTGATCCAGCTTTCTGCTATGGCCTGG
GAAAAAGGTGGAAGATGGCCCAAGTCCTTGGGCCCCTGAACCCACATGGGAGACCCGGAA
GAAGCTCCTGGCTTCGGACTGCCGCAGCTCCAGCCATTGTGGCCAGTTAGGGAGTGAACC
AGTGGATGGAAGACCCCTCTCTCTCTGCCTCTCTTTCTCTCTCTGTGTAACTCTGACTTT
CAAGTAAATCTTTTTTTTTTTTTTTTTGACAGGCAGAGTGGACAGTGAGAGAGAGAGACA
GAGAGAGAAAGGTCTTCCTTTTTGCCGTTGGTTCACCCTCCAATGGCCGCCGCTGCAGCC
GTCGCACCGCGCTGATCCGATGGCAGGAGCCAGGAGCCAGGTGCTTTTCCTGGTCTCCCA
TGGGGTGCAGGGCCCAAGCACCTGGGCCATCCTCCACTGCACTCCCTGGCCATAGCAGAG
AGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCCGGCGCCCCAACCGGGACTAGAACC
CGGTGTGCCGGCGCCGCAAGGTGGAGGATTAGCCTATTGAGCCACGGCGCCGGCTTGAAC
AGACTTTTTAGAGAAGAGCAAATGGCTCTTAAACACATCTGTATGGAAAGATGCCCAGTT
TTACCAACAATAAGGGAAATATAATGGAAACTATATTATGATGACATTTCACACATATCA
CATTGTCAAAAGTTCACAAGTTTTGTAACATACTTTTTTCCTGAGGCTATGGAGAAAAAT
TCTCATCTATTATTACTGGTGGGAATCCAAAATGGTGTAATTGCTAGGAAGAATATGGCA
ACAACTAGCAAAATTACACATGCATATGACAGTCTCTTGTTAAACTTTGTTAGACTCCTC
TGAGCCATCATCTCAACTAGGTCAACCTCTCAACCTTAGGCTTACATCTCCATCCCTACA
GAGTCCAATTTTAGCAAAAATCCTTAAGCCAGTTTACCCAAAATCCACCCCTTAGTCCCC
GATATCTTACTTTGGATAACCAATTGGTTTTCTGTCCTCTGCAACCTCCACACCCACCCC
ACAGGTGTTTGATCACTGTGGCCTGTCTTCAGTAAGGATCCTATTGTCTTATCCAGAGGT
TTCCCCAAAATAATCTGCTGCTCAATGATCCCTCACCTTTCTCACTGATTAAATTTCCAT
TTGTTCATACTGTGTTCAGAGTTGAGTCTAATCTCTCTTCTCTACTGCAAAATTCCACTG
CAGTGGACCCTGCACCCATCAAGACAAGCCCTTCAACTCTGGAAAAAAGTCTTCCTTACT
TTGCTTTAACAAGTATCACTGGGGGCTGGCGCTGTGGCGTAGCAGGTTAATGCCCTGGCC
TAAAGCGCCAGCATCCCATATGGGCACCAGTTTGAGACCTGGCTGCTCCACTTCCAATCC
AGCTCTCTGCTGTGGCCTGGGAAGCAGTGGAGGATGGCCCAAGTCCTTGGGCCCCGCACC
TACGTGGGAGACCCACAAGAAGCTCTTGGCTCCTGATAGGTGCAGCTCTGGCCATTGGGC
CAGCTGGGGAGTGAACCATCAGATGGAAAGCCTCTCTCTCCCTCTTTGACTTTCGAACAA
ATAAATAAATCTTTAAAAAAAAATCAATGGACTTTTTTTTTCTGTAACACTATATAAGTT
TAGAAACATGTAAATATTTTTGTATTTGTAAATATACAAAAGAAAATCCTTGAAAACTGA
AAGTAAAAATGAAACAAATGAGAGGAAGACATTTGGTGTAGCAGGTAAGACACCGCTTGG
GGGCTAGCACTGTGGCAAAGTGGGTTAGGCCGCTTCTTGCAATGCCCACATCTTTTAATC
AGAGCAATGATTCTGGCCCTGGATGTCCCACTTCCTATCTAGATCCCTGCTAATGCCCCT
GGGAAAGCAGTAGGAAGGCAGTAGATGATGTCCCAAATACTTGGGCTCCTGTCACCAACA
TGACAGATGGGGATCTTGGCTTTGGCCTGACCCTGGCCCACCTCTAGCAGCTGCGTCATA
TGGGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAAGAGGACAGAGGTTCTTCTATTCTAAGATTTTTCCCG
TAATTTAGCAGAATATGCCCAGAGCCCTGGAGTTAGATCCTCACTCACTTTTTCTTTGTC
TCCTCTTTTGGCTGGGGACGCCCGGGTCTAGACCATATTCAGTTCGTGGCCCAGGAAGGA
ATAGTTAGCCAAAGTTGAATCTCCCCATGCAAAACGCAAGCCACAGGACCGGCAGAACTG
ATATCATCGCCACAGTGGTTGAATTCAGGTCTCCCATGCCGGTGCAGGGGCCCAAAGACT
TGGGGCATCTTCCACTGCTTTCCCAGGCCACAGCAGAGAGCTGGATCGGAAGTGGAGCAG
CCGGGTCTCAAACCAGCACCCATATGGGATGCTGGCGCTTCAGGCCAGGGCGTTAACCCA
CTGTGCCACAGCGCCGGCCCCAAGAATGTGTTTCTTAAATGCAAATACTTTGGGGCCAGC
GCTATAGCATAGCAGGTAAAGCCACAGCCTTCAGTGCCGGCATCCCATATGAGCACAGGT
TCGAGTTCCTGCTACTCCACTTCCAATCCAGCTCTCTGCTATGACCTGGGAAAGCAGTAG
AAGATGCCCCAAGTCCTTGGGCCCCTGCACCGGCATGGGAGACCTGGAAGAAGCTCCTGC
CTTAGGATTAGCACAGCTCTGGCTGTTGCAGCCACCTAGGAAGTGAACCAGTAGATGGAA
GACCTCTCTCTATTTCTTTCTCTGTCTCAGCCTCTCTGTAACTCTGCCTTTCAAATAAAA
CAAAATAAAAATCTTAAAAATACTTCTAGGGGCCAGGACTGTGGTGTAGTGGACTAAGCC
TCTTCCTACAGTGCTGGCATCTACTGGTTGCTCCACTTCTGATCCAGCTCCCTGCTAATG
GCCTGGGAAAACAGTGGAAGATGGCCCAAGTGCTTGGGCCCCTGCACCCACATGAGGGAC
TCAGAAGCAGCTCCTGGCTACTGGCTTCCGATTGGCCCAACAGCAGCCATCGCAGCCATC
TGGGGAATGAACCAGAAGATGGAAGACTTCTCTATCTCTCCTCCTTTCTGTCAATAACTC
TGCCTCTCCAATAAATATTTTTTAAATAAAAGCAAATACTGCTATTAAAAATGTTTTAGC
ATTTTTAAAAAAATTATTTATTCGAAAATCAGAGTTACACAGAGAGGAGAGAGAGAGAGC
TTTCACCTGCTGGTTTACTTCCCAAATGACCGGAAGAGCTGGGCCTCGGCCAGGCTGAAG
CCAGGAAATTCAAGCAATGACAATTAGAAAGTGGATACTAGAAACAGTCTCTGCTCCTAC
TCCCAGTTTCCAAAGTATTTGGGGCCATTGAGGATCAAGCTGTAGCTCTTCAATGGCTAC
AGATCAGTTTCCTGTAGCTAATGAAGCTGGGCCTGTAACCAGATCCCATTTGACTGGAAG
CACTAAATCAGATCTAGCCATATCCTACTTGTTTAGAGTAAAGTCTGTCATTAACTAGAA
TTTAACAAGAGAATAAATCTTAATATTTGAATATTGGAAATACCATCCAGGAAACTGGGA
TGTAGACTTGGAGTAATGGCCACAGAAGAAATTCACAACGGCAAACTAGAACCAGTTGTA
TTTGTCATGGATTAAAATGGAGGACATGTGAAATCTACACGGTGCTAAACAGATTTTCAG
GAAATTAAGATGAAAGAGTTTGCTCTAGAAAATATACTAGCACTAAAAAAAAAAAAAAAA
AAAAAAAAGCCATTTACTGGAAGGAAGAAAGAACTCTAAAAAAAAGAAAAATTAATTAAA
AAATTTTTAAAAAATTAAAAAATACTAGCACTAAAAGTTGCTTTAGGTATCTATTATTTT
TAGTATGAATTAAATATAAACTGACAGTGAGTTTATTACTTAACCTTGTCATGAGAAAAT
TCTGAGCTGTTCTAAAAGACAAGAGGAAAATGAAAGGAAGGAAAGAGGAGGAACTACATC
GGGCAGAGGGGTGAGTGTAGAGAATGGGAGAGGAGAGCACTTTCAACAACTTCCCCCAAA
AATGGGGTGGGTGCCTAACCACTAGGCTAAACATCCACTCTAGTATGTGTATGTGTGTGT
GTGTATATATATATTTTAAAGACTTATTTATGTATTAAATAAGTCACAGAGAGGCAGAGG
CTTCCATCTGCTGATTCACTCCCCAAATAGACGCAACGGCCAGAGCTGGGCGGATCTGAA
GCAGGAGCTTCTTCCAGGTCTCCCATGTGGGTGCAGGGGCCCAAGGACTTGGACCTTTTT
CTATTTTCTGAGGCCATAGCAGAGACCTGCATTGGAAGTGGAGTAGCCAGGACTTGTACC
AGCGCCAATATGGAATGCCAACACTGCAGGTGGTGGCTTTACCTAGTACGACACAGTGCC
GGCCCAAGTGTGTATTTTGATTATTGATCTGGAAGAAAAGTAAGCCAAGACCATTTAAAG
GATGTGAAAAGGGTAAGAATGAGAATGCTAAAATCCTATCTGTCTCAATAGGAATGCAAA
AGGCAATGTTCAAATTACTCAAAAATGTACACATTGTTTAGAAACATAGCTGTAAAAAAT
AACAGAGTTCAAAGAAGATGTTTAAAGAAAAAGGAGTGGGAGGGCTGGCGCTGTGGCACA
GTGGGTTAACACCCTGGCCTGAGGTGCCGGCATCCCATATGGGTGCTGGTTCTAGTCCCC
GCTGCTCACTCTTCTGATCCAGCTCTCTGCTATGGCCTGGGAAAACAGTAGAAGATGGCC
CAAGTGCCTGAGTCCCTGCACCCACATGAGAGACCCAGAAGAAGCTCCTGGCTCCTGGCT
TCGGTTTGGCTCAGCTCTGGCCATTGTGGCCATCTGGGGAGTGAAACAGCGGATGCAAGA
CCTTTCTCTCTCTGTCTGTAACTCTCTTAAATAAATAAAACCTTAAAAAAATGAGTTAAG
GGAGAGGAACTGGCAATTCACAGAAGTAATCCAAATGGCCAATAAATAAATGAAATGAAT
ACAATCACATATTGTTTCACATACAACAGTGAGCCAAATTATGAGGTCAGGCAATTTCAA
GTAATGGAGAGAATATCACACAGCGAGAACTCTAACTGCTGAGGAAGGTGTAAATTGATC
CAACCTCTTTGGAGAACAATTTAGAAATTATTTAGTGAAGTTAAAGATATACTTCCTCTA
TGATTCAGCAGTTCCACTCTACATATAGACTTCTAAACTGAATCACTGTAGTAGTGAAAA
ATTAACAACTTAAATGTCCACGAATAACAGATGTTAGGATTTGACATAACTGGGTAGGGG
TGAATAAGTAATAACATCATTATTAATAGCTAACATTTATTTATTAAGTATTTAATGTGT
ACCAGAAACTTGCCTAAGGTCTTTTCCTATGAGGCAAATATTAGTTTTATCCCCATTTTG
TTGGTGAGGATATGAGAGACAGAAAGGTTATGTAAGTTAGCAGCTAAGATCACACAGGTA
GTAAGTAGAGAAGTGGCTGGTTTGACTTGAGCCCCATTCTTACAGTTATACTATATAGGT
AAGCCATTCTCTATACTTTTTAGAGAACTCCATATTATTCTCTGTACTTTTTACTATGCT
TGAACCATCTCATGATAAAAATTAAATATTAATAAAATAAAATGTATAAATTCCAAACAT
TTGTGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GATCCGATGGCAGGAGCCAGGATCCAGGTGCTTTTCCTGGTCTCCCATGGGGTGCAGGGC
CCAAGCACTGGGCCCATCCTCCAACTGCACTCCCTGGCCATAGCAGAGAGCTGGCCTGGA
AAGAGGGACAACCGGGACAGAATCCGGCGCCCCAACCGGGACTAGAACCCGGTGTGCCGG
CGCCGCAAGGTGGAGGATTAGCCTACTGAGCCACGGCGCCGGCCCCAAGTAAATCTTTTT
TTTAAAAAAAGTGTATATGCAAGCCTGGTAGGATGTATTTAACAGAGAAATATTAGCTAC
TTTAATGAACATAAGTTTGAGAAGCTATAAAAATAAAAATTACAGATAAATTCATTACTT
GTTTAAAACCCACCTACTGAGAGAATTTTGTTTTGTCAAGTTAAACTTTATTAAGAAACC
AGTATCCAAATATGGTCTTATATAAGACAGTGTTGCAGGATTTTGTAAATGGATTTTTAT
TGTCCTTAGTTTTCTCATTGTGTTTCTTATACTCTTTAAATTTTGTTTTTGTTTATTTAG
ATACATAGGAGTAAAAACAAATGGAAGTTTCATCTTAAGGATGGCATTATGAATCTTAAT
GGAAGAGATTATATATTTTCCAAAGCCATTGGAGATGCAGAATGGTGAAGAGTCGCCTCT
TTTCTTTTATAAATAAAACAAAAGAAACTTAAAAAAAAATTTAAAACAGACGGTTTGAAA
CTTGGGACATAGACCAACCAAAATTTCACTTCTGCATGTCAGAAAAGTGCAGTAGAAGCA
AAGCTACTGGAACAAAGATAGACCTTGACAACATAGACACTACTCTAACTGGCAAGCCAT
GGAACTGTAGCACCTGGGGTTGTTGGGGGGTGGAGGGGTGGGGTGGGTTTTGTGTAGGAA
AACCATAACTGTTGATTTTAAATACAGGTACCTGCCACTGGTAATTAGCATGTAAAGCTT
TCTCTATATTCCTTCCTCCAACTTGGATTCAATCAGAAGATAACTTGTTGGAATGAACTG
AAGAAACTTCCCTTTTGATAGATTGAATTGAAACTGCTTATTGTATGTGGTTATATTTGG
TAAAAATTGCGTGTGAGGTTTTTACAAAAGGGTAAGAATTACGGTGTTGAATTTTAATTC
ACTTGTATAAGAAAACAATTTAAAACTCATAATAGGTCTTAAATATTTTTACTTGCTGTT
CTCCCTCAATAATATATACCTCTTCCTTCCTGGCTTAATGAAACAGCTACTTATATTTAA
AGGAGGTAATCAGTGATCACAGTTTAAAGAAAGAATTTGACCCAGGTATGAATATTTTAA
TTAGGTTTTCAGACTTATTAAATGCAGTTTGATGACATGGGTCTTGACTGTGTTGAATGG
AATTAAAATGACAACTTTAATTTCCTTGCCAAAAGTTTATTTCTTTTAGTTACCACCTTA
AAAAGAAACCCCAAATTGTCTCCTCAGGAATACACTTTTTTGACAGAGGACCATCTGGTT
GAGTTGTATTGCACATGAGCGTTGGCCGACTTTCCTGTTGGCTCCAGTATGTGCTTACAC
ATGTGTTTAGTCTTTTCCCATTCAGATAACATTCTGTGCGTTGAAGCATAGAGCAGGTGA
TGAGGACCTAGATTTTTATTAGAAATTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 3332..3396, 5303..5378, 7396..7529, 8848..9168, 14128..14217, 29820..29927
1001..1205, 3332..3396, 5303..5378, 7396..7529, 8848..9168, 14128..14217, 29820..29924
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved