Oryctolagus_cuniculus Locus FAM96A
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus FAM96A
Oryctolagus_cuniculus
FAM96A
GeneScaffold_4575
SNORA38
6433..6564
14494
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCA
GCGTCAGAAGACTAGCTCCCTCACAGAGCCTGCGAGAGATTTCAGGGCAGAGACCCTGTC
CTATCTCGGCACCTACAGATCGCATCTGACAAATTAAGTACCCAATTCATAGCTGAGATT
TAACTGGAGGACGAGACGGATAAAATAACATCATCAACTATGTTAACGGCATCCATGACA
ACACGTACACCAGATGGCTTGAGACGTCCTTTTTAGCATAGCGAACTCCATTCTGTCACC
GTGAGTGCAGAGAAAGTCCTCTTAGCTCTAAGTCGTCTTTAGAGACGATTGACAGAAATA
TTCAGCCCACAGTGATGAGCTGGGCTGGACTGAGTCCCTAGGAGGCGAGAAAACCAGAGA
TCCACCATGCCTAACTGTCCTTACTGGCCTCCCCGACATCCCATTTCACCGCAACCGGAA
ACCCGCTTCTGGCCTGATTAGGAAGACAGACCGGCTGGAAGCAGCTCCCTCCGAGAAGTA
ACTGTAAATAGTCTCCGTACTAGAAACCACTCTCCTTTCCTCTACCTCTTCAGGATTCAT
CTTTAGCTTTCTGTGGGCACTGATCAGGCGGTGGGTGACAGACCGTTACACGCCCACTCG
GAGGAGGAAACTCCAAATCCCAGAATACTGTTCGCCGTATTCCGAGGAAAACATCCCATA
CATCCTAGCGCGCATAGCGCCAGCTGGGTCACGCGGATTGTTTTTTTTTTCTTGCTGCGC
TGAAGCCAAGCAAAGCATGCTGGGGTTTGTAGTCCTTGCGGCTCCCTTCCCTAAGTCTTT
CGCGCTACTCCGTCGAGCCCCGCCTCTTCTCTGCTCCTTTGACCCTTTCTTTAGACTAGT
GTTAGCCCTTTTGAAGACCAGGAAGTTGCTAAATCCCGACACCGGCAGCTGAGAGACGGT
GGCTCGGGTGGGACAGTCGCCAGGGATGGCGGAGCGTGAGAATGGAGCGGGTGTCCGGGC
TGTTCTCCTGGACGCTGAACAGAGTCCTGTGGCTCTCAGGCCTCTCTGAGCGGGGAGCTG
CCCGGCAGCCCCGGATCATGGAAGAGAAAGCGCTAGAGGTTTATGGTAATTAACTTTACG
CAGTGCAGCATTTGGTGGTATATGTAGGCGCGGGGGCGGAGGACGGGCTGGGGTGGGGGA
GAAGGGCCTCACCTGAGGGTGTGGGAGTGACACTGGGGTTTTAAACGGGATCTCGTCGCT
AGCGAAGAAAGCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCACACCAGCTCTTGCTGTCTGTCTACAGCTGCTCTGTTGGCTTCTCTGTGGGGT
GGGCAGAAGTCCTGGGGAGGGGCTATTTTTTGAGGCAGTCTTCTATTTAAGAGGATATAT
TCCCAATATTTTGAGTCAGTTCACAGTAGATAAATAGGTCTCTGTGACAATTTACTTTGT
TATAAAGAATATAAAGGGAGTTTGTTTTAAACCAAATGTTCATCAGTAGGGAGCTGATTA
AATAATCAGTAATGGTAAATGTGACCAATGGAATTCCATGCAGTTATAAAAAAGGGTAAA
GAAGCTCTCTATATTGAATTTATTTTTAAGAGATTTATTTGCAAGTTAGAGTTACAGAGA
GGGACGGAGAGACAGAGATCTTCTGTCTGCTGGTTCACTCCCCTGATAGCTGCAATGGCT
GAGGCTGGGCCAGGCCAAAACCAGGAGCTTCTTCTGGGTCTCTCATGTGGATGTTGGAGC
CCAAGCACTTGGGCCATCTTCCGCTACTTTTCCCAGGCGTTAGCAGGGAGTTGGATCAGA
AGTGGAGCAGCCAAGACTTGAACCAGCGCCCATGTGGGATGCCAGCATTGCAGGCAGCAG
CTTTATCCACTACACAACAGTGCCAACCCCTATTTGTATTTTATTTCATAAGCATAAAGA
ATACGTAAGAAGAGAATTGCTGTGATGGATATTTGGGGTAATGGTGGTAGGAACTGGGCA
TGTGAAGGACAGGGTTGAGGAATATTTTTGTATGTTTAAAATTTTTGGGCCAGCGCCGCT
GCTCACTGGCCGGTGCCGTGGCTCACTCAGTTAATCTTCCACCTGCGGCGCCAGTACCTG
GGGTTCTAGTCCCAGTTGGGCGCCAGATTCTGTCCCAGATTGCCCCTCTTCCAGGCCAGC
TCTCTGCTGTGGCCCGGGAAGGCAGTGGAGGATGGCCCAAGTGCTTGGGCCCTGCACCCC
ATGGGAGACCAGGATAAGTACCTGGCTCCTGCCGTTGGATCAGCGCGGTGCGCTGTCCAC
AGCACGCCGGCCACGGCGGCCATTGGAGGGTGAACCAACGGCAAAAGGAAGACCTTTCTC
TCTCTCTCTCTCTCACTGTCCACTCTGCCTGTTAAAAAAAGAAAAAAAAAAAGTATTTAT
AAATTAGGGTATATTTCTCTTTTAAAGTTGCAAAAAAGGGACTGCCAAAGATATATTTGT
AGAGTTTTTTCTTTTCTTATTTAAATGTAAATTCTTCATGTATTTAGCACATAATTTGAA
TTAGTAACATCAGAGAACAGCATACCACATTAATCCCAGTCTCCCAAAGATAGACACGTT
CGAGTTTGTCAAGAAATGCTATTTCAGGAACAGACACCACATAGTTACTAAACTGCAAAA
GAGGTCATTTTCAATTCCAAAAGATGTTACAGATAAAATCTGGCTTATTGCTCTTGATCT
TCTTTTTTTTAAACTGAGTATATTTTCATACAGTTGCATACAATTAAAATAATACAATTC
TGAAAATTTTATCAGTGTACTAACATATATTTTCACTTAAACTCAATTTTGTCTGATATT
CATATTACTCCTTCAGCTTTCACTGATGAATATTTACCAATTATGTTTCAATATATATTT
TAACTTTCAACCTTTTTGGGTGCTTCTGTTTTACATGGATTTCCTGTTTAAAATTAAAAA
AAAAAAAACAAAAACAAAAAAAACACACCACAACAGTGGGTATTTGGCCTAGCAGTTAAC
ATGTCAGTTAGGAGAACTATGTTCCTATCAGAGAACCTGAATTTGAATCTAGACTTCTCT
CCTGATTCCAGCTTCCTACCAGTGTAGACCCTGGAAGGCAGCAGGTAATACTCAGGTAGC
TGGGTCCCTGCCAACCACATGGGAGACTAGGGCCGATTCCCAGCTCGTGGCTTCAGCCTG
GCCCAGCACTGTCATTATGGGAATTTAAGAAGTACACCAGCAGATTGGAGTGAACCAGTC
GATGGGAGATCACTGTGTCTGTTTCTCATCCTCTCTTTCTCTCTGCCCCTAAAATTATAT
ACATACACACTGAAGTTTACAAATACAGTCTCACAATCATTTTCTTTCACATGGATAGTG
TAGTCCATTTACAAGGTTGTCAAGACTTACATTTGGATTTATATCTAACATCTTATTTTT
ATTGTTCTCCTTTTCTAAATGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAGAGAGAGAGAGAGAGCTTCCATTCTTTAGTTTACTCCTGAAAT
GGCCTTAACAACCAGATCTGGGATAGTCCAAAGCATGAGCCAGGAACTCTGTTGTAGTCT
CCCACATGGGTGGCCTGAGCACTGTCTTCCCAGGTGCATTAGCAGGGAGCTGGATCAGAA
GTAGAGTAGCCAGGACTTGAACCATACTCCAGCATGGGATTCCCATGTTATTATAAGCAG
CAGCTTACCCTGCTACACAACACCTATCGCAACAAATTCATTTTTTAAGATTTATTTTAT
TTGTTTGAAAGGCAGAGTTACAGAGAGAGGGAGAGATAGAGAGATCTTTGATCTCCTGGT
TCACTCCCCCAGATGGCCCTAATTGCTGGAACTGGGCCAGGCAGAAGCCAGGAGCCAGGA
GCTTCTTCTGGGTCTCCCATGTGGGTGCAGGGGCCCAAGGACTTGGGTCATCTTCTGCTG
CTTTCCTAGGTGCATTAACAGGGAGCTGGATTGGAAGCGGAACAGCTGGGCGCCCATATG
GGATGCCAACATTGCAGGTGGCGGCTTAACCCACTATGCTACAATGCTGGCCCCAACAAA
TAAAATGTATTTAAATTATAAAAGTAACAAGTTTATTAACAATAATTTTGAAGCTGTGCT
GAACATAAAGGAAGAAATAAAACCTGTTGTCATGAAAGAACGTGTGCCCTGGGCTGAATT
CCAGTTCTAACAGCTCTGCTGTGTTGTAGCCGTGGGCAAGTTACTTAACCTCGCAGAGTC
TCAGTTTCCTTATCTGTAAAATTGGGACAGTTAAAGGTTACCTACAGAGTGGGAAGAGCA
AAGTCAAAAGCTTGCAATATATGAAAAATGTTGTTTTTTTATCATTCACTATGAGCTTTC
TATTAGTCATACAGTTTAAGTACACAGTTACATGACACATAATCAAAAAGTTCATGCAAA
ATGTATATCATTTTCAGAACTGGGGACAAGCGTTTGGCGCAGTGTTTAAGACCCTGCATT
TTGGAGTGCCTGGGATGGGATCCTGGCTCCACTTCCAATTCCAGCTTCCTGCTAATAAGC
CTCCCTGGAGGCAGCAAATGATGGCTCAAGTGCTTGGGTCCCTGCATCCATTGGGTAGAC
TTGGATTGAGTTCCTGGCGCCTGGCTTTGGCCTAACTGCCATTTCTATTGTGGGCATTTG
GAGAATGAATGAATGGATGGAAGATCTTTTTCTTTCTATCTATCCTTTCAAATGAAATGA
AAATAAATAATAAAATTAAACAAAAGCTATGAATAGACTTCAAAATTTTTTGCACCAAAA
CATTTAATTCAATTTTTCTGTGAACCTTTTGAAGTTCCTTCTTATAGTTACATGTCATTC
TTCTTGATATATCATAAGTTTTGCAACCTTTTAGACTATTTCTAGCCTTTTGCAATTATA
AATAATACTATGACTGTTCTACAGAGTCATATCTGTGGCTTCCTGTCTTTTAACACATGA
AGAATTGGAGGCAAAGAAATGAGTACTTAGAGAAGTCTGGGACCAGCATGTTCCCTGTAA
TCGCAAGGTCAACCGTCCTTGTAGAATGAATGAATAATACTGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTGAAATGTAAATAACCCTATGTAGGAGGACTAAGATAAGGTTCTGGTCAGCATT
TCAGACACGTACACTGCCCAGAGTTTGGTCACTTCTGTTGGTCCTTTGATAAGGGGTTAA
GAGCGTAGGCCTTTTCGAGAGTAGTCTAATGGTCTGTCGCAGTAATCGTGTCCCGTGAGC
CCCGCTGCCGAGCCCGGTGAGGAAAGCTGGCTTTCTGGCTGGCGTGCCGAGGAGCAGGTC
GTCCTCCCAGGGCAAGGAGAGGCGCCTGAGTGACGGCTCCACCCTGCCTGGGGAGGAATG
CCAGAGATGAGGAAGTCCGTGAAGGCGTTAAGTGGGGAAGGCAGGGGAACCAGTGGATAA
CAATTTGTGTTGCCTTAGTCCGGGAAGAATGCTGAAGGCAGCTGTGGTCCAATGAGCTCG
GCATAGGATTTGGAGTAGGAAGGTCTGGGTTCAGTGCCCACCTCTGCCACCACGTGATGT
TGGATAAATCACTTCACTTGTTTTGCTGGCTGTGAGATGAAAATTCTACAGTAATGATGC
TGGCATTTAGTGGATACTTACTGTCAGGGGGTATTTAAGCACTATGTGTAGCGATTTATT
TACTCCTCCCAGCAGCCCACGGATGGTGGTGCTATTGCAAATAGAGGAACTGAAGGGCAG
AGAGGCTTAAGTAGCTTGCCAGGGTCACACAGCTAGTGTGTTGCGGAACAAGTGTTGACC
CCCGCATGGCTATCTCAGTTGTGCTCCGCTGTGTCTCTTGAGGATAATAGTTCTCAAGAA
AGTGTTTTGTGAATGGTAACACAGTTACTAATGGGTAAAATACCTACCAACAATGACCAG
AACACATGAGGATGCTCAGATGGTATGCAAATAATAAATTAAGGAGACAGAGTTGGGGCA
GAGGGAGGGAAAGAACCCTCCCAGATATACATAAGGCAGGTCCTTTAAATGGAGACCCAC
TTAAGGGAATGATAATGTTTTCTTTAGTGTCCCCTAGTATTTATCATAGGATTACTATGT
TTTTAGACTGCCTGCAAAGCCAGGGCACTAAAGGCTGAAACTCTATTTATAATAAGAGTA
ACTTGATTCAGCTTCTGTTGTCTAGAATACAGATTTGGTTAAAAATTCTTTCTTTAGTTT
GAGGTGAGGGGTAAGTGGAACATTGGCACCAACGACCTGTTCCAAGTCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTAT
GTCTTAACTTCCAGGCCCAACATGCCCCATGTGATCTTTTTTACCTTATTTTTATTTTTT
AGAAGAGAGAATTTTAAAAATATGTATATTTGTTCAGCTAGTGCTGCGGCTCACTAGGCT
AATCCTCCGCCTTGCGGCGCCGGCACACTGGGTCCTAGTCCCGGTTGGGGCGCCGGATTC
TGTCTTGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTGTGGCCAGGGAGTGCAGTGGAGG
ATGGCCCAAGTGCTTGGGCCCTGTACCCCATGGGAGACCAGGATAAGTACCTGGCTCCTG
CCTTTGGATCAGCGCGGTGCGCCAGCCGCAGCGCGCCAGCCGCGGCGGCCATTGGAGGGT
GAACCAACGGCAAAAAGGAAGACCTTTCTCTCTGTCTCTCTCTCTCTCACTGTCCACTCT
GCCTGTCCAAAAAAAAAAAAAAAAAAAAAGTATATTTGTTCTACTTATTTCAGAAACAGG
AAGAGCACCCATCCTCTGGTTTATTCCCCAAGTTCCTGCAACAGCTAGAGCCTGTTCAGG
CCGAAGCCAGGGGTCAGGAACTCATTCTGGATCTCCTATATGGGTGACAGGGACCTAACT
GCTTTTGCCATCACTTTCTACCTCCCCAAGTGCACATAAGCAGGAAGCTGGAACAAGAAT
TGAAGCAAAGACTCGAACTCAGACACTAACACACCATGCCGGCAGGCCAAATACCTCCCC
CAACCATGTGACTTTTTTTTTTTTTTATTTGACAGGTAGAGTTAGACAGTGAGAGAGAGA
GAGAGAGAGAAAGGTCTTCCTTTTCCTTTGGTTCACCCCTCAATGGCCACTGTGGCTGGC
GCGTTGTGGCCGGCGCACCGTGCTGATCCAAAGCCAGGAGCCAGGTGCTTCTCCTGGTCT
CCTATGAGGGTGCAGGGCCTAAGCACTTGGGCCATCCTCCACTGCACTCCCGGGCCACAG
CAGAGAGCTGGACTGGAAGAGGGGCAACCGGGACAGAACCTGGTACCCATATGGGATGCC
GGTGCTGCAGGTGGAGGATTAACCAAGTGAGCCACGGGCGTCAGCCCCCAATGTGGCCTT
TTTAAATGACTCTTACCGGGCTTTAAGTTTTTGTATGTGCTGGCCTGCTGTGGGCAGTCA
GCACAGTTTAATGACTGAATGCCCCTTGCATGGAGGCCAGTTGATGTAGTGGTACAGTGT
GGGCTTTCTAGTGGTGTTCGATTCCAGTCTCACCTGTGCCACTTGACTGGCTTAGTGACC
TTGGGCAAGTTACATGTGACCTTGGATCTGTAGTTTGCAGAATGTGGTTTGTAGATAATC
CAGCTCCCTGGATTATTGCGAGGACTGTGTATTAAATTTCCTGTCATGGTGCCAGGCTCA
AAGGAGACTTACACGGGATTGATTCAAAGCTGTTTTCAGTTGCCCTGTTGTATGCGACAC
CTAGACACACTGTATGCTTTTTCAGGAACCCATAAGAAAAGATGAATTGTTAACTGGAGA
TGTTTGTTTTTTCTTTGCCTTCCACAGGGCTGTGCTTAAGAGTAAAACTTCAGCGGTGTT
TGCCATTTAAACACAAGGTAAGGACGATGCTCATTGTTGGTGTTTAGGATAGTTCTGTTA
TGAATTCACATACTGTGCAGTCACCTACTTAAAGTATACGACTCAAGAGGCTGGCATTGT
TGCACAATAGGTTAAGCTGCCATTTAAAACACTAACATCTCATGTCAAAGTGGCAGTTCC
TATTCTGGCTACTCTGCTTCTGATCCAGTTTGCTGCCAGTGTGCCTGGGAAAAGGCAACT
GCTGATGGCCCTAGTACTTGGGCCCCTTGCCACCCAGAGGGGAGGCCCAGATAGACTTCC
AGGCTCCTGGCTTTGGCCTGGCCCAAGTCTGGCCATTGTAGCCAACTGGGGAATAAACCA
GCAGTTGTAATACCCAGCTCCCTGGATTATCATGAGGTATAATTAAGACTATATATTAAA
TTTCCTATCATGGTGCCAGGCTCAAAGGACACTTACACTGAATTGATTCAAAGCTGTTTT
CAGTTGCCCTGTTGACCTATCACTGTTTCTCTGTCACTCTACTTTTCAAATAAATAAATA
AACCTAAGAATAGATAAAGTATGCAGTTCAGTGGTTTTTAGTAATGTAGATTCTTTACCC
ATGTTTAAATTGAGTTGACTTTTTATTATTGATTTGTAATGGTTCTTTATGTATTCTAGA
TACAAGTCCCTTACTGTTTATATGAATGGCAAATAGTTTCTTCCATTCTATGAGTTATCT
TCCCACCTTTTAAAAAATTTTTTTAAGATTGATTTATTTATTCAAAAAGCAAAGTGACAG
AGAGACAGAGAGAGGCAAAGAGAGATCTTCCATCTAGTGGTTTACTCTCAAATGACTATA
AGAGCCAGGGCTGGGCCAAGTCAAAGCCAGGAATCAAGAACTTCATCCTGTTCTCCCACA
TGGGTGGCAGAGTTTGCTGCTTTCCCAGCTGTACTAGCAGGAAACTGGATTGGAAGTGGA
GAGGTTGGGATTTGAACCGGTGCACTGATATGGGATGTCAATATCATAAGCTTAACCACT
GTGTCACAATGCTGTCCTCTTCTCATTCTTTTTCTTTATTTTTTAGAAAGATTTATTTAT
TTATTTGAAAGGCAGAGCATCAGAGAGAGACGGAGAGAGGGGGAGGGGGGACAGGGGGAG
AGAGAGAGAGAGATCCTCTGTCTGCTGGTTCACTTCCCAAATGGCCGCAACAGCCAGGTC
AGGGCCAGGCTAAAGCCAGGAGCCTGGAACTCCATCTGGGTCTCCCATGTAGGTGGTCGG
GTCCAAGCACTTGGGCCATCTTTTGCTGTTTCCCTAGGTACATTAGCAGGAAGCTGGATT
GAAAGTGGAGTAGTTGGATTTCAAACTGACACTCTGCTATAGACTGTCAACATCACAAGC
AGTGGCTTAACCAACTGCACCACAGTGCCCTCAGGGAGAGACGCTGAGAGCTCCATCTGC
TGGTTCACTCCCCAAATGCCCAAGACAGCTGGAGCTGGGCCAAGGCCAAGCCGGGAGCCA
GAAGCTTTCTCCAGGTTTCCCATGCAGGTGCAGGGGCCCAGGCACTTGGGCCATCTTGTA
CTGCTTTCCCAGGCCGTAGCAGAGAGCTGGATCAGAAGTGGAACAGCCAGCACTCCAACT
GGCAACCATATGGGATACTGGCACTGTAGGCGGTGGCTTTACCTGCTATGCCACAGCGCT
GGCCCCAATTTAATAATTTTTTAAAGTAAATGAGTATGGAGTGATTCTGTACCTGTTATT
TTGTAATCTGGAATAAATGTTATACCAGTAGGGGAATTTTTATGATGTCTTTTAAAACAG
GTTGAACTAGATGATCTCTCAGGTCTCTTTTAGCTATAATAGGTTATGGTTTTATTTCAC
TCATGAAAAACATGTATCTCAGTAGTAAATAATGAGGGTTAGTTAATTTGCACCAGTCTT
CTCTGGAGAGTGGATATCTTTATCAAATACATGATTTTTTTGTCGCAGAATTTGCACTAA
TTTTGTGGGTTGTCTCAAAAGCTCTGATTCTAGGAGGGTACAGCAGGGTCAGAAGGGATA
TCCTGACCAATATTATTCATAAAAATAAATTTAGCAAGATAATAATGAATGTGAATAGAG
GATAGCTTAAACTATATATATTGTGATCCCATTTTTGTAAAATAAGCAATGAAAAGAAGC
TTCCAGTTTTTGAGTGTGTGTGTGTGTGTAAAATCTGTAAGATTATGTGAATGTAAGCAA
AAATAGGAAAGAACCTGCCCCAGAGTGTTCATGTGGCTTTCCCAGAGGCTGGGGCAGGAG
GAGGTGTAGGTCCTGACTCAGACGGAGTAGAGTGCAGGGAAATACAATTGTGAGTAAGAC
TGCAGGTCTGATCCTCGTTTGTGTCCCCTTGTGCTTATGTGTGTTTATGAAAACACTGAA
TGGAGATGCCCCCAGCAAGCCTTTCCCAAGTGACCAAAAATAAAAATGTGAAAAGATTTA
CCCCCAAGTCTTTAGAAACAGAATTTAGGTTGTCGTTCCAGGATTCTGCAGTCCTTGGTG
CTTTCCACCTTATCTGTCATCTTAGAATGTTCTCATGTTTGTTTTGACTATTTTTCCTCC
CCAGTTGGAGATCTACATTTCTGAAGGAACTCACTCAACAGAAGAAGACAGTAAGTGCCA
ATCTTGAGACTTTTTTTTTTTTTTTTAATTAATTTGAAAGGCAAGGTTAGAGCGAGGGAA
AGACAGAGAGAGGGATCTTACACATGCTGGTTCACTGTCCAAATGGCTACAATGGCTGGG
GCTGTGCCAGGCTCAAGCCAGGAGCCTGGAGCTTCATCCCTGTCTGCTGGGTGGGTGGAA
GTCAAGCAGGTAAAACTTTAGGGACTCTTGAGGTATGTGCTGTGTCTCTGGATTGGTGTA
GAAGAATGGGAGTGGGGAACCTTTTTGTGTATAGACTTTGACCTACAGAGAAATCAATCA
GTAATCACTTAAAAATAGCAAAAGTAAGGTTTGAGAAAAACAAAAGACAAAATGTTCTAG
ATGGTCTGTATGTTCCATTAAAAACAATTTTATGGGGTTGGCATTGTGGCTTAGCAGATA
AAGCTGCCGCCTGTGACAATAGCATTCCATATGGGCTCTGATTTGAGTCCTGGCTGCTCC
ACTTAGGATCCATTTCCCGACTAATGTGCCTGGAAAAACTGGGGAAGATGACCAAAGTCC
CTGGGCTCCTGCCACCCACGTAGGAGACCCAGAAGAATCTTCTGGCTCTTGGCTTCATCC
TAGCCCAGCCCCAGTCATTGTGGCCATTTGGTGAATGAACTAGCAGATGGAAGATCTCAC
TCTCTCTCTCTAACTCTGCTTTTCAAATAAATAAATAAATATTTAAGGAAAAATTTGCCA
TTCTAGCAGGCCAGTAAAAACACTACGTGGTGTTATATGTTGACACAGTTCTGCTAACTT
TTGTCTGTGTTTTGCAGTCAACAAGCAGATCAATGACAAAGAGCGAGTGGCAGCCGCAAT
GGAGAACCCCAACTTACGGGAAATTGTGGAACAGTGTGTCCTTGAACCTGACTAATAGCT
GCTTTAAGAGCCACTGAACCGTAATTGTTTGCTATATTTGTTTAAATGCTTTGTAAAATA
TAAAAAGACTCATGTTTAATACATAGGTGATTTGTACCTCAAAGCCTTTTTTAAAGGATT
ATTTCCAAGTGAGATTTAATTATAAGCTAGGACCTAACTTGTTCAGTGTATAACATTCTC
AGGATTTGTAACACTTAAGTAATCAGACAGAAAAATATTTTCTAGCTATTATGTGTAAGA
TGAGTCGCTATTTTTCTGATGCCCATTCTGATAAAACTGCTTTTCATGTCAAACACCTAC
CGTGCCCAAAGGTGTTCACTTTAAATCATTATTCTGTAAAATAAAAAAAAAAAATATGAT
TCTTGTAATGACTCAGCTTAAAATGTGTTTATTGAACTGTAAATGCCGGTGTAATTGTTG
ATTCCCAAAAGAACTTTCCACAGCTTTATTTTTGCTGATTATAAGGTGAAATCACTTCTA
AGATCCAAAAGGTACCTGGAAGATGAGATCCTGCCTTCCTTCGGTGAGAGTCGGCCCCAT
CTATAGAAGAGCAACCAACGCAGGCCAGAGGACAGACTCAAGTTTGTAAAAATGTTTGTT
TAATTATTCTAAAGGTAGAGAGATCTCCCACCCACTGATCCACTCCCCAAATGCCTGAAA
AAGCCAGGGCTGGGACAGGCTGAAGCCAGGAATTGGGAACTCGACCTGGGTCTCCCATGT
GAGAGGCAGAGACACAAATACTTGAGCCATCACCTGCTGCCTCCCAGAGTGCACGTGAGC
GGGAGCAGGATGCAGAACAGAGCTAGCACTGAACCCGTGCCTGGGGTTTGGGGTGGAGGT
GTCCCAGGCGGTGGCTTAACTCTTATGCCAGTGCCTGTTCCAACATATAATTTTACTTTT
TAAAAAATATTTTTATTTATTTTGAAAGAGAGAGAGAGCGCGCGCATGCTCCCAACAGTC
AGGACTGGGCCAGACCAGAGCCAGGAGTTTCATCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1124, 1375..1539, 9927..9976, 12544..12589, 13397..13494
1001..1124, 1375..1539, 9927..9976, 12544..12589, 13397..13491
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved